ID: 908150488

View in Genome Browser
Species Human (GRCh38)
Location 1:61296296-61296318
Sequence TTAAACTCCCTTGAATCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 164}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908150487_908150488 18 Left 908150487 1:61296255-61296277 CCTATCAGTATTTGACTTCAGAT No data
Right 908150488 1:61296296-61296318 TTAAACTCCCTTGAATCTCCAGG 0: 1
1: 0
2: 0
3: 12
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908150488 Original CRISPR TTAAACTCCCTTGAATCTCC AGG Intronic
900580782 1:3407648-3407670 TTAAACTTCCTTGCCTCTCTGGG + Intronic
901808189 1:11750783-11750805 TTGAACCACCTTCAATCTCCTGG + Intronic
904298989 1:29542030-29542052 TTAAACTCCCTTGACTGAGCTGG + Intergenic
904504713 1:30941872-30941894 TTAAATACCCTTGAATCTTGTGG - Intronic
904911311 1:33936445-33936467 TTCAACTCCCCTGAACCTGCGGG - Intronic
907561377 1:55392215-55392237 TTAAACCACCTTGCATCTCTGGG + Intergenic
908150488 1:61296296-61296318 TTAAACTCCCTTGAATCTCCAGG + Intronic
911349129 1:96730807-96730829 TTATACTCCCTTGAGTGTCCAGG - Intronic
915279180 1:154810611-154810633 TTAAAATCCCTTCCTTCTCCTGG - Intronic
915790186 1:158661194-158661216 TTAAATTCCCTTGAAACCCTAGG + Intronic
917443986 1:175091331-175091353 TTAAACTTCTTTAAACCTCCAGG + Intronic
918760216 1:188394838-188394860 TGAAAGTCCATTTAATCTCCAGG + Intergenic
922143248 1:222911588-222911610 TCAAACTCCCAGGAATTTCCTGG + Intronic
922275180 1:224070932-224070954 GAATACTCCCTTTAATCTCCTGG - Intergenic
922287339 1:224181920-224181942 TTAAACTCCTTTTAATCTACAGG + Intronic
923683569 1:236138948-236138970 TAAACCACACTTGAATCTCCTGG - Intergenic
1063174887 10:3542661-3542683 TTAAACTCTGTTGAATCCTCTGG + Intergenic
1064123680 10:12641042-12641064 TCAACCTCCCTTGAACCTCCTGG + Intronic
1064929453 10:20608161-20608183 TTAAACATCCTTGATTTTCCAGG - Intergenic
1066644931 10:37596764-37596786 TTGAACTCCCTTAAACCTACTGG - Intergenic
1067762488 10:49058690-49058712 TGGAATTCCCTTGAGTCTCCAGG + Intronic
1070375372 10:75825516-75825538 TTAAAATGCCATGCATCTCCAGG - Intronic
1071612707 10:87046058-87046080 ATAAACTCCCTTGACTTTTCTGG + Intergenic
1072130090 10:92485569-92485591 TGAAACTACCTTGAAACTCTGGG + Intronic
1074545525 10:114399373-114399395 TTAAACTCTCCTCAATCTTCAGG - Intronic
1078773308 11:14371146-14371168 TTAACCTCACTTGCATCTCCAGG - Intergenic
1078967950 11:16369511-16369533 TTAAACTCTTTTCTATCTCCAGG - Intronic
1080335560 11:31191933-31191955 TTAAACTTCATTGTATCTCTTGG + Intronic
1082829025 11:57601785-57601807 CTCAGCTCACTTGAATCTCCAGG - Intronic
1085136342 11:74092453-74092475 TTAATCTCCCTTTAACCCCCAGG - Exonic
1087855097 11:103082504-103082526 TTAAAATTCCTTGATTCTCTTGG - Intronic
1088701431 11:112416146-112416168 TTAAACTCTGTTGACTCACCTGG - Intergenic
1089761744 11:120731387-120731409 TTGAACTCCCTTGCATCCCTGGG + Intronic
1090280659 11:125453309-125453331 GAAAAATGCCTTGAATCTCCAGG + Intronic
1090504567 11:127297604-127297626 TCAAAGTTCCATGAATCTCCAGG - Intergenic
1091051717 11:132378612-132378634 TTAAGCTCCATTGGATCTGCTGG - Intergenic
1092525479 12:9307057-9307079 TTAAACACCATTTAATCTCTAGG - Intergenic
1092541793 12:9424763-9424785 TTAAACACCATTTAATCTCTAGG + Intergenic
1093419289 12:18956242-18956264 TTATTCTCCATTGAATCTCCTGG + Intergenic
1094511237 12:31097740-31097762 TTAAACACCATTTAATCTCTAGG - Intronic
1098158351 12:67623481-67623503 TTAAACACCATTGGATCTGCTGG - Intergenic
1100664922 12:96740898-96740920 CTAAACTTCCTTTAATCTACAGG + Intronic
1102187563 12:110961103-110961125 TTAAACTCCCTTGCAGCTGGGGG - Intergenic
1102388534 12:112531206-112531228 TTAAATACCCTTGAATCAGCTGG + Intergenic
1102961528 12:117096553-117096575 TTAAACACTCTTGTATGTCCTGG - Intronic
1103035592 12:117653920-117653942 TTAAACACCATTGGATCTGCTGG - Intronic
1105478657 13:20752466-20752488 TGAACCTTCCTTGAATCTCCAGG + Intronic
1106156089 13:27157927-27157949 TTAAACAGCTTTGAATCTCTAGG + Intronic
1109106749 13:58262277-58262299 TGAATCACCCTTGAATCTCTGGG - Intergenic
1111126869 13:83921067-83921089 TCAAAATCCCTTGTCTCTCCTGG - Intergenic
1111635445 13:90897672-90897694 TTAAACTTACTTAAATCTCTGGG + Intergenic
1116623062 14:47230728-47230750 TTAAACTCCATTCAACATCCAGG + Intronic
1117626255 14:57642068-57642090 TTAAACTCTAATGAATCTCTAGG - Intronic
1121157815 14:91703413-91703435 CTAAACTCCTTGGAATTTCCTGG + Intronic
1121429489 14:93876903-93876925 TTAAACTGCCATGGATCCCCAGG + Intergenic
1124614779 15:31233808-31233830 TCAAACTCCCCAGAGTCTCCTGG - Intergenic
1126646358 15:50878841-50878863 TTAAAGTCCCTTAACTGTCCTGG - Intergenic
1128262129 15:66239834-66239856 ATTAACTCCCTTGCACCTCCGGG - Intronic
1132286873 15:100669826-100669848 CCAAACACCCTGGAATCTCCAGG - Intergenic
1138739596 16:59292433-59292455 TCAAACACCTTTGATTCTCCAGG + Intergenic
1139067275 16:63333177-63333199 CTGAACTCTCTTGAAGCTCCTGG - Intergenic
1139783810 16:69374007-69374029 TCAAACGCCCTTGAATATGCAGG + Intronic
1143159404 17:4859243-4859265 GGAAGCTCCCTAGAATCTCCTGG + Intronic
1145083484 17:19915569-19915591 TTAAACACCCCTGTATATCCTGG - Intronic
1146253194 17:31368648-31368670 TAAAACTCCTTTGTATCACCTGG + Intronic
1148385815 17:47234074-47234096 TGAATCTCCTTTGAAGCTCCAGG - Intergenic
1149446483 17:56717311-56717333 TTACTCATCCTTGAATCTCCAGG - Intergenic
1151777164 17:76213268-76213290 TTAAAATCCTTGGAATATCCAGG + Intronic
1152979588 18:263720-263742 TTATTCACCATTGAATCTCCAGG + Intronic
1154481351 18:14829242-14829264 TTAAACTCTATTTAATATCCTGG + Intronic
1155151557 18:23127404-23127426 CTAAACTCCCTGTAATTTCCTGG + Intergenic
1156113917 18:33762966-33762988 TTAAACAGACTTGAATCTCAGGG + Intergenic
1156535058 18:37854632-37854654 CTTACCTCCCTTCAATCTCCTGG + Intergenic
1159120772 18:64167494-64167516 TTAAATTCTTTTTAATCTCCAGG + Intergenic
1159253018 18:65906592-65906614 TTCAACTCCCTTGAAACAACGGG + Intergenic
1165126163 19:33599415-33599437 CTAATCTCCATAGAATCTCCTGG - Intergenic
927384927 2:22521884-22521906 CTAAAGTCCTTGGAATCTCCAGG - Intergenic
929809177 2:45174454-45174476 TTAAACTTCCTTGCAATTCCTGG - Intergenic
932185745 2:69693955-69693977 TAAAGCCCACTTGAATCTCCTGG + Intronic
932602700 2:73139573-73139595 TCACACTGACTTGAATCTCCAGG + Intronic
933784017 2:85823974-85823996 TTGCACTTCCTTGAATCTGCAGG + Intergenic
942166672 2:173247269-173247291 ATAAACTTAGTTGAATCTCCAGG + Intronic
942632787 2:177969745-177969767 TTACACTACTTTGTATCTCCTGG + Intronic
944753486 2:202735503-202735525 ATAATCTCCCCTGAATTTCCAGG - Intronic
947953929 2:234171455-234171477 CAAAACTCCCTTGAAGTTCCTGG - Intergenic
1172843972 20:37918810-37918832 GTAACCTCCCCTGACTCTCCAGG + Intronic
1175329302 20:58151775-58151797 TGAAAATCCCTTGATTCTCCTGG + Intronic
1176799259 21:13407367-13407389 TTAAACTCTATTTAATATCCTGG - Intergenic
1177348690 21:19906451-19906473 TTAAACTTCCATTAACCTCCAGG + Intergenic
1177807718 21:25890408-25890430 TTCAACTCCCTAGAAACACCTGG + Intronic
1179636337 21:42713020-42713042 GTAAACTCACTTGTATTTCCAGG + Intronic
1180073450 21:45450120-45450142 TTTCGCTCCCTGGAATCTCCAGG + Intronic
1180626502 22:17197335-17197357 TTGAACAGCCTTGAATTTCCAGG + Intronic
1182760292 22:32717302-32717324 GTAAGGTCCCTTGAGTCTCCTGG + Intronic
949379824 3:3432085-3432107 TTAAGCATCCTTGAATCTCTAGG + Intergenic
950540137 3:13607529-13607551 TAAAACTTCCGTGAATTTCCTGG + Intronic
953216865 3:40926936-40926958 GTTAACTCCCTTGCATTTCCAGG + Intergenic
953864923 3:46575898-46575920 TTAAACCTCCTTGCAGCTCCAGG + Intronic
954003280 3:47574256-47574278 TAAAAGTCCCCAGAATCTCCTGG - Intronic
956837978 3:73111251-73111273 TTGAACTACCTTGAAGTTCCTGG + Intergenic
957284725 3:78203555-78203577 TTAAGCTCCCCTGTATTTCCTGG - Intergenic
961092411 3:124125604-124125626 TTAGACTCCCTCAAATGTCCAGG - Intronic
961118747 3:124355042-124355064 TCAAGCTCCCTGGAATCTCCTGG + Intronic
962633798 3:137308638-137308660 CTGAATTCCCTTGAAGCTCCTGG + Intergenic
966010147 3:175065109-175065131 TCAAAGTCACTTGAATTTCCAGG - Intronic
969140997 4:5071650-5071672 CTAAGCTCCTTTGATTCTCCAGG - Intronic
969178633 4:5420400-5420422 TTGATCTCTCTTGAATCTCAAGG - Intronic
970941604 4:21640830-21640852 TTAAACACCATTGAATCTGCTGG - Intronic
971454372 4:26830244-26830266 ATAAACACCCTTGAATGACCAGG + Intergenic
973095324 4:46190654-46190676 TTAAACTACCTCTAAACTCCTGG + Intergenic
973545756 4:51980255-51980277 TTTATCTCCCTTGAATCTGAAGG + Intergenic
974899357 4:67978360-67978382 TGAAACTCCCTTGCATCCCGGGG + Intergenic
975436417 4:74357654-74357676 TTTAACTCTTTTGTATCTCCTGG + Intergenic
975768043 4:77690041-77690063 TTCAAATCCCTGGAATTTCCAGG + Intergenic
976202147 4:82589618-82589640 TTAAGCTCCCTTCCATCTCTTGG + Intergenic
977069665 4:92368764-92368786 TTAAACACCCTTCAATTTTCTGG - Intronic
977380295 4:96264285-96264307 TGAAATTTACTTGAATCTCCTGG - Intergenic
977701757 4:100030033-100030055 TCAAACACCATTGAATCTGCTGG + Intergenic
978549023 4:109904316-109904338 TTAAACTTCCTTGAAGATCAGGG + Intergenic
978899098 4:113926964-113926986 TCAAACTCCATTGAATCTGCTGG + Intronic
978996914 4:115168519-115168541 TTAAACTCATTTCAAACTCCTGG + Intergenic
980609552 4:135139962-135139984 TTAAAATCCCTGGAATATCAGGG - Intergenic
981936931 4:150248969-150248991 TTAAACTAACTTCACTCTCCTGG - Intronic
983097873 4:163586311-163586333 TTAGACTGGGTTGAATCTCCAGG + Intronic
986938351 5:12918896-12918918 TCAAACACCATTGAATCTGCTGG + Intergenic
987527573 5:19073041-19073063 TAAAGCTCTCTTGATTCTCCTGG - Intergenic
987800381 5:22688150-22688172 TTTAATTCTCATGAATCTCCTGG - Intronic
988595232 5:32585035-32585057 GTGAACTCCCTTACATCTCCAGG + Intronic
992167670 5:74071031-74071053 TTAGACTCCCATGTATTTCCAGG + Intergenic
998642914 5:144032377-144032399 CAAAACTCCCTTGCAGCTCCTGG + Intergenic
999559025 5:152779114-152779136 TTAAATTCCTTTTAATCTACAGG - Intergenic
1000945018 5:167411679-167411701 TTAAACTTCATCCAATCTCCTGG - Intronic
1001103949 5:168836903-168836925 TTAAAATACCTGGAATCTGCGGG - Intronic
1003238238 6:4317788-4317810 TTAAATCCCCTGGAATTTCCTGG + Intergenic
1003932432 6:10938231-10938253 GGAAACTTCCTTGAATCTCAGGG - Intronic
1008654961 6:53602440-53602462 TTAAACTGCCTGGAACTTCCTGG - Intronic
1010521385 6:76842479-76842501 TGAAACTGTCTTGAATATCCAGG - Intergenic
1010897709 6:81385183-81385205 ATATAATCCCTTGAATCTCTTGG - Intergenic
1011527350 6:88279435-88279457 TTTACATCCCTTGAAACTCCAGG - Intergenic
1012521349 6:100124785-100124807 TTAAACTCCCTGGACTCTTTTGG - Intergenic
1023139785 7:37090548-37090570 CTAGAATCCCTTGAACCTCCAGG + Intronic
1026445109 7:70477481-70477503 TTAAACTCCCTAGAAGCTGATGG + Intronic
1026610686 7:71857400-71857422 TTAAACTCCTTTGACTCACAGGG - Intronic
1027465771 7:78513183-78513205 TTCATCTCCTTTGAATTTCCTGG - Intronic
1030793761 7:113761587-113761609 TTAAACTCCCATGAAAATCAAGG + Intergenic
1032209311 7:129898139-129898161 TTCACCTCCCTTGACTTTCCAGG - Intronic
1034433631 7:151052880-151052902 TTGAACCCCCATGAATCTCTAGG + Intergenic
1036290935 8:7489589-7489611 TTGAACTTCTTTGAATATCCAGG - Exonic
1036330555 8:7821948-7821970 TTGAACTTCTTTGAATATCCAGG + Exonic
1042820936 8:72929422-72929444 TTTTTCTCCCTTGAATCACCTGG - Intronic
1042897931 8:73691842-73691864 TTAAATTCCTTGGAATTTCCTGG + Intronic
1043104460 8:76090207-76090229 TCAAACTCTCTTGAATCTAGGGG - Intergenic
1045231049 8:100308120-100308142 TTAATCTTACTGGAATCTCCTGG + Intronic
1046498760 8:115048060-115048082 TTAAACTCCTTTGCTTCTCAGGG - Intergenic
1048198953 8:132355518-132355540 TTAAACTCTCATCAATTTCCAGG - Intronic
1048423590 8:134301924-134301946 ATAAAATTCATTGAATCTCCAGG - Intergenic
1051584013 9:18707530-18707552 TTAAACTCCTTTCCAGCTCCAGG - Intronic
1052918804 9:33946049-33946071 TCAAACACTTTTGAATCTCCTGG + Intronic
1053554111 9:39116782-39116804 GAAAACTCACTTGAATCTACTGG - Intronic
1053818215 9:41936907-41936929 GAAAACTCACTTGAATCTACTGG - Intronic
1054108476 9:61080566-61080588 GAAAACTCACTTGAATCTACTGG - Intergenic
1054612381 9:67250559-67250581 GAAAACTCACTTGAATCTACTGG + Intergenic
1055715367 9:79111585-79111607 TTTCAGTCCCTTGAGTCTCCAGG + Intergenic
1056654166 9:88495613-88495635 CTAACCTTCCTTGAGTCTCCAGG - Intergenic
1059611417 9:115901297-115901319 TTTATCTCCCTTCAATCTCTTGG - Intergenic
1059996595 9:119916250-119916272 TTAAACTGCTTTGAAGCTCCTGG + Intergenic
1188673443 X:32909312-32909334 TTAAACTACATTGAATTCCCTGG - Intronic
1189706312 X:43762288-43762310 GTTAACTCCCTTGAACTTCCAGG - Intergenic
1190262068 X:48803536-48803558 TTATACACCCTTGAATCCCCTGG - Intronic
1190405295 X:50080887-50080909 ATCAACTCCCTTTAATTTCCTGG - Intronic
1192765824 X:74138669-74138691 TTGAGCTCCCTTGAATTTTCAGG - Intergenic
1197532130 X:127642460-127642482 TTAAACTCTCTAGTAACTCCAGG - Intergenic
1197838652 X:130721942-130721964 TTAAAATTCCTTGAATCTATAGG - Intronic
1197967970 X:132085205-132085227 CTAAACTCCCTTGGCTTTCCTGG + Intronic
1199759616 X:150895389-150895411 TTAACCGCCCTTTAAACTCCTGG + Intronic
1201796659 Y:17903699-17903721 TCAAGCACCATTGAATCTCCTGG + Intergenic
1201804896 Y:18002286-18002308 TCAAGCACCATTGAATCTCCTGG - Intergenic