ID: 908142946

View in Genome Browser
Species Human (GRCh38)
Location 1:61206436-61206458
Sequence CCAATTTCACAGTGTTGACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 214}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908142944_908142946 7 Left 908142944 1:61206406-61206428 CCTTGGCTGCTAACAAGTTTTCA No data
Right 908142946 1:61206436-61206458 CCAATTTCACAGTGTTGACTAGG 0: 1
1: 0
2: 1
3: 17
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908142946 Original CRISPR CCAATTTCACAGTGTTGACT AGG Intronic
902046132 1:13525994-13526016 GCAATTTCACAGTGTTAGCCAGG + Intergenic
902327451 1:15710981-15711003 CCAGTTTCACCGTGTTGGCCAGG - Intronic
906129772 1:43449133-43449155 CACATTTCAGACTGTTGACTCGG + Intronic
908142946 1:61206436-61206458 CCAATTTCACAGTGTTGACTAGG + Intronic
908303038 1:62781187-62781209 GGAAGTTCACAGTGATGACTAGG - Intergenic
911273552 1:95832578-95832600 ACATTTTCACAGTGCTGGCTGGG + Intergenic
911355490 1:96813389-96813411 CCATTTTTAAATTGTTGACTTGG - Exonic
911687964 1:100798894-100798916 CCAATTTTACAATCTTAACTTGG - Intergenic
912785918 1:112604114-112604136 AGGATTTCACTGTGTTGACTAGG - Intronic
914866906 1:151438015-151438037 GGAGTTTCACAGTGTTGACCAGG - Intronic
916097560 1:161364794-161364816 CCTGTTTCACAGTTCTGACTGGG + Exonic
916511391 1:165475021-165475043 CCAATTCCTCAGAGCTGACTTGG - Intergenic
917332928 1:173901071-173901093 CAAACTTCACAGTGCTGACAGGG - Exonic
918420105 1:184355590-184355612 CTTATTTCACAGTCTTGTCTGGG - Intergenic
918732777 1:188019055-188019077 TCAGTTTCACAGTGTTTACATGG + Intergenic
919806418 1:201383352-201383374 CCAACTTCACTGTGTTGTCTGGG + Exonic
922242631 1:223765814-223765836 CCAGGTTCACATTGGTGACTAGG + Intronic
923978324 1:239290462-239290484 CAAGTTTTAAAGTGTTGACTAGG - Intergenic
924825367 1:247532651-247532673 ACAATTTCACTGTGTTGCCCGGG + Intronic
1063599591 10:7468251-7468273 CCGATGACATAGTGTTGACTAGG - Intergenic
1063758130 10:9039495-9039517 CCAAGATCAAAGTGTTGTCTGGG + Intergenic
1064383598 10:14869484-14869506 ACAGTTTCACTGTGTTGACCAGG + Intronic
1065127287 10:22585785-22585807 CGGATTTCACTGTGTTGGCTAGG + Intronic
1066340681 10:34529924-34529946 GGAGTTTCACAGTGTTGACCAGG + Intronic
1069735797 10:70653310-70653332 CCAGCTTCCCAGTGCTGACTTGG + Intergenic
1071470514 10:85980892-85980914 CCCATTTCACAGTGAGGATTTGG + Intronic
1074308711 10:112302544-112302566 CCAATTTCACAGAGGAAACTAGG - Intronic
1077620068 11:3713525-3713547 CGAGTTTCTCAGTGTTGACCAGG - Intronic
1078920486 11:15826111-15826133 CCCACTTCCCAGTGTTGCCTGGG - Intergenic
1079969877 11:27023910-27023932 CCAATGTTACAGTGTTGATTTGG + Intergenic
1080760817 11:35247286-35247308 CAAATTCCAGAGTGTAGACTGGG - Intergenic
1086569055 11:88262473-88262495 ACACTTTCAGAGTGTTGACAGGG - Intergenic
1086575476 11:88335260-88335282 CTAACTTCACAGTCTTGCCTCGG - Intronic
1087531632 11:99389217-99389239 CAAGTTTCACCATGTTGACTAGG + Intronic
1088797692 11:113277630-113277652 CCACTTTGACAGTCTTGACAAGG - Exonic
1090663516 11:128899496-128899518 CCAATTTATCAGTGATGATTAGG - Intronic
1091483852 12:864300-864322 ACAGTTTCACCGTGTTGGCTAGG + Intronic
1092098621 12:5864473-5864495 ACAATTTCACTGTGATGAATAGG - Intronic
1093935235 12:24993822-24993844 CCAAAGTGACAGTGTTCACTTGG - Exonic
1096477659 12:51918146-51918168 CCAAGTTCACAGTTTTTAGTAGG - Intronic
1099629865 12:85128920-85128942 CTGATATCAAAGTGTTGACTGGG + Intronic
1100326023 12:93540514-93540536 CTAAAATCACAGTGTTAACTGGG - Intergenic
1100686580 12:96992882-96992904 CCAACTTGACAGTCTTAACTAGG - Intergenic
1100818809 12:98411950-98411972 GTAATTTCACTGTGTTGCCTAGG - Intergenic
1102753598 12:115318511-115318533 CAGATTTCACCATGTTGACTAGG + Intergenic
1105960079 13:25325757-25325779 GCCATTTCACAGTGTTGCCTAGG + Intronic
1107639996 13:42432097-42432119 CTAAAATCATAGTGTTGACTGGG - Intergenic
1107705835 13:43103867-43103889 CCAATTTCACAGTGTTACAAGGG - Intronic
1108721887 13:53140648-53140670 CCAAAATCACAGTGTAGACTGGG + Intergenic
1110677883 13:78271390-78271412 CCAGTTGCACTGTGTGGACTTGG + Intergenic
1111020952 13:82451006-82451028 CCTATTTCTCAGTATTGATTTGG - Intergenic
1113978113 13:114247357-114247379 CGAATCTCACTGTGTTGCCTAGG + Intronic
1115950052 14:38710811-38710833 CCAATTGCCCAGTGTTTCCTGGG - Intergenic
1116900789 14:50360727-50360749 CCACTTTCAGATTTTTGACTAGG + Intronic
1118487926 14:66231734-66231756 CCAATTTCAGAGAGTTTTCTGGG - Intergenic
1119608781 14:76044229-76044251 CCAGTTTCACTATGTTGACCAGG + Intronic
1120284887 14:82487144-82487166 CTGATTTCACAGTGGTGACAAGG + Intergenic
1120913210 14:89686845-89686867 CACATTTCACAGTTTTAACTGGG + Intergenic
1122954523 14:105064357-105064379 CCAATTTGATAGTGTTGCCCAGG + Intronic
1125701596 15:41690557-41690579 TCAATATCACACTGTTGACTGGG + Intronic
1128385296 15:67143623-67143645 CCATTTTCACCATGTTGACCAGG + Intronic
1129409023 15:75338712-75338734 CCAAGTTCCCAGGGTTGCCTGGG - Intronic
1132158174 15:99511827-99511849 CCAAGTTCCCAGAGTTGGCTGGG + Intergenic
1133817411 16:9208765-9208787 CTAATTTCACAGAGTTTTCTGGG - Intergenic
1135031710 16:19044057-19044079 ACAGTTTCACCATGTTGACTAGG + Intronic
1137888099 16:52128142-52128164 CCTATTTCACAGAGTTGGCTTGG - Intergenic
1138613753 16:58148052-58148074 CCAAAATCAAGGTGTTGACTGGG + Intergenic
1140872197 16:79117200-79117222 ACAATTTCACCGTGTTGCCCAGG + Intronic
1141191651 16:81829407-81829429 CCAGTTTCACCATGTTGACCAGG + Intronic
1141349323 16:83278381-83278403 CCCATTTCAGAGGGTTGTCTTGG - Intronic
1142316479 16:89349762-89349784 CCAACTTCATAGTTTTGTCTTGG - Intronic
1142573464 17:890954-890976 CCATTTGCAAAGTGCTGACTTGG + Intronic
1144016840 17:11204242-11204264 CCAAGATCACAGTGTTGGCAGGG + Intergenic
1146147677 17:30435785-30435807 CCAAAATCACAGTGTTGGCAGGG + Intronic
1147552107 17:41450726-41450748 CCAATTTCAGGGGGTTGACCAGG - Intergenic
1150059284 17:62050411-62050433 CCAATATCCAAGTGTTGAGTCGG + Intronic
1153839813 18:8996654-8996676 GGAGTTTCACAGTGTTGACCAGG + Intergenic
1155627088 18:27846792-27846814 CCAATGTAACAGTGTTGAGGCGG - Intergenic
1158278511 18:55794944-55794966 CCAGTTTCACATTCTTAACTGGG + Intergenic
1159532450 18:69671906-69671928 CCAATTTCTTAAAGTTGACTGGG + Intronic
1161648476 19:5469302-5469324 ACAGTTTCACTGTGTTGGCTAGG - Intergenic
1161762788 19:6186886-6186908 CCAATTTCACTGTGTTGCCCAGG + Intronic
1164310089 19:24037936-24037958 GGAATTTCACCATGTTGACTGGG + Intronic
1165563874 19:36706483-36706505 ACAATTTCACCATGTTGCCTAGG + Intronic
1166910862 19:46155365-46155387 TCAATTACACAGAGTTGGCTGGG + Intronic
925095984 2:1203297-1203319 CCAGTTTCACAGAGTTATCTGGG - Intronic
925779496 2:7369348-7369370 CCTTTTTCACAGTGTGGAGTTGG - Intergenic
925859878 2:8163768-8163790 CCAATCTCACAGGGGTGGCTGGG + Intergenic
928034580 2:27810035-27810057 TCATTTTCACAGTGTAGACCTGG - Intronic
928980699 2:37132816-37132838 TCAATTTCCCAGTCTTGTCTTGG - Intronic
929493766 2:42421618-42421640 TCAATTTCTCAGTGTTTATTTGG + Intronic
929727109 2:44441368-44441390 ACAGGTTCACAGTGATGACTCGG + Intronic
930181865 2:48368140-48368162 CCAAATTCATGGTGTTGACACGG + Intronic
930858474 2:56044360-56044382 CCAATTTCACAGTCTTCATATGG - Intergenic
931874425 2:66496458-66496480 CCAATTTCATAGTGTGCACGGGG + Intronic
933346132 2:81087952-81087974 CCAATTTCACAATTTTGCCACGG - Intergenic
935692004 2:105740520-105740542 CCAGTTTCACAGTCTTGAGTGGG + Intergenic
939758312 2:146141107-146141129 CCAATTTCATCGCATTGACTAGG + Intergenic
940804168 2:158167167-158167189 CTAAAATCACAGTGTTGACAGGG - Intergenic
941239719 2:163021660-163021682 CAAATTTCTCAGTGCTGAGTAGG + Intergenic
943022747 2:182595137-182595159 CCTATTTCACAGTGTTCTCAGGG + Intergenic
944015754 2:195035170-195035192 CCAATTTCAGAGTCTTGGCAAGG + Intergenic
946109448 2:217401493-217401515 CCAATTTCTCAGTGATGTCATGG - Intronic
946257729 2:218458378-218458400 GCAATTTCACCATGTTGGCTAGG - Intronic
946319180 2:218939826-218939848 CCAGAATCACAGTGTTGACAGGG - Intergenic
946745020 2:222836931-222836953 ACAGTTTCACAGTGTTGGCCAGG - Intergenic
948672180 2:239575590-239575612 TGAATGTCACAGTGTTAACTGGG + Intergenic
1169312297 20:4554405-4554427 CCAATTTCTCAGTGTTTGCAAGG + Intergenic
1169577066 20:6975549-6975571 CCAATTTCTCTCTGTTTACTTGG + Intergenic
1173262370 20:41448036-41448058 AGAATTTCCCAGTGTTAACTTGG - Intronic
1174608321 20:51777856-51777878 AGGATTTCACTGTGTTGACTGGG + Intergenic
1176230676 20:64031177-64031199 CCATCTTCTCAGTGTTCACTGGG + Intronic
1177476579 21:21631753-21631775 TCATTCTCAAAGTGTTGACTGGG - Intergenic
1178816684 21:35936398-35936420 CCAAAATCACAGTGTTGACAGGG - Intronic
1181905349 22:26190577-26190599 CCAATTTCACAGGGTTGTGGAGG + Intronic
1183985509 22:41567990-41568012 CCAATTCCACAGCCTTGTCTAGG + Intronic
1184634487 22:45816056-45816078 ACAGTTTCACCATGTTGACTAGG - Intronic
1185133008 22:49051269-49051291 GCAGTTTCACCGTGTTGACCAGG - Intergenic
949272275 3:2232269-2232291 CCAATTTTACAGGGTTTACAGGG + Intronic
951976457 3:28516047-28516069 CCGGTTTCACTGTGTTGACCAGG - Intronic
954006556 3:47595924-47595946 CGAGTTTCACAATGTTGGCTAGG + Intronic
956716784 3:72086476-72086498 GCCATTTCACAGTGCTGCCTGGG - Intergenic
958905400 3:99936565-99936587 GGAATTTCACAGTGTTGGCCAGG + Intronic
959144421 3:102527127-102527149 CCAAGTTCACAGAGATGATTCGG + Intergenic
961632578 3:128312221-128312243 CCTACTTCACAGGGTTGTCTAGG - Intronic
962701605 3:138005654-138005676 CCAAATTCACAATGTAGACTAGG + Intronic
962892575 3:139685461-139685483 CCATTTTCACAGTGGTGCCCTGG + Intergenic
963785201 3:149527586-149527608 CCATTTTCAAATTCTTGACTAGG + Intronic
963959888 3:151297682-151297704 CCTACTTCACAGTGTTGCTTAGG + Intronic
964573523 3:158138782-158138804 GCAATTTCACAGGAATGACTTGG - Intronic
966323581 3:178729326-178729348 CCCATCTCACAGTATTGATTAGG + Intronic
975132845 4:70845811-70845833 CAAATTTCACCATGTTGACCAGG + Intergenic
975826457 4:78324810-78324832 ACAATTTGGCAGTGGTGACTGGG + Intronic
976796519 4:88939957-88939979 CCAAATTCACAGTATTAACTGGG - Intronic
980424316 4:132606946-132606968 CCAAATTCAAAGTGTTCTCTGGG + Intergenic
980627813 4:135396461-135396483 CCAATTTCACACTGCTGATAAGG - Intergenic
982472649 4:155811931-155811953 ACATTTTCACCATGTTGACTAGG - Intergenic
983637810 4:169916067-169916089 GGAATTTCACCATGTTGACTAGG + Intergenic
986304330 5:6504350-6504372 CCAAGATCACAGTGTTGGCTGGG + Intergenic
987480948 5:18457129-18457151 CCAATGTCAAAGTGTTGACAAGG - Intergenic
987760962 5:22162524-22162546 CCAATGCCAAAGTGTTGACCAGG + Intronic
987953786 5:24710979-24711001 ACAATTTCACCGTGTTGGCCAGG - Intergenic
988182011 5:27807387-27807409 ACAATTTGACAATGTAGACTGGG - Intergenic
988845446 5:35122961-35122983 CCAATTGGCAAGTGTTGACTGGG + Intronic
990279857 5:54238464-54238486 TCAAATTCACAGACTTGACTTGG - Intronic
990324338 5:54660202-54660224 CCAAGATCACAGTGTTGGCAGGG + Intergenic
991184775 5:63794461-63794483 CCAATTTCCCAGTTTGGAATGGG - Intergenic
991354312 5:65751942-65751964 GAAATTTCACAGTGTTGGCCTGG + Intronic
991895742 5:71395986-71396008 CCAATGCCAAAGTGTTGACCAGG + Intergenic
992299563 5:75364320-75364342 CCCATTTCACTGTCTAGACTTGG + Intergenic
992944249 5:81794094-81794116 CCAATATCACACTGAAGACTTGG + Intergenic
993621362 5:90171964-90171986 CAAATTTCTCAGTGTGGTCTAGG + Intergenic
993665600 5:90691574-90691596 GGAGTTTCACAGTGTTGGCTAGG + Intronic
993801953 5:92352632-92352654 CCATTTTCACACTGTTGATAAGG - Intergenic
995234669 5:109814045-109814067 CCAATGTCACAGTGAGAACTAGG + Intronic
997055020 5:130432422-130432444 ACAATTCAACAGTGTTAACTGGG + Intergenic
997814522 5:137003211-137003233 ACAGTTTCACCGTGTTGACCAGG - Intronic
998534338 5:142915549-142915571 GGAATTTCACCGTGTTGGCTAGG + Intronic
998950051 5:147384618-147384640 CCACTTTCACATTGTTGAAGAGG - Exonic
1000657973 5:163904895-163904917 CCAAAATCACAGTGTCAACTAGG - Intergenic
1002756524 6:165788-165810 ACAGTTTCACTGTGTTGCCTGGG + Intergenic
1004814748 6:19300806-19300828 CCATTTTCAATGTTTTGACTAGG + Intergenic
1005907478 6:30276823-30276845 CCAATTTCACACTGATACCTGGG + Intergenic
1006173948 6:32110546-32110568 CCAGCTTCACAGTGAGGACTGGG + Intronic
1008442140 6:51543856-51543878 TCAATTTCAAAATGTTGCCTGGG + Intergenic
1008563987 6:52749450-52749472 CCATGTTCAGAGAGTTGACTGGG + Intergenic
1009544288 6:65004634-65004656 CCAAATTCACAGTGATAACTTGG + Intronic
1010277531 6:73987173-73987195 CCAAGATCAAGGTGTTGACTGGG - Intergenic
1011384051 6:86775066-86775088 CTAATTTCACAGTTTTGACTGGG - Intergenic
1011471616 6:87713451-87713473 CACGTTTCACACTGTTGACTTGG - Intergenic
1011897422 6:92247391-92247413 AGAATTTCACCATGTTGACTGGG + Intergenic
1013012134 6:106130495-106130517 CCAAATACACAGTGTTGTTTTGG + Intergenic
1013234318 6:108183621-108183643 CCAAATGGACAGAGTTGACTTGG - Intronic
1015251135 6:131129093-131129115 CAAATTTCACCATGTTGGCTAGG - Intergenic
1015308633 6:131739352-131739374 TCAACTTCACAGTGTAGACATGG - Intronic
1016732091 6:147438183-147438205 CCAAGTTTACAGTGTTGAAATGG - Intergenic
1016912091 6:149209132-149209154 CTAATTTCAAAGATTTGACTGGG + Intergenic
1018147969 6:160911038-160911060 CCAATTTCACTGTGTTAGCCAGG + Intergenic
1020685319 7:11286473-11286495 TCAATTTCTCATTATTGACTAGG + Intergenic
1021282767 7:18740466-18740488 CCAAGTTCACTGTCTTGATTGGG - Intronic
1021493372 7:21245267-21245289 CCTATCTCACAGTCTTAACTAGG + Intergenic
1022237612 7:28477236-28477258 ACAATTTCCCAGTGTGGATTTGG + Intronic
1022399399 7:30023013-30023035 CAAATTTCACATACTTGACTGGG + Intronic
1022644837 7:32220418-32220440 CCCACTTCTCAGTGTTGATTTGG - Intronic
1022945958 7:35283912-35283934 CCAAGTTCAAGGTGTTGACAGGG - Intergenic
1023624760 7:42105049-42105071 GCAATTTCACAGTGTTTCTTTGG - Intronic
1023973213 7:45007095-45007117 CCATGTTGACAGTGTAGACTTGG - Intronic
1024627656 7:51221994-51222016 AGAATTTCACCGTGTTGACCAGG - Intronic
1024628458 7:51228529-51228551 AGAATTTCACAGTTTTGACCTGG + Intronic
1024659552 7:51479783-51479805 GCAGTTTGACAGTGTTTACTTGG - Intergenic
1026929242 7:74214826-74214848 GGAATTTCACCGTGTTGCCTAGG + Exonic
1027511092 7:79081107-79081129 CCAATTTGACAGTGTACACAAGG + Intronic
1028710975 7:93907776-93907798 CCAAAATCCCAGTTTTGACTGGG - Intronic
1029043047 7:97597719-97597741 ACAATGTTACAGTGTTGCCTGGG + Intergenic
1030112141 7:106035872-106035894 CCAATTTCCCAGCGTTGACCAGG + Intergenic
1030816450 7:114044980-114045002 CCTAGTTCATAGTTTTGACTGGG + Intronic
1031519990 7:122752402-122752424 CAAATTTCACAGTGTTATCCAGG - Intronic
1033823834 7:145165047-145165069 CCCATTTCGCAGTGTGGCCTAGG + Intergenic
1035328768 7:158083063-158083085 CCACTCTCACAGTGCTCACTCGG - Intronic
1035891899 8:3354179-3354201 CCAATTTAACTGTATTGAATAGG - Intronic
1038855460 8:31327050-31327072 CCATTTTCACAATATTGATTAGG - Intergenic
1038946170 8:32362696-32362718 GCAATTTGAGAGTGTTTACTTGG - Intronic
1039908580 8:41806143-41806165 CCAGTTTCAAAGTGTAGCCTGGG - Intronic
1040018256 8:42717716-42717738 CCTAGCTCACAGTGTTGTCTGGG + Intronic
1040393703 8:46974376-46974398 ACACTTTCACAGTGTTGTCATGG + Intergenic
1041228810 8:55728914-55728936 GCCATTTCACAATGGTGACTTGG - Intronic
1041318827 8:56592943-56592965 CAAATTTCACAGTTTTGACAAGG + Intergenic
1045480843 8:102590927-102590949 CCACCTGCACAGTCTTGACTGGG + Intergenic
1046154628 8:110271600-110271622 ACAATTTCCAAGTCTTGACTAGG - Intergenic
1050433231 9:5583512-5583534 ACAAGTACACAGTGCTGACTGGG - Intergenic
1050483692 9:6112328-6112350 CTATTTCCACAGTGTTTACTAGG + Intergenic
1052458315 9:28729826-28729848 CCAAATTCAAAGAGATGACTAGG + Intergenic
1056977877 9:91276863-91276885 CCATTTTCACATTCTTTACTTGG - Intronic
1058703313 9:107618931-107618953 CCATTTTCTGAGTGCTGACTTGG + Intergenic
1059718223 9:116933289-116933311 CCAATTTTACAGCATTGACTGGG - Intronic
1203489297 Un_GL000224v1:88018-88040 TCAATTTCACAGAGTTTAGTCGG + Intergenic
1203501918 Un_KI270741v1:29913-29935 TCAATTTCACAGAGTTTAGTCGG + Intergenic
1185913278 X:4006131-4006153 CTAAAATCAAAGTGTTGACTAGG + Intergenic
1186460136 X:9741693-9741715 CAAATTTCACTGTGTTGCCCAGG - Intronic
1187491355 X:19754658-19754680 CCAGTTTCACCATGTTGACCAGG + Intronic
1187781419 X:22830443-22830465 TCAATTTCACAGTTTTCACATGG + Intergenic
1189052427 X:37660420-37660442 TCAATTCCACAGAGTTTACTGGG - Intronic
1191912347 X:66164311-66164333 CCAATTTGGCAGGGTTTACTGGG - Intronic
1192535681 X:71925239-71925261 CCAAATTGACAGTGGTGTCTGGG + Intergenic
1192676422 X:73201857-73201879 CCATTTTCACACTGTTGATAAGG + Intergenic
1194580588 X:95666079-95666101 CCAAGTTCACAGGGTTGAGAAGG + Intergenic
1195362186 X:104093868-104093890 CCAATGTAACAGTGTTGAGAGGG + Intergenic
1195791590 X:108594051-108594073 TCAAGTTCAAAATGTTGACTAGG - Intronic
1196104892 X:111885073-111885095 CCACCTTCACTGAGTTGACTAGG - Intronic
1196376879 X:115042959-115042981 CCAAGGTCACAGAGCTGACTGGG - Intergenic
1200852770 Y:7902819-7902841 CAAAACTGACAGTGTTGACTTGG - Intergenic
1200868397 Y:8070705-8070727 CCAGTTTCACCATGTTGACCTGG - Intergenic
1201546522 Y:15169568-15169590 AGAATTTCACCATGTTGACTAGG + Intergenic