ID: 908148106

View in Genome Browser
Species Human (GRCh38)
Location 1:61268762-61268784
Sequence TCCCTTTTCCTGGGAGCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 338}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908148102_908148106 14 Left 908148102 1:61268725-61268747 CCTTTGAAAACAAAGATAAGGAG 0: 1
1: 0
2: 4
3: 39
4: 443
Right 908148106 1:61268762-61268784 TCCCTTTTCCTGGGAGCTCTGGG 0: 1
1: 0
2: 3
3: 43
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908148106 Original CRISPR TCCCTTTTCCTGGGAGCTCT GGG Intronic