ID: 908152480

View in Genome Browser
Species Human (GRCh38)
Location 1:61316585-61316607
Sequence CAGGGTTATCAGCATTCGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 54}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908152480_908152487 27 Left 908152480 1:61316585-61316607 CCCTCCGAATGCTGATAACCCTG 0: 1
1: 0
2: 0
3: 4
4: 54
Right 908152487 1:61316635-61316657 AGAACAAGAGCGCTCTTACTTGG No data
908152480_908152485 -4 Left 908152480 1:61316585-61316607 CCCTCCGAATGCTGATAACCCTG 0: 1
1: 0
2: 0
3: 4
4: 54
Right 908152485 1:61316604-61316626 CCTGATGAGAAACATTGTAGTGG 0: 1
1: 1
2: 2
3: 15
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908152480 Original CRISPR CAGGGTTATCAGCATTCGGA GGG (reversed) Intronic
901752620 1:11420678-11420700 AGGGATTATCAGCATTTGGATGG - Intergenic
904092888 1:27957419-27957441 CAGGGTGATCAGGCTTCGGAGGG + Intronic
905402752 1:37715496-37715518 TGGGGTCATCAGCATTCAGATGG - Intronic
906695230 1:47819053-47819075 CAGGCTTGTCAGCACTGGGATGG - Intronic
908152480 1:61316585-61316607 CAGGGTTATCAGCATTCGGAGGG - Intronic
908636261 1:66168992-66169014 CAGGATTATCAGCATCCAGAAGG + Intronic
916688053 1:167165753-167165775 CTGGGTTTTCAGGATTAGGAAGG - Intergenic
920941490 1:210487440-210487462 TAGGGTTATTAGTATTCTGAAGG + Intronic
1063836561 10:10021318-10021340 CAGTGACATCAGCATTCAGATGG - Intergenic
1068236089 10:54234249-54234271 CATTGTTATTAGCATTAGGAAGG - Intronic
1074480740 10:113818114-113818136 AAGGGTCCTCAGCATACGGATGG - Intergenic
1075099554 10:119496488-119496510 CAGGGTAAACAGGCTTCGGACGG - Intergenic
1084673989 11:70623851-70623873 CAGGGCTGTCAGCATTATGAAGG + Intronic
1089152247 11:116373167-116373189 CAGGGTTTTCAGCATTAATAGGG - Intergenic
1089164366 11:116463450-116463472 CATGGTTATAAGCACTCAGAGGG + Intergenic
1090792154 11:130099955-130099977 CAGGGTTATTAACATACCGACGG - Intronic
1094321626 12:29190242-29190264 TAGTGTTATCAGCATACAGATGG + Intronic
1096592594 12:52671017-52671039 AAGAGTCATCAGCATTTGGAGGG - Intergenic
1102038885 12:109787995-109788017 CAGGGATGTCAGCATTCTCATGG - Intronic
1112682323 13:101780942-101780964 CAGAGTTGTCAGCAGTGGGAAGG - Intronic
1113919175 13:113897140-113897162 AAGGGTTATAAGAAATCGGAAGG + Intergenic
1115002843 14:28442517-28442539 CAGAGTTTTCAGCATTTGGTTGG - Intergenic
1115097038 14:29649716-29649738 CAGGGTTTTCAGCATTTGAGGGG + Intronic
1120299422 14:82687529-82687551 CAGGTTTATCAACAGTCAGAGGG - Intergenic
1122789112 14:104176928-104176950 CCGGGTTCACAGCATGCGGAGGG - Exonic
1125586778 15:40826283-40826305 AAGGGTTATCAGCAGTCCTAGGG - Intronic
1134757166 16:16677850-16677872 CAGTAATATCAGCATTTGGAGGG + Intergenic
1134988902 16:18681313-18681335 CAGTAATATCAGCATTTGGAGGG - Intergenic
1136402085 16:30024596-30024618 CGGGGTTGTCAGCACTGGGAAGG + Exonic
1148619149 17:49021674-49021696 CAGGTTTATCAGCTATAGGAGGG + Intronic
1158491296 18:57911836-57911858 AAGGAGTATCAGCATTCTGAGGG + Intergenic
1159327575 18:66943151-66943173 CAGGGTCATCAGCATGCAGATGG - Intergenic
1160715785 19:575981-576003 CAGCATCATCAGCATCCGGAGGG + Intronic
929334174 2:40720493-40720515 CAGTGTTTTCAACATTCTGAGGG + Intergenic
929836573 2:45406522-45406544 CAGGGTTTTCAGCAAGAGGATGG - Intronic
938937274 2:136138071-136138093 CACTGTTATCAGCATGAGGATGG - Intergenic
944924015 2:204444538-204444560 CAGGGTTATAAGCATGCCCAGGG + Intergenic
947590162 2:231380828-231380850 CAGGGAAATCAGCATTTGGCTGG + Intergenic
1177377238 21:20286954-20286976 CTGTGACATCAGCATTCGGATGG + Intergenic
949292021 3:2477997-2478019 GAGGATTATCAACAGTCGGATGG + Intronic
957530900 3:81439709-81439731 CAAGGTTATCATCTTTCAGAAGG + Intergenic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
965258040 3:166442623-166442645 CAGTGTTCTCAGCATTCATATGG + Intergenic
977314995 4:95435169-95435191 AAGGGATATCAGAATTGGGAGGG - Intronic
979103568 4:116654847-116654869 GATTGTTATCAGCATTCTGAAGG - Intergenic
991203050 5:64016609-64016631 CAGAGTCCTCAGCATTTGGAAGG - Intergenic
992124957 5:73630566-73630588 CAGGTTTTTCAGCTTTCAGAAGG + Intronic
995741919 5:115364529-115364551 CAGGCTTTTCAGCATAAGGATGG + Intergenic
1001849924 5:174954734-174954756 ATTGGTGATCAGCATTCGGAGGG + Intergenic
1008424624 6:51342706-51342728 GAGGGTTATCTGAAATCGGATGG + Intergenic
1018763598 6:166911626-166911648 ATGGGTTATCAGCAAACGGACGG - Intronic
1035303263 7:157911851-157911873 CAGGGTTAGCAGAAGACGGAAGG - Intronic
1045013039 8:97975187-97975209 CTGGGTTATCAGGATTCATATGG + Intronic
1046301965 8:112306463-112306485 CATGGTTATCAGCATTTGTATGG + Intronic
1047156405 8:122324164-122324186 CAGGGTTTTCATCTTTGGGATGG - Intergenic
1049594655 8:143477786-143477808 CAGGGGTCTCACCATTGGGAGGG + Intronic
1190746570 X:53326710-53326732 CATGGTTCTCAGTATTCTGACGG - Intergenic
1194659915 X:96619190-96619212 CAGGGTCTTCAGCTTTCAGATGG + Intergenic
1198975377 X:142329575-142329597 AATGGTTATCAGCATTCGAGTGG + Intergenic