ID: 908154185

View in Genome Browser
Species Human (GRCh38)
Location 1:61335550-61335572
Sequence ATAAGCTAACTGGCCAGGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1906
Summary {0: 1, 1: 1, 2: 11, 3: 137, 4: 1756}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908154181_908154185 8 Left 908154181 1:61335519-61335541 CCTGGGGTGCATTCTGTATCCTC 0: 1
1: 0
2: 2
3: 10
4: 124
Right 908154185 1:61335550-61335572 ATAAGCTAACTGGCCAGGCGCGG 0: 1
1: 1
2: 11
3: 137
4: 1756

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908154185 Original CRISPR ATAAGCTAACTGGCCAGGCG CGG Intronic
900072325 1:780565-780587 ATGAGCAAAATCGCCAGGCGCGG - Intergenic
900322370 1:2091325-2091347 AAAAACAAACAGGCCAGGCGCGG - Intronic
900722465 1:4186214-4186236 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
900724720 1:4208474-4208496 ATAAAGGAACTGGCCAGGTGGGG + Intergenic
900847570 1:5115861-5115883 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
901045795 1:6394881-6394903 AAAAGAAAACAGGCCAGGCGTGG - Intergenic
901115784 1:6842628-6842650 GTAAGCAAAAGGGCCAGGCGTGG + Intronic
901211840 1:7531105-7531127 AAGAGGTTACTGGCCAGGCGCGG - Intronic
901587295 1:10307598-10307620 AAAAACAAACAGGCCAGGCGCGG - Intronic
901744184 1:11361694-11361716 AAATGCTTACTGGCCTGGCGCGG - Intergenic
901811606 1:11769948-11769970 AAAATCTTCCTGGCCAGGCGTGG - Intronic
902068051 1:13705691-13705713 TGGAGCTCACTGGCCAGGCGTGG + Intronic
902247034 1:15127845-15127867 AAAAAATAACAGGCCAGGCGCGG - Intergenic
902300490 1:15499025-15499047 ATAAGATCATTGGCCAGGGGCGG - Intronic
902865692 1:19276819-19276841 ATAAATTAACAGGCCAGGTGTGG + Intergenic
903119094 1:21202813-21202835 ATTAGCCAAGTGGCCAGGCACGG - Intergenic
903203025 1:21758879-21758901 ATAAATCAACTGGCTAGGCGTGG + Intronic
903245422 1:22011602-22011624 ATAAAAAAATTGGCCAGGCGTGG + Intronic
903395937 1:23001924-23001946 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
903726988 1:25455967-25455989 AAAAGCATACAGGCCAGGCGTGG + Intronic
903746773 1:25592356-25592378 AAAAGAAAAATGGCCAGGCGCGG - Intergenic
903903243 1:26664250-26664272 ATGAGCAAAGGGGCCAGGCGCGG - Intergenic
903997453 1:27316438-27316460 AATGGCTCACTGGCCAGGCGTGG + Intergenic
904115436 1:28158407-28158429 ATAAGCAACAGGGCCAGGCGCGG + Intronic
904159962 1:28515889-28515911 ATACACAAAATGGCCAGGCGCGG + Intronic
904510608 1:31003464-31003486 ATCAGTTCACTGGCCGGGCGCGG + Intronic
904546399 1:31276740-31276762 CGAACCAAACTGGCCAGGCGTGG + Intronic
904647453 1:31978482-31978504 ACAAACAAACAGGCCAGGCGCGG - Intergenic
904658370 1:32066380-32066402 AAAAAAAAACTGGCCAGGCGCGG - Intergenic
904711715 1:32435077-32435099 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
904726490 1:32552367-32552389 ATAAACCAAATGGCCAGGCGTGG + Intronic
904996401 1:34634929-34634951 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
905060436 1:35135304-35135326 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
905170245 1:36105655-36105677 ATGAGGAAACTGGCCAGGCATGG + Intronic
905374778 1:37512898-37512920 AAAAGAAAAGTGGCCAGGCGTGG + Intronic
905433231 1:37939731-37939753 ATAAAATAACAGGCCGGGCGCGG - Intronic
905499867 1:38427807-38427829 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
905555628 1:38880491-38880513 GTAAGCAAGTTGGCCAGGCGCGG + Intronic
905740921 1:40370882-40370904 ATTCTATAACTGGCCAGGCGCGG + Intronic
906257084 1:44358596-44358618 AAGACCTAACTGACCAGGCGTGG - Intergenic
906301535 1:44685599-44685621 ATAAGCTATCTGGCCAGGTATGG - Intronic
906397184 1:45476555-45476577 ATGAGGTAGCTAGCCAGGCGCGG + Intronic
906477594 1:46180453-46180475 AGAGGCTAACTGGCCACGGGTGG + Intronic
906509590 1:46403385-46403407 AGAAGAGAACAGGCCAGGCGCGG - Intronic
906744434 1:48211950-48211972 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
907292710 1:53427031-53427053 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
907503486 1:54900836-54900858 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
907514253 1:54983267-54983289 ATTAGCCAATTAGCCAGGCGTGG - Intronic
907521350 1:55025338-55025360 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
907638076 1:56156843-56156865 ATAAGGTAATTGGCCGGGTGCGG - Intergenic
908078527 1:60547916-60547938 GTAATCTAACTGGACAGGCCTGG - Intergenic
908154185 1:61335550-61335572 ATAAGCTAACTGGCCAGGCGCGG + Intronic
908289259 1:62645855-62645877 ATAAACTACTCGGCCAGGCGTGG + Intronic
908461621 1:64352939-64352961 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
908591862 1:65644849-65644871 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
908635958 1:66165049-66165071 AGAAATTAAGTGGCCAGGCGTGG - Intronic
908852501 1:68389003-68389025 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
909006085 1:70278200-70278222 AAAAAAGAACTGGCCAGGCGTGG + Intronic
909035551 1:70591034-70591056 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
909109625 1:71457990-71458012 ATAGGAAAACTGGCCAGGCGTGG - Intronic
909133210 1:71765883-71765905 ATAAGAGACCTGGCCAGGCGCGG + Intronic
909550941 1:76897745-76897767 ATAAGGGAACTGGGCAGGTGGGG + Intronic
909646577 1:77923283-77923305 TTAAGATACCTGGCCAGGCATGG - Intronic
909776596 1:79491539-79491561 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
909788183 1:79641702-79641724 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
909841957 1:80338426-80338448 AAAAGCTTCCTGGCCAGGTGCGG + Intergenic
909910051 1:81248177-81248199 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
909955717 1:81776475-81776497 AAAATCTTACTGGCCAGGCGTGG - Intronic
909978361 1:82070488-82070510 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
910002649 1:82357829-82357851 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
910049477 1:82958079-82958101 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
910241139 1:85087278-85087300 ATACGCAAATTAGCCAGGCGTGG + Intronic
910475599 1:87602910-87602932 ATAAGATAATTGGCCAGGTGCGG + Intergenic
910613342 1:89168642-89168664 AAAACCAAACTGGCCAGGTGTGG + Intronic
910835456 1:91504397-91504419 AAAAGCTTACTGGCCAGGCATGG - Intronic
910961683 1:92770498-92770520 AAAAAGAAACTGGCCAGGCGAGG + Intronic
910961936 1:92772304-92772326 AAAAAGAAACTGGCCAGGCGAGG + Intronic
911006439 1:93230209-93230231 TAAAGCCAACTGGCCAGGCACGG + Intronic
911071153 1:93832790-93832812 ATAAGCGAGCTGGGCAGGTGGGG - Intronic
911147903 1:94569836-94569858 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
911154726 1:94626386-94626408 GTAAGCTAATTGGCCAAGTGAGG + Intergenic
911510538 1:98804221-98804243 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
911570480 1:99512358-99512380 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
912296559 1:108475675-108475697 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
912393866 1:109324424-109324446 ATAAGGGGAATGGCCAGGCGCGG - Intronic
912655294 1:111481217-111481239 ATAAAATAACTAGCCAGGCATGG + Intergenic
912684679 1:111752986-111753008 AAAAGAAAACAGGCCAGGCGCGG - Intronic
912790838 1:112648670-112648692 CTTAACTAACAGGCCAGGCGTGG + Intronic
912813648 1:112812178-112812200 ATAAGGGAACTGGGCAGGTGAGG - Intergenic
913006118 1:114633287-114633309 ATACAGAAACTGGCCAGGCGTGG + Intronic
913244179 1:116857044-116857066 ATAATAAAACTGGCCAGGTGTGG - Intergenic
914805821 1:150990852-150990874 ATAAATAAACAGGCCAGGCGCGG + Intronic
914891166 1:151624720-151624742 ATAATCAAGCTGGCCGGGCGTGG - Intronic
915059314 1:153167182-153167204 ATAAAATCTCTGGCCAGGCGTGG + Intergenic
915253320 1:154606320-154606342 ATAAAATAACTGGCCGGGCGTGG - Intronic
915508107 1:156370026-156370048 ATGAGGCAACTGGCCAGTCGTGG + Intronic
916227925 1:162508400-162508422 ATGAGCTAAATGGCCAGGCGTGG - Intronic
916232807 1:162556992-162557014 GTAAGACATCTGGCCAGGCGCGG - Intergenic
916328944 1:163593751-163593773 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
916357653 1:163931264-163931286 AAAAGGAAAGTGGCCAGGCGCGG + Intergenic
916765678 1:167858207-167858229 AGAAGCTCACAGGCCAGGTGTGG + Intronic
916941876 1:169685601-169685623 ATAAGGGAACTGGGCAGGTGGGG - Intronic
917102034 1:171455818-171455840 AAAAAGTGACTGGCCAGGCGCGG - Intergenic
917322831 1:173801528-173801550 AAAATCTAACTAGCCAGGCATGG + Intronic
917550574 1:176023426-176023448 AAAAGTAAACAGGCCAGGCGTGG + Intronic
917777912 1:178358078-178358100 ATAAGAAAATTAGCCAGGCGTGG + Intronic
918000748 1:180492956-180492978 ATAAGAATACTGGCCAGGCTTGG + Intronic
918277457 1:182967262-182967284 AAAAAATAACTGGCCAGGCGTGG - Intergenic
918347206 1:183616386-183616408 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
918429022 1:184439053-184439075 ATATAAAAACTGGCCAGGCGTGG + Intronic
918492585 1:185097823-185097845 ATAATTTTACTGGCCAGGCACGG - Intronic
918507211 1:185269140-185269162 ACAAACTATCAGGCCAGGCGCGG - Intronic
918567581 1:185951271-185951293 ATAAGGGAACTGGGCAGGTGGGG + Intronic
918581485 1:186136018-186136040 ATGAGTTAATTAGCCAGGCGTGG + Intronic
918714316 1:187768481-187768503 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
919166675 1:193904688-193904710 ACAAGAAAACTAGCCAGGCGTGG - Intergenic
919476486 1:198037519-198037541 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
919911116 1:202111398-202111420 ATAACATAATTGGCCAGGCACGG + Intergenic
920008566 1:202851302-202851324 AAAAGCAGCCTGGCCAGGCGAGG + Intergenic
920009999 1:202860672-202860694 AGAACTTGACTGGCCAGGCGCGG - Intergenic
920024427 1:202982909-202982931 TTATGCCAACTGGCCAGGTGTGG - Intergenic
920026262 1:202999754-202999776 TTACCCTAACCGGCCAGGCGCGG + Intergenic
920134468 1:203758444-203758466 ATAAATTAACGGGCCGGGCGTGG + Intergenic
920908092 1:210190028-210190050 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
920989371 1:210922089-210922111 AAAAACTGACGGGCCAGGCGCGG + Intronic
921212509 1:212912239-212912261 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
921459686 1:215412915-215412937 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
921483613 1:215691170-215691192 ATAGGCTAACTGGCTGGGCACGG - Intronic
921509345 1:216010735-216010757 ATAAGGGAACTGGGCAGGTGGGG - Intronic
921520227 1:216148282-216148304 ATAAGGGAACTGGGCAGGTGGGG - Intronic
921635365 1:217486482-217486504 AAAAACTAACTGGGCAGTCGAGG - Intronic
922048496 1:221968684-221968706 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
922049448 1:221976077-221976099 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
922063307 1:222112145-222112167 ATAAGATAATTGGCCGGGCGTGG - Intergenic
922153978 1:223027378-223027400 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
922267261 1:223994523-223994545 ATGAGCAAAATCGCCAGGCGCGG - Intergenic
922475124 1:225901682-225901704 AGATGCTAACTGGCCAGGCACGG + Intronic
922514578 1:226197529-226197551 ATAATATAATAGGCCAGGCGCGG + Intergenic
922522439 1:226267068-226267090 AAAAGTAAATTGGCCAGGCGCGG - Intronic
922848956 1:228715030-228715052 TAAAGTTAATTGGCCAGGCGCGG - Intergenic
922877170 1:228948970-228948992 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
922906485 1:229177158-229177180 ATAAGGGAACTGGGCAGGTGAGG - Intergenic
923047470 1:230366085-230366107 ATAAACTAAAAGGCCAGGAGGGG + Intronic
923075295 1:230603958-230603980 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
923131015 1:231074768-231074790 ATAAAGGCACTGGCCAGGCGCGG - Intergenic
923214109 1:231833182-231833204 ATAAGGGAACTGGACAGGTGGGG + Intronic
923244842 1:232120917-232120939 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
923281688 1:232449226-232449248 TTAAGAAAACTGGCCGGGCGCGG + Intronic
923286856 1:232504380-232504402 ATAAACGAACTAGCCAGGCATGG + Intronic
923301911 1:232649111-232649133 TGAAGCTACCTGGCCAGTCGGGG - Intergenic
923379481 1:233401304-233401326 AAATGCCAACTGGCCAGGTGTGG + Intergenic
923408540 1:233686407-233686429 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
923478004 1:234355438-234355460 ATAAACTTTGTGGCCAGGCGTGG + Intergenic
923521734 1:234740161-234740183 ATAAACAAACAGGCCGGGCGCGG + Intergenic
923711338 1:236389851-236389873 ATAAAAAAATTGGCCAGGCGTGG + Intronic
923770650 1:236935237-236935259 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
923807111 1:237269331-237269353 ATATGCTATATGGCCGGGCGCGG - Intronic
924051986 1:240088503-240088525 AAATACTAAATGGCCAGGCGTGG - Intronic
924109548 1:240684492-240684514 AGAAAACAACTGGCCAGGCGTGG + Intergenic
924180738 1:241436705-241436727 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
924512365 1:244738194-244738216 AAAAGTTCATTGGCCAGGCGTGG + Intergenic
924593707 1:245427315-245427337 AAAAACAAACAGGCCAGGCGTGG + Intronic
924700577 1:246448059-246448081 ATAATCAAATTAGCCAGGCGTGG + Intronic
924705295 1:246496322-246496344 ATCAAGAAACTGGCCAGGCGTGG - Intronic
924896095 1:248339202-248339224 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1062930839 10:1351480-1351502 ATAAGGGAACTGGGCAGGTGGGG - Intronic
1063295239 10:4798683-4798705 ATAATATAAATGGCCAGGCATGG + Intronic
1063363247 10:5473845-5473867 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1063685172 10:8230078-8230100 ATAAAATAATTGGCCAGGCATGG + Intergenic
1063989516 10:11544777-11544799 TTTAGATTACTGGCCAGGCGTGG - Intronic
1064688789 10:17892719-17892741 AGAAGATAACTGGCCAGGCGTGG + Intronic
1064886912 10:20122138-20122160 ATAAGGGAACTGGGCAGGTGGGG + Intronic
1065007946 10:21396696-21396718 ATACGCTGCCTGGCCAGGAGCGG - Intergenic
1065064861 10:21951048-21951070 GTAATCTAGATGGCCAGGCGAGG + Intronic
1065308992 10:24396044-24396066 AAATGCTTACCGGCCAGGCGTGG + Intronic
1065443030 10:25771726-25771748 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1065587851 10:27237903-27237925 ATACCCTATCAGGCCAGGCGTGG - Intronic
1065710141 10:28508188-28508210 ATAAATTTAGTGGCCAGGCGTGG - Intergenic
1065948938 10:30634073-30634095 ATAGGCTGATTGGCCAGGCACGG + Intergenic
1066121999 10:32298085-32298107 ATAATCTAACTGGCCAGGCGCGG - Intronic
1066460197 10:35606333-35606355 TTAAGCTTCCAGGCCAGGCGTGG - Intronic
1066549174 10:36536185-36536207 ATAAACTAACCAGCCAGGTGTGG - Intergenic
1068058259 10:52036741-52036763 ATAAGGGAACTGGGCAGGTGGGG + Intronic
1068231063 10:54169490-54169512 ATAAGGGAACTGGGCAGGTGGGG - Intronic
1068236501 10:54240919-54240941 ATAACAGAATTGGCCAGGCGCGG - Intronic
1068360856 10:55973934-55973956 ATAAGAGAACTGGGCAGGTGGGG - Intergenic
1068606215 10:59008040-59008062 AAAGCCTAACTGGCCATGCGCGG + Intergenic
1068665990 10:59676630-59676652 ATATAATAACTGGCCAGGCATGG + Intronic
1068804913 10:61184705-61184727 AAAAGATAGCTGGCCAGGCATGG + Intergenic
1068862923 10:61866085-61866107 ATGAGATAACAGGCCAGGCGTGG - Intergenic
1069530320 10:69213344-69213366 AAAACCTTACAGGCCAGGCGTGG - Intergenic
1069850694 10:71402824-71402846 AAAATCCAGCTGGCCAGGCGTGG + Intronic
1070008796 10:72452156-72452178 AATAACTAACTGGCCAGGTGCGG - Intronic
1070475019 10:76821307-76821329 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1071187320 10:83059882-83059904 ATAAGGGAACTGGACAGGTGGGG - Intergenic
1071313189 10:84363282-84363304 ATTAAATAAGTGGCCAGGCGTGG - Intronic
1071325047 10:84506501-84506523 ATAATTAAACTGGCCGGGCGTGG + Intronic
1071329271 10:84544083-84544105 ATACTCTGACTGGCCAGGCCTGG + Intergenic
1071611977 10:87039749-87039771 ATAAACCTACTGGCCAGGCATGG - Intergenic
1071821820 10:89287429-89287451 ATAAGGGAACTGGGCAGGTGGGG - Intronic
1071897647 10:90084013-90084035 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1071961203 10:90810160-90810182 ATAAGGGAACTGGGCAGGTGGGG - Intronic
1072343999 10:94484528-94484550 AGAACAAAACTGGCCAGGCGTGG - Intronic
1072538275 10:96379529-96379551 GTAAGGAAACTGGCCAGGCATGG + Intronic
1072580354 10:96734951-96734973 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1072874975 10:99162917-99162939 ATAGGCTTCATGGCCAGGCGCGG + Intronic
1072890980 10:99324479-99324501 AAATGCTAACAGGCCAGGCACGG + Intergenic
1072982229 10:100108736-100108758 ATAAAATAATTGGCCAGGCATGG - Intergenic
1072995990 10:100244643-100244665 ATAAAATAACGGGCCAGGCGCGG - Intronic
1073130867 10:101188351-101188373 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1073209581 10:101788440-101788462 AAAAGTTTTCTGGCCAGGCGTGG + Intronic
1073366581 10:102947759-102947781 ACAAACAAACAGGCCAGGCGCGG + Intronic
1073369273 10:102972344-102972366 AGAAGCTTCCTGGCCAGGCACGG + Intronic
1073525195 10:104174763-104174785 AAAATATAACTGGCCGGGCGTGG + Intronic
1073643669 10:105277947-105277969 ATAAGTGCCCTGGCCAGGCGTGG + Intergenic
1073683606 10:105730112-105730134 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1073753809 10:106559374-106559396 AATAGGTCACTGGCCAGGCGTGG - Intergenic
1074019107 10:109565094-109565116 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1074740869 10:116483385-116483407 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1074927420 10:118087321-118087343 ATAAAAAAACAGGCCAGGCGTGG + Intergenic
1075013579 10:118894682-118894704 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1075248790 10:120847577-120847599 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1075277001 10:121103223-121103245 ACAAGAAGACTGGCCAGGCGTGG + Intergenic
1075376477 10:121981887-121981909 ATAAGGACATTGGCCAGGCGTGG - Intergenic
1075692862 10:124411525-124411547 ATGAATTAACTGGCCAGGCGTGG + Intronic
1075766844 10:124899892-124899914 ATAATAAAACTGGCCAGGCGTGG + Intergenic
1075786854 10:125055874-125055896 AGCAGCTAACTGGCCAGGCGTGG + Intronic
1076162739 10:128257966-128257988 ATAAGCTTTAAGGCCAGGCGTGG + Intergenic
1076863307 10:133153261-133153283 ATAAGAACAGTGGCCAGGCGCGG + Intergenic
1077129347 11:962441-962463 ACAAACTCTCTGGCCAGGCGTGG + Intronic
1077589796 11:3482608-3482630 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1077612274 11:3650674-3650696 ATAAGGGAACTGGGCAGGTGGGG - Intronic
1077850709 11:6072810-6072832 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1077864077 11:6208882-6208904 ATTAGCTTTCTGGCCAGGCGCGG + Intronic
1078043460 11:7891004-7891026 AGAATCCAACTGGCCAGGGGAGG + Intergenic
1078046043 11:7915137-7915159 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1078158366 11:8817969-8817991 ATAGGCTTTCTGGCCGGGCGTGG + Intronic
1078353820 11:10618373-10618395 ATAAGCTCACTGTCTAGGAGAGG - Intronic
1078485947 11:11723313-11723335 TTAAGATTTCTGGCCAGGCGCGG + Intergenic
1078855500 11:15203342-15203364 ATAAGCAATCTGGCCTGGAGAGG - Intronic
1078870531 11:15339970-15339992 ACCAGCTAACAGGCCGGGCGCGG - Intergenic
1079170193 11:18086406-18086428 ATAAGTAAACAGGCCAGGTGGGG + Intronic
1079188159 11:18255457-18255479 ATAAGAAAACTAGCCAGGCATGG - Intergenic
1079377927 11:19910566-19910588 AAAACATAACTAGCCAGGCGCGG + Intronic
1079433519 11:20421191-20421213 ATAAACAAACTAGCCAGGCACGG - Intronic
1079447551 11:20570527-20570549 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1079672481 11:23186913-23186935 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1080027825 11:27632057-27632079 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1080038306 11:27732314-27732336 ATAAGCTCACAGGCCAGGTGCGG - Intergenic
1080099737 11:28445944-28445966 ATAAAATAACAGGCCAGGCCAGG - Intergenic
1080627611 11:34044764-34044786 ATACGAAAACTAGCCAGGCGTGG - Intergenic
1081334389 11:41846630-41846652 ATTGGCAAACTGGCCTGGCGCGG + Intergenic
1081643295 11:44773124-44773146 TAAAACTCACTGGCCAGGCGCGG + Intronic
1081645449 11:44786925-44786947 AAATGCTAACTGGACAGGCCAGG - Intronic
1081823299 11:46021842-46021864 AGAAGATAAGTGGCCAGGCATGG - Intronic
1082002155 11:47399179-47399201 ATAAAATAATTAGCCAGGCGTGG - Intergenic
1082020789 11:47531277-47531299 AAAAACAAACAGGCCAGGCGCGG + Intronic
1082026432 11:47576006-47576028 ATAAGAAAATTAGCCAGGCGTGG - Intronic
1082188492 11:49212701-49212723 ATAAGCATTTTGGCCAGGCGCGG - Intergenic
1083286558 11:61663004-61663026 ATAAATTCATTGGCCAGGCGCGG + Intergenic
1083403262 11:62439384-62439406 ATAGGGAAACTGCCCAGGCGCGG - Intronic
1083470158 11:62879061-62879083 AAAAACTAACAGGCCAGGTGTGG - Intronic
1083534491 11:63455643-63455665 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1083601797 11:63953333-63953355 AGATGCTCACTGGCCAGGTGTGG - Intronic
1083643662 11:64159502-64159524 ATAAACAAACAGGCCAGGCACGG + Intronic
1083675908 11:64324501-64324523 AAAACATAACAGGCCAGGCGGGG + Intergenic
1083852932 11:65378458-65378480 CTAAGCTAAGTGGCCAGGCCCGG - Intronic
1083889980 11:65591093-65591115 ATAAGAAAACCGGCCGGGCGCGG + Intronic
1083979353 11:66153489-66153511 ATAAAAAACCTGGCCAGGCGCGG + Intronic
1084047251 11:66576351-66576373 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1084105919 11:66980345-66980367 ATTAGCCAGGTGGCCAGGCGTGG - Intergenic
1084232392 11:67762411-67762433 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1084245516 11:67854382-67854404 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1084354281 11:68626879-68626901 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1084355638 11:68636441-68636463 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1084613200 11:70217291-70217313 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1084675939 11:70634568-70634590 ATGGGCAAACTGGCCAGGTGAGG + Intronic
1084827169 11:71740196-71740218 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1084861554 11:72021902-72021924 AAAAGCTTCCTGGCCGGGCGTGG - Intronic
1084905251 11:72341108-72341130 TTAAAATAACTTGCCAGGCGCGG - Intronic
1085568395 11:77537172-77537194 CAAAGCTAAAAGGCCAGGCGTGG + Intronic
1085570281 11:77552666-77552688 ATAAGGGAACTGGGCAGGTGGGG - Intronic
1085598431 11:77831999-77832021 AAAAGATACCTGGCCAGGCGTGG - Intronic
1085629879 11:78105996-78106018 TTAAGATAATTGGCCAGGCATGG - Intronic
1085934351 11:81124524-81124546 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1085988097 11:81808947-81808969 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1086133238 11:83421850-83421872 ATAAGGGAACTGGGCAGGCAGGG - Intergenic
1086294156 11:85346476-85346498 TTAAGAAAATTGGCCAGGCGCGG - Intronic
1086678027 11:89634001-89634023 ATAAGCATTTTGGCCAGGCGCGG + Intergenic
1086857142 11:91878596-91878618 ATAAACTTCCTGGCCAGGCGCGG + Intergenic
1087099172 11:94348453-94348475 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1087099722 11:94352387-94352409 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1087127898 11:94644341-94644363 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1087196999 11:95312251-95312273 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1087242973 11:95800678-95800700 ATAAGAGACTTGGCCAGGCGCGG - Intronic
1087249547 11:95882205-95882227 ATAATCCAATTGGCCAGGCGCGG + Intronic
1087314767 11:96590662-96590684 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1087579112 11:100029290-100029312 ACATGCTAATTGGCCGGGCGCGG + Intronic
1087839452 11:102907052-102907074 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1087864040 11:103201115-103201137 ACAAGATTACTGGCCAGACGCGG - Intronic
1087928673 11:103950256-103950278 ATAAGGAAACTGGCCAGGAGTGG + Intronic
1088213310 11:107480507-107480529 ATAAGATCAGAGGCCAGGCGTGG - Intergenic
1088422165 11:109660306-109660328 ATATTCTGACTGGCCAGGCTAGG + Intergenic
1088555040 11:111052922-111052944 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1088657566 11:112015173-112015195 GAATGCTAATTGGCCAGGCGCGG - Intronic
1089234491 11:117011685-117011707 ATAAGGTTTCTGGCCAGGCATGG + Intronic
1089419606 11:118321484-118321506 ATAGTCTCCCTGGCCAGGCGCGG - Intergenic
1089470972 11:118719984-118720006 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1089477293 11:118775022-118775044 ATAATTTACTTGGCCAGGCGTGG + Intronic
1089478007 11:118781635-118781657 ATAGGTTAACAGGCCAGGCGTGG + Intronic
1089840921 11:121416758-121416780 AAAAACTATCAGGCCAGGCGTGG - Intergenic
1089866970 11:121640902-121640924 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1089987759 11:122829850-122829872 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1089994627 11:122894028-122894050 ATAAGAAACTTGGCCAGGCGTGG + Intronic
1090107512 11:123868571-123868593 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1090367039 11:126215406-126215428 TTAAGATTTCTGGCCAGGCGCGG + Intronic
1090526728 11:127545706-127545728 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1090546411 11:127772051-127772073 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1090732765 11:129585931-129585953 GTAAAGTAACTGGCCGGGCGCGG - Intergenic
1090850506 11:130567338-130567360 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1090871871 11:130756494-130756516 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1090926853 11:131257467-131257489 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1091183767 11:133629524-133629546 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1091560231 12:1606626-1606648 TTAAACTATTTGGCCAGGCGCGG + Intronic
1091570802 12:1683738-1683760 AAAAGATAATTGGCCAGGCATGG - Intergenic
1091886612 12:4021271-4021293 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1092254786 12:6920688-6920710 AAAAGCAAACCAGCCAGGCGTGG - Intronic
1092278732 12:7082619-7082641 TTAAGCATTCTGGCCAGGCGTGG - Intronic
1092340795 12:7674121-7674143 AAAAACTTACTGGCCGGGCGCGG - Intergenic
1092416091 12:8291514-8291536 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1092474570 12:8807660-8807682 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1092561791 12:9622447-9622469 ATATGAAAACTAGCCAGGCGTGG - Intergenic
1092626662 12:10335902-10335924 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1092662512 12:10754467-10754489 ATATGCTATGTGGCCAGGCATGG - Intergenic
1092723636 12:11465153-11465175 ATAAGGGAACTGGGCAGGTGGGG + Intronic
1092739240 12:11612683-11612705 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1092789791 12:12061121-12061143 ATAAGGGAACTGGGCAGGTGGGG - Intronic
1092924769 12:13262947-13262969 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1093001342 12:14000027-14000049 GTAAGAAAAATGGCCAGGCGTGG - Intergenic
1093071074 12:14707847-14707869 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1093186761 12:16029142-16029164 ATAAACAAACTGGCCGGGCGCGG + Intronic
1093267920 12:17024681-17024703 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1093321898 12:17723249-17723271 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1093455316 12:19359671-19359693 ATAAGCTTTCTGGCCGGGCGCGG + Intronic
1093522270 12:20065373-20065395 AAAAGCAAACTGGCCGGGTGTGG + Intergenic
1093578903 12:20766104-20766126 ATAAGGGAACTGGGCAGGTGTGG - Intergenic
1093584433 12:20819985-20820007 ATAAGGGAACTGGGCAGGTGGGG + Intronic
1093645484 12:21581322-21581344 ATAACATAACTGGCCAGGTCAGG - Intronic
1093946789 12:25118551-25118573 AAAAACAAACAGGCCAGGCGTGG - Intronic
1094029818 12:25998635-25998657 AAAAGCTTTCTTGCCAGGCGCGG - Intronic
1094400767 12:30058715-30058737 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1094547286 12:31416552-31416574 AGAAAGTAACTGGCCAGGCATGG - Intronic
1094643357 12:32297893-32297915 ATAAGAAAACTGGCCAGGCACGG + Intronic
1095466323 12:42491260-42491282 AAAAGCTCAGTGGCCGGGCGCGG + Intronic
1095637736 12:44452534-44452556 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1095667439 12:44819030-44819052 ATAAGTGAACTGGCCGGGCGCGG - Intronic
1095778216 12:46032549-46032571 ATAAGCGAACTGGGCAGGTGGGG - Intergenic
1095876890 12:47089150-47089172 ATAAACCAAAAGGCCAGGCGTGG + Intronic
1095934581 12:47664097-47664119 ATAAGATCATGGGCCAGGCGTGG + Intronic
1096151238 12:49314383-49314405 ATATGACAACTGGCCAGGCAAGG + Intergenic
1096211603 12:49770510-49770532 AGATGCATACTGGCCAGGCGCGG + Intergenic
1096267331 12:50134221-50134243 ATAAGAAAATTAGCCAGGCGTGG + Intronic
1096312680 12:50535281-50535303 ATAAGCTACCAGGCCTGGCCTGG - Intronic
1096384301 12:51184724-51184746 ATACAAAAACTGGCCAGGCGTGG - Intergenic
1096397107 12:51274535-51274557 ATAATGTATCAGGCCAGGCGTGG - Intergenic
1097011932 12:55959087-55959109 ATAATTTAATTGGCCAGGTGTGG + Intronic
1097073755 12:56376735-56376757 AGAAGCAAACAGGCCGGGCGTGG - Intergenic
1097083195 12:56448434-56448456 AAAAACAAACAGGCCAGGCGCGG + Intronic
1097206728 12:57328350-57328372 ATAAGACAACTGGCCAGGCATGG - Intronic
1097236798 12:57546171-57546193 ATAAGCTAACAGAGAAGGCGGGG + Intronic
1097398673 12:59104569-59104591 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1097416965 12:59326193-59326215 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1097542111 12:60954961-60954983 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1097582236 12:61472088-61472110 ATATGCTCACCGGCCGGGCGCGG - Intergenic
1097709432 12:62902070-62902092 AAAAGCTTTTTGGCCAGGCGCGG + Intronic
1097859976 12:64509157-64509179 ATAAGCAAAAAGGCCAGGGGCGG + Intergenic
1097866720 12:64565284-64565306 ATAAAAGAGCTGGCCAGGCGTGG + Intergenic
1098028559 12:66231219-66231241 ATATGTTTACTGGCCAGGTGTGG + Intronic
1098137308 12:67416281-67416303 AGAAGCAACCTGGCCAGGCACGG - Intergenic
1098173548 12:67769622-67769644 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1098255012 12:68607774-68607796 ATGAGCTTCTTGGCCAGGCGCGG - Intergenic
1098629151 12:72706088-72706110 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1098629946 12:72711874-72711896 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1098653743 12:73004945-73004967 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1098988367 12:77036895-77036917 ATTAGCTGATTAGCCAGGCGTGG - Intronic
1099292014 12:80786057-80786079 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1099404077 12:82237945-82237967 AGAAGCTTATGGGCCAGGCGCGG - Intronic
1099836010 12:87910369-87910391 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1100155738 12:91798394-91798416 AAAAGCTTTCTGGCCAGGCGTGG + Intergenic
1100561453 12:95751913-95751935 ATAAGGGAACTGGGCAGGTGGGG - Intronic
1100608136 12:96168724-96168746 ATAAGATACATGGCCAGGCGTGG - Intergenic
1100940437 12:99718234-99718256 ATAAGGGAACTGGGCAGGTGGGG - Intronic
1100990774 12:100249356-100249378 ATAGGCAAATAGGCCAGGCGTGG + Intronic
1101036400 12:100711442-100711464 AAAGGCTAAATGGCCAGGCACGG - Intergenic
1101278308 12:103225653-103225675 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1101395520 12:104343507-104343529 ATAAAGTAAGAGGCCAGGCGTGG + Intronic
1101608584 12:106269539-106269561 ATCACCAAACAGGCCAGGCGTGG + Intronic
1101778024 12:107811423-107811445 AAAAGTGAACTGGCCGGGCGCGG + Intergenic
1101781405 12:107841161-107841183 AAGAACTAACTGGCCAGGCGTGG - Intergenic
1102058058 12:109911455-109911477 ATACACAAATTGGCCAGGCGTGG + Intronic
1102100679 12:110276037-110276059 ATGAGAGGACTGGCCAGGCGTGG - Intergenic
1102165801 12:110805561-110805583 AAAAGTAAACTGGCCAGGCATGG - Intergenic
1102272491 12:111549771-111549793 ATAAGATACCTGCCCAGGCGTGG + Intronic
1102470405 12:113156682-113156704 ACAAGGTAACAGGCCAGGCTTGG - Intronic
1102550286 12:113686637-113686659 ATAAGAAAATTAGCCAGGCGTGG + Intergenic
1102585913 12:113922841-113922863 ATGAGGTCACAGGCCAGGCGCGG + Intronic
1102604566 12:114058576-114058598 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1102892332 12:116569763-116569785 AAAAGATAACAGGCCAGGCATGG + Intergenic
1103023712 12:117556874-117556896 ATAAGCATATGGGCCAGGCGCGG + Intronic
1103091337 12:118100212-118100234 ATTAGCTGAATGGCCGGGCGTGG + Intronic
1103349652 12:120275226-120275248 ATAAGGAATCTGGCCGGGCGCGG - Intergenic
1103423333 12:120808364-120808386 ATGAGGAAACTGGCCAGGCATGG - Intronic
1103634177 12:122289139-122289161 AAATGTTAATTGGCCAGGCGCGG + Intronic
1103643979 12:122376225-122376247 ATAAAATAATTGGCCGGGCGGGG - Intronic
1103939477 12:124494104-124494126 ATAAGCTCACTGGCCCTGCCTGG - Intronic
1104117375 12:125762663-125762685 ATAAAATAAGGGGCCAGGCGTGG - Intergenic
1104230875 12:126882827-126882849 ATAAGCTCCTCGGCCAGGCGCGG - Intergenic
1104257699 12:127154531-127154553 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1104490958 12:129192878-129192900 ATTATATAACAGGCCAGGCGCGG + Intronic
1104868229 12:131974267-131974289 ATTAAAAAACTGGCCAGGCGCGG - Intronic
1105002542 12:132700335-132700357 AAAAGTCAAGTGGCCAGGCGCGG - Intronic
1105469031 13:20675001-20675023 AAAATATAACTGGCCAGGCGCGG - Intronic
1105901091 13:24753864-24753886 ATATGAAAACTGGCCGGGCGTGG + Intergenic
1106024840 13:25946901-25946923 ATACAAAAACTGGCCAGGCGTGG - Intronic
1106025587 13:25952660-25952682 AAAAGAAAACTGGCTAGGCGTGG - Intronic
1106439286 13:29751184-29751206 AGTAGGAAACTGGCCAGGCGTGG + Intergenic
1106626237 13:31423761-31423783 AAAAGCAAGGTGGCCAGGCGAGG - Intergenic
1106714877 13:32377299-32377321 ATAAAATAGCTGGCCAGGCGCGG + Intronic
1106943528 13:34801372-34801394 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1107075673 13:36319181-36319203 ATAAGGGAACTGGGCAGGTGGGG - Intronic
1107469496 13:40679002-40679024 ATTAGCCCAGTGGCCAGGCGCGG - Intergenic
1107870618 13:44743294-44743316 AAAAGCAAACTTGCCAGGCATGG - Intergenic
1108093992 13:46881154-46881176 ATGAGACAACTGGCCAGGCAAGG + Intronic
1108513083 13:51172602-51172624 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1108803785 13:54130663-54130685 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1108814217 13:54269595-54269617 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1108919460 13:55657948-55657970 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1108947524 13:56043047-56043069 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1108952858 13:56115391-56115413 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1109278100 13:60324205-60324227 ATAAGACATCTGGCCAGGTGTGG - Intergenic
1109343659 13:61091098-61091120 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1109352998 13:61207538-61207560 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1109499376 13:63215849-63215871 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1109709573 13:66144308-66144330 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1109716653 13:66229358-66229380 ATAAGGGAACTGGACAGGTGGGG + Intergenic
1109913175 13:68943976-68943998 ATAAGCATACAGGCCAGACGCGG + Intergenic
1110063063 13:71066357-71066379 ATAAGAAATCTGCCCAGGCGTGG + Intergenic
1110115833 13:71815793-71815815 ATAAGCTCAGAGGCCGGGCGCGG + Intronic
1110650406 13:77936302-77936324 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1110765567 13:79276867-79276889 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1110978570 13:81868908-81868930 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1111301201 13:86353020-86353042 AAAGGTTAACTGGCCAGGTGCGG - Intergenic
1111302137 13:86361145-86361167 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1111362022 13:87189400-87189422 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1111394537 13:87648231-87648253 ATAAGTTAACAGGCCTGGCGTGG + Intergenic
1111458750 13:88515798-88515820 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1111582229 13:90237282-90237304 TTAAGCTCTCTGGCCAGGCACGG + Intergenic
1111630528 13:90842178-90842200 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1111631609 13:90851564-90851586 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1111885603 13:94017121-94017143 TTAAGAAAACTGGCCAGGCACGG - Intronic
1112014927 13:95323763-95323785 ATAAGTTCATTGGCCGGGCGCGG - Intergenic
1112063544 13:95766988-95767010 ATGGAATAACTGGCCAGGCGTGG - Intronic
1112236914 13:97645050-97645072 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1112481697 13:99781766-99781788 ATAAACAAACTGGCCAGCCATGG - Intronic
1112755230 13:102625146-102625168 AAAAGTTAAGTGGCCGGGCGTGG - Intronic
1112889240 13:104211036-104211058 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1113732267 13:112649904-112649926 ATAAGCAAACAGGCCGGGCGCGG + Intronic
1114169210 14:20254681-20254703 AGGAACTACCTGGCCAGGCGCGG - Intergenic
1114189896 14:20432629-20432651 AAAAAATTACTGGCCAGGCGCGG + Intronic
1114294043 14:21313497-21313519 ATGAGATAGATGGCCAGGCGCGG + Intronic
1114299230 14:21359384-21359406 ATAAACAAACTGGGCTGGCGTGG - Intronic
1114438454 14:22727242-22727264 AGAACCAAACAGGCCAGGCGCGG - Intergenic
1114511670 14:23267122-23267144 ATAAAAAAACTAGCCAGGCGTGG - Intronic
1115057941 14:29153656-29153678 GTAAGCCAACCGGCCAGGTGCGG + Intergenic
1115087502 14:29535222-29535244 ATAGGAAAACTGGCCGGGCGCGG + Intergenic
1115187014 14:30700380-30700402 AAAAGAAAAATGGCCAGGCGTGG + Intronic
1115567218 14:34635288-34635310 ATAAAAAAATTGGCCAGGCGTGG + Intergenic
1115574304 14:34695716-34695738 ATAAGCTTATTGGCGGGGCGCGG + Intergenic
1115697041 14:35910291-35910313 AAAATTTAACTGGCCAGGCGCGG - Intronic
1115784702 14:36811493-36811515 ATAAAATAACTAGCCAGGTGTGG + Intronic
1115904895 14:38193530-38193552 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1115982004 14:39063704-39063726 ATATGCTATTTGGCCAGGGGCGG + Intronic
1116057525 14:39882240-39882262 ATAAACAAAATGGCCAGGCGTGG - Intergenic
1116179771 14:41518682-41518704 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1116451586 14:45072578-45072600 ATAAAAAAACTAGCCAGGCGTGG - Intronic
1116490495 14:45498358-45498380 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1116534695 14:46015395-46015417 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1116573536 14:46546653-46546675 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1116613600 14:47106920-47106942 ATAAGGGAACTGGGCAGGTGGGG - Intronic
1116702315 14:48258356-48258378 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1116703207 14:48265352-48265374 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1116878198 14:50135718-50135740 ATAAGCAAACTGGCTGGGTGAGG - Intronic
1116930012 14:50681333-50681355 TTAAGACAGCTGGCCAGGCGCGG + Intergenic
1117111276 14:52458266-52458288 ATGAGACAACTGGCCAGGTGCGG + Intronic
1117174242 14:53131127-53131149 ATAAGGGAACTGGGCAGGTGAGG - Intronic
1117197275 14:53353273-53353295 AAAAGATAATTGGCCAGGCACGG + Intergenic
1117385156 14:55204524-55204546 ATAAGAAAAATGGCCAGACGTGG + Intergenic
1117526394 14:56610530-56610552 AAAACCTCACTGGCCGGGCGCGG - Intronic
1117700467 14:58408124-58408146 GTAAGATATGTGGCCAGGCGCGG + Intronic
1117701555 14:58419161-58419183 AAAACCCAACTGGCCAGGTGAGG + Intronic
1117801272 14:59446817-59446839 ATAAGGGAACTGGGCAGGTGGGG - Intronic
1117947178 14:61040627-61040649 AAAATTTATCTGGCCAGGCGCGG - Intronic
1117957829 14:61136396-61136418 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1118260837 14:64245237-64245259 AGAAGATCTCTGGCCAGGCGAGG + Intronic
1118427586 14:65683301-65683323 ATAAGAAACCTGGCCAGGAGTGG - Intronic
1118559354 14:67061800-67061822 ATAAGCAAAGGGGCCAGGCATGG - Intronic
1118566686 14:67148854-67148876 AAAGGCAAACTGGCCGGGCGCGG - Intronic
1118811634 14:69279220-69279242 TTAAGATAAATGGCCAGGCGTGG - Intronic
1118846697 14:69552810-69552832 ATAAGGCACTTGGCCAGGCGTGG + Intergenic
1118921139 14:70150962-70150984 AAGAACTATCTGGCCAGGCGCGG + Intronic
1118937172 14:70298775-70298797 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1119285637 14:73452067-73452089 AAAAAAAAACTGGCCAGGCGTGG + Intronic
1119312753 14:73663494-73663516 ATACTGGAACTGGCCAGGCGTGG - Intronic
1119317289 14:73706233-73706255 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1119504804 14:75163260-75163282 AAAAACTCACGGGCCAGGCGCGG + Intronic
1119560188 14:75583652-75583674 ATAAGGGAACTGGGCAGGTGGGG + Intronic
1119562086 14:75598629-75598651 ATAAAATAACTAGCCAGGCATGG - Intronic
1119590746 14:75885198-75885220 ATAAAAAAACTGGCCAGGTGCGG + Intronic
1119838801 14:77774775-77774797 AGAAGTTAACTAGCCAGGCATGG - Intergenic
1119843425 14:77810403-77810425 AAGAATTAACTGGCCAGGCGTGG - Intronic
1120251312 14:82064059-82064081 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1120512772 14:85435374-85435396 ATAATGTACTTGGCCAGGCGTGG - Intergenic
1120533037 14:85657119-85657141 AAAGCCAAACTGGCCAGGCGCGG - Intergenic
1120539476 14:85735947-85735969 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1120618334 14:86734081-86734103 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1120659872 14:87238014-87238036 ATAAGTGAACTGGGCAGGTGGGG + Intergenic
1121193205 14:92047686-92047708 ATAAGGGAACTGGGCAGGTGGGG + Exonic
1121313798 14:92949388-92949410 AAAAGCTAAGTGGCTGGGCGCGG - Intronic
1121703735 14:95975687-95975709 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1121776090 14:96592107-96592129 GTAAGGAAGCTGGCCAGGCGCGG - Intergenic
1122041088 14:98987934-98987956 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1122224922 14:100269970-100269992 AAAAATTAAGTGGCCAGGCGCGG + Intronic
1122471835 14:101973448-101973470 TTAGTCTATCTGGCCAGGCGCGG - Intronic
1122556428 14:102583167-102583189 ATGATTTAAATGGCCAGGCGTGG - Intergenic
1122675977 14:103413746-103413768 AAAAGACAACTGACCAGGCGTGG - Intronic
1123005526 14:105320860-105320882 ATAACCTGACTGGCCGGGCCTGG + Intronic
1123045781 14:105513248-105513270 ATAAGAGAACAGGCCAGGCACGG - Intergenic
1123767910 15:23500218-23500240 ATAAGAAAGCTGGCCAGGTGTGG + Intergenic
1124197922 15:27649217-27649239 AAAAGATGCCTGGCCAGGCGTGG - Intergenic
1125131424 15:36288614-36288636 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1125160357 15:36636260-36636282 AGAAGGTAATGGGCCAGGCGCGG + Intronic
1125213131 15:37239173-37239195 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1125629312 15:41134247-41134269 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1125773954 15:42194172-42194194 AAAAACAAACTGGCCAGGTGTGG + Intronic
1125997734 15:44180492-44180514 AAAAGAATACTGGCCAGGCGCGG + Intronic
1126035803 15:44544412-44544434 AGTAGAAAACTGGCCAGGCGTGG + Intronic
1126068909 15:44848575-44848597 CTTAGAAAACTGGCCAGGCGTGG - Intergenic
1126089912 15:45042199-45042221 CTTAGAAAACTGGCCAGGCGCGG + Intronic
1126530068 15:49702114-49702136 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1126628294 15:50707405-50707427 TTATGCAAATTGGCCAGGCGCGG - Exonic
1126776398 15:52104252-52104274 ATTAGCTGGGTGGCCAGGCGTGG - Intergenic
1126912324 15:53429815-53429837 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1128244221 15:66121972-66121994 AGAAACACACTGGCCAGGCGTGG + Intronic
1128952424 15:71900142-71900164 ATAAGTTTTCTGGCCAGGTGCGG + Intronic
1129219972 15:74126636-74126658 ATAAGAGTACTGACCAGGCGCGG - Exonic
1129259518 15:74356663-74356685 ATAAGGGAACTGGGCAGGTGGGG - Intronic
1129577676 15:76769151-76769173 ACAAACAACCTGGCCAGGCGTGG + Intronic
1129747010 15:78029346-78029368 AAATTATAACTGGCCAGGCGTGG - Intronic
1130019753 15:80218427-80218449 ATAAGCAAATAGGCCAGGAGCGG - Intergenic
1130534312 15:84772392-84772414 ATAAAAAAACTGGCCAGGCGTGG + Intronic
1130641589 15:85680971-85680993 ATACACAAATTGGCCAGGCGTGG - Intronic
1130781149 15:87042384-87042406 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1130855197 15:87834004-87834026 ATAAGGGAACTGGGCAGGTGAGG - Intergenic
1130945857 15:88550474-88550496 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1131037874 15:89236668-89236690 AAAAGTTTGCTGGCCAGGCGCGG + Intergenic
1131044129 15:89298877-89298899 ATAGGCAACCTGGCCGGGCGTGG + Intronic
1131171380 15:90181208-90181230 AAAAGTTAACAGGCCAGGCCCGG + Intronic
1131219877 15:90574186-90574208 ATAAACTTATTGGCCGGGCGTGG + Intronic
1131245195 15:90785821-90785843 AAAAGCAAACAGGCCAGGCGAGG - Intronic
1131368688 15:91861777-91861799 ATAAGAAAACTAGCCAGGCTTGG - Intronic
1131447831 15:92514245-92514267 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1131489993 15:92854373-92854395 ATAAGGAAAGTAGCCAGGCGTGG - Intergenic
1131534679 15:93226141-93226163 ACAAGCAAACAGGCCGGGCGTGG - Intergenic
1131638936 15:94268480-94268502 AAAAGGAAAGTGGCCAGGCGCGG - Intronic
1131684262 15:94753508-94753530 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1132012099 15:98285124-98285146 AAAACAAAACTGGCCAGGCGGGG - Intergenic
1132203637 15:99971959-99971981 ATAAGCTAAAAGGCCGGGCGCGG + Exonic
1132263101 15:100443026-100443048 ATAAGGGAACTGGGCAGGTGGGG - Intronic
1133003968 16:2867405-2867427 ATAAGTTAGTTGGCCGGGCGCGG - Intergenic
1133158074 16:3889775-3889797 AAAAGGAAACTGGCCAGGTGCGG - Intergenic
1133192145 16:4142020-4142042 ATGATCCAATTGGCCAGGCGCGG + Intergenic
1133249166 16:4468987-4469009 ACAAACGAACAGGCCAGGCGTGG + Intronic
1133253213 16:4498528-4498550 ATAAAATAATTAGCCAGGCGTGG - Intronic
1133442594 16:5833201-5833223 ATATGAAATCTGGCCAGGCGTGG + Intergenic
1133752799 16:8737630-8737652 AGAAACTAGCTGGCCAGGCGCGG + Intronic
1133765642 16:8835993-8836015 ATAAGGGAACTGGGCAGGTGGGG + Intronic
1133766674 16:8843066-8843088 ATAAGGGAACTGGGCAGGTGGGG + Intronic
1133869460 16:9674091-9674113 ATAAGGGAACTGGGCAGGTGGGG + Intronic
1133963879 16:10517497-10517519 ATATAATAACAGGCCAGGCGCGG - Intergenic
1134342089 16:13355541-13355563 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1134361391 16:13534071-13534093 ATGAGTTACCAGGCCAGGCGCGG - Intergenic
1134385091 16:13764309-13764331 AAGAACTACCTGGCCAGGCGCGG + Intergenic
1134449093 16:14352832-14352854 AAAAGGGAACAGGCCAGGCGTGG - Intergenic
1134631876 16:15762263-15762285 ATAAACTAAGAGGCTAGGCGTGG - Intronic
1134650336 16:15903489-15903511 ATGAGCTAATGGGCCAGGTGCGG + Intergenic
1134916238 16:18073351-18073373 AAAAGCTAATGGGCCAGGTGTGG - Intergenic
1135147362 16:19974246-19974268 AGAAGCAAATGGGCCAGGCGTGG - Intergenic
1135344839 16:21680221-21680243 ATAAGATTACAGGCCGGGCGCGG + Intronic
1135376182 16:21949393-21949415 ATAAGCTATCAGGCCTGGTGCGG + Intergenic
1135406844 16:22204760-22204782 ATATGCTAATTGGCCAGGTCTGG + Intergenic
1135411173 16:22235786-22235808 ACAAACAAACTGGCCAGACGCGG - Intronic
1135430953 16:22382966-22382988 ATAAAATAAAAGGCCAGGCGCGG - Intronic
1135557285 16:23447609-23447631 ATAAAATCCCTGGCCAGGCGTGG + Intronic
1135691966 16:24545360-24545382 AAAAGACTACTGGCCAGGCGCGG - Intronic
1135704496 16:24663260-24663282 ATCAGCAAAGGGGCCAGGCGCGG + Intergenic
1135755247 16:25091885-25091907 AAAAACTATCAGGCCAGGCGCGG - Intergenic
1136176058 16:28517599-28517621 TTAAGAAAGCTGGCCAGGCGTGG - Intergenic
1136237378 16:28923115-28923137 ACATGCTACCTGGCCAGGCGCGG + Intronic
1136446674 16:30326171-30326193 ATAAATTAATTGGCCGGGCGCGG - Intergenic
1136619987 16:31422228-31422250 ATGAGCAAGCTGGCCAGGCGAGG - Intronic
1136847127 16:33585600-33585622 ATTATCTAACTGGCCAGGCACGG - Intergenic
1137296058 16:47094714-47094736 AAAAAATAAATGGCCAGGCGCGG - Intronic
1137490218 16:48926152-48926174 ATAAGATTCCTGGCCAGGCGTGG + Intergenic
1137529469 16:49268875-49268897 ATGAGCTAATTGGCCAAGCATGG - Intergenic
1137631077 16:49945818-49945840 ATATACAAACTAGCCAGGCGTGG + Intergenic
1137942243 16:52699629-52699651 ATCAGAAAACAGGCCAGGCGTGG + Intergenic
1138003351 16:53305349-53305371 TTAAGCAAACAGGCCAGGTGTGG - Intronic
1138064915 16:53930511-53930533 AGAAGATAATTGGCCTGGCGCGG - Intronic
1138612177 16:58134147-58134169 ATACAAAAACTGGCCAGGCGCGG - Intergenic
1138689917 16:58757609-58757631 ATAAAAAAACTGGCCAGGCATGG - Intergenic
1138759018 16:59520613-59520635 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1138805040 16:60081567-60081589 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1138822964 16:60283750-60283772 AAAAAATAACTAGCCAGGCGTGG - Intergenic
1139225825 16:65232805-65232827 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1139230507 16:65278226-65278248 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1139409217 16:66745566-66745588 AGAAGCTAATAGGCCGGGCGCGG - Intronic
1139555988 16:67710650-67710672 TAAGGCTAACTGGCCGGGCGCGG - Intronic
1139743970 16:69059494-69059516 AAAAGAAAAGTGGCCAGGCGCGG - Intronic
1139786551 16:69397645-69397667 AGAAGATAACCAGCCAGGCGCGG - Intronic
1139942965 16:70619437-70619459 ATAAGGGAACTGGGCAGGTGGGG + Intronic
1139943639 16:70623768-70623790 ATAAGGGAACTGGGCAGGTGGGG + Intronic
1140394681 16:74616468-74616490 ATGAAATAACAGGCCAGGCGTGG + Intergenic
1140737372 16:77910380-77910402 ATACACTAGGTGGCCAGGCGTGG + Intronic
1140965396 16:79961530-79961552 AAAAGCTTTCAGGCCAGGCGCGG + Intergenic
1141294261 16:82752123-82752145 ATAAGCTAACAAGGCAGGCCTGG + Intronic
1141320172 16:83000867-83000889 AACAGATAAATGGCCAGGCGCGG - Intronic
1141400496 16:83742915-83742937 ATAAGCAAACTGGCCAGGTGCGG + Intronic
1141591010 16:85068620-85068642 ATACAAAAACTGGCCAGGCGTGG - Intronic
1141605134 16:85148548-85148570 ATAAGGAAACTGGCCAGGTGCGG + Intergenic
1141796624 16:86279273-86279295 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1141865116 16:86745004-86745026 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1142339735 16:89513576-89513598 AGAAAATAATTGGCCAGGCGTGG + Intronic
1203108835 16_KI270728v1_random:1434255-1434277 ATTATCTAACTGGCCAGGCACGG - Intergenic
1142785419 17:2218257-2218279 ATAACCAAATAGGCCAGGCGCGG + Intronic
1142841941 17:2639186-2639208 ATAAGCTTAGGGGCCAGGCGCGG - Intronic
1143040333 17:4030653-4030675 ATAAAATAAGTAGCCAGGCGTGG - Intronic
1143138616 17:4727088-4727110 ATAAAAAAACTGGCCGGGCGCGG - Intergenic
1143223020 17:5278293-5278315 ATGAACAAACTGGCCAGGTGCGG - Intergenic
1143252203 17:5531950-5531972 ACACACCAACTGGCCAGGCGCGG + Intronic
1143441438 17:6977635-6977657 ATAAAATATCTGGCCAGGTGCGG + Intronic
1143823126 17:9581024-9581046 AAAAACTACGTGGCCAGGCGTGG + Intronic
1144258851 17:13498121-13498143 ATAATCTAACTGGCCTGCTGGGG - Intronic
1144308981 17:13995017-13995039 ATGAGAAAACTGGCCAGGCACGG + Intergenic
1144471780 17:15549438-15549460 ATAAGATGCCTGGCCAGGCATGG + Intronic
1144555284 17:16276579-16276601 AAAAATTAACTGGGCAGGCGTGG + Intronic
1144561608 17:16325053-16325075 GGACTCTAACTGGCCAGGCGCGG + Intronic
1144580178 17:16454399-16454421 ACAAACAAACAGGCCAGGCGTGG + Intronic
1144596786 17:16576585-16576607 TTATTCAAACTGGCCAGGCGTGG - Intergenic
1144861459 17:18305909-18305931 ATAAATTAACTGGCCAGGCTCGG + Intronic
1144924699 17:18795263-18795285 ATAAGTTGCCTGGCCAGGCATGG - Intronic
1145026697 17:19473148-19473170 ATATACAAACTGGCCGGGCGCGG - Intergenic
1145083823 17:19918247-19918269 ATAAGATAAATGGCCAGACATGG + Intronic
1145950624 17:28813917-28813939 TTAAGAAAACTGGCCGGGCGCGG + Intronic
1146052283 17:29563569-29563591 ATAATAAAAGTGGCCAGGCGCGG + Intronic
1146108548 17:30065371-30065393 ATGACCTAACTGGCCAGGCGCGG + Intronic
1146353213 17:32113043-32113065 AGATGATTACTGGCCAGGCGTGG - Intergenic
1146370595 17:32263682-32263704 AAAAGATCCCTGGCCAGGCGCGG - Intergenic
1146379296 17:32316806-32316828 ATAAAATAAAAGGCCAGGCGTGG - Intronic
1146560420 17:33864195-33864217 AGAAGGTAACTGGCCAGGCGGGG - Intronic
1146597989 17:34186014-34186036 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1146666157 17:34705321-34705343 TTAAGATATCTGGCCAGGTGTGG + Intergenic
1146928936 17:36764442-36764464 AGGAGATAACAGGCCAGGCGCGG - Intergenic
1147015331 17:37487625-37487647 AAAAACTAATTAGCCAGGCGTGG + Intergenic
1147272416 17:39284534-39284556 ATAAGAAAATTTGCCAGGCGTGG - Intronic
1147289821 17:39432772-39432794 AAAAAAAAACTGGCCAGGCGCGG + Intronic
1147298740 17:39506504-39506526 ATCATATAATTGGCCAGGCGTGG - Intronic
1147368708 17:39976566-39976588 ATTTGCTCACAGGCCAGGCGAGG - Intronic
1147379821 17:40047504-40047526 ACAAAAAAACTGGCCAGGCGTGG + Intronic
1148235466 17:45965569-45965591 ATACAAGAACTGGCCAGGCGTGG - Intronic
1148378535 17:47173800-47173822 ATAATGAAACTGGCCAGGCGTGG + Intronic
1148490556 17:48021232-48021254 GAAGGCTAACGGGCCAGGCGCGG + Intergenic
1148517440 17:48233562-48233584 ATAAGATTACTGGCCAAGTGTGG + Intronic
1148624772 17:49060904-49060926 ATTCTCTAATTGGCCAGGCGTGG + Intergenic
1148878356 17:50706608-50706630 ATAAGAAAACTGGCCAGGAACGG + Intronic
1148928583 17:51109150-51109172 ATTAGCACATTGGCCAGGCGTGG - Intronic
1149089864 17:52764758-52764780 AAAAATTAACTGGCCAGGCGCGG + Intergenic
1149656706 17:58313320-58313342 ATAAGAAAACTGGCCAGGCATGG + Intronic
1149703672 17:58676218-58676240 ATAAGAAAATTAGCCAGGCGTGG + Intronic
1149807636 17:59634062-59634084 ATAAAAAAACTGTCCAGGCGTGG - Intronic
1149841630 17:59970108-59970130 AGAAACAAACAGGCCAGGCGTGG - Intronic
1149912591 17:60580090-60580112 ATAATCAAAGGGGCCAGGCGTGG + Intronic
1150255034 17:63737829-63737851 ATAAAAAAACTGGCCAGGTGTGG + Intronic
1150412177 17:64954658-64954680 ATGAGGAAACTGGCCAGGCACGG + Intergenic
1150463109 17:65369479-65369501 AAAGGATAAATGGCCAGGCGTGG - Intergenic
1150695468 17:67401223-67401245 GAAAGAAAACTGGCCAGGCGCGG - Intronic
1150735980 17:67739943-67739965 ATAAGAGAACAGGCCAGGCATGG + Intronic
1151294859 17:73177478-73177500 AATGACTAACTGGCCAGGCGGGG - Intergenic
1151312596 17:73303051-73303073 AAAAGATAATTGGCCAGGCGCGG + Intronic
1151502875 17:74503496-74503518 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1151622571 17:75255309-75255331 ATAAGGGAACTGGGCAGGTGGGG - Intronic
1151737432 17:75952963-75952985 ATAAAGAAACTGGCCAGGTGTGG - Intronic
1151839665 17:76608934-76608956 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1151910611 17:77080371-77080393 TTAAGCTTCCAGGCCAGGCGCGG - Intergenic
1151972227 17:77464366-77464388 ATATAAAAACTGGCCAGGCGTGG - Intronic
1151992829 17:77588933-77588955 ATAAGAAAATTAGCCAGGCGTGG + Intergenic
1151996729 17:77614100-77614122 AGAAGAAAGCTGGCCAGGCGCGG + Intergenic
1152116047 17:78387886-78387908 AAAAACTAAATGGCCAGGCACGG - Intronic
1152201366 17:78948438-78948460 ATAAAATAACTAGCCAGGCATGG + Intergenic
1153045767 18:854513-854535 CTGAGCTTCCTGGCCAGGCGCGG - Intergenic
1153083064 18:1250837-1250859 AAAAGCAAATTAGCCAGGCGTGG - Intergenic
1153996015 18:10442002-10442024 ATATGAAAACTAGCCAGGCGTGG + Intergenic
1155173909 18:23286790-23286812 ATAAGGGAACTGGGCAGGTGGGG - Intronic
1155696935 18:28696084-28696106 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1155703711 18:28781480-28781502 AAAAGAAAATTGGCCAGGCGCGG - Intergenic
1155892619 18:31287210-31287232 ATAAGGGAACTGGGCAGGTGTGG + Intergenic
1155941631 18:31806536-31806558 ATAAGGGAACTGGGCAGGTGTGG - Intergenic
1156060323 18:33066149-33066171 GAAAACTAACAGGCCAGGCGCGG - Intronic
1156184565 18:34647002-34647024 ATAACAAAACTGGCCAGGCGCGG - Intronic
1156237444 18:35218504-35218526 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1156251849 18:35359288-35359310 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1156451262 18:37267634-37267656 CTAAGCTAAGTGGCCATGCCAGG + Intronic
1156780094 18:40840364-40840386 ATAAAGTATCTGGCCAGGCACGG + Intergenic
1156915898 18:42464303-42464325 ATAAGTGAACTGGGCAGGTGGGG - Intergenic
1156958266 18:42993614-42993636 ATAAGGGAACTGGGCAGGTGGGG - Intronic
1157078431 18:44494679-44494701 ATGAGCCGACTGGCCAGGCACGG + Intergenic
1157262854 18:46191470-46191492 ATAATGTATCAGGCCAGGCGTGG - Intronic
1157477497 18:48032724-48032746 AAAACCTACCTGGCCAGGGGCGG - Intronic
1157759782 18:50252729-50252751 ATAGGATATCTGGCCAGGCATGG + Intronic
1157906306 18:51573009-51573031 ATAAGGGAACTGGACAGGTGGGG + Intergenic
1158336466 18:56418330-56418352 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1158394559 18:57069601-57069623 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1158402073 18:57130143-57130165 AGAAGCTAGATGGCCAGGTGTGG + Intergenic
1158464709 18:57679983-57680005 ATAAACTACCTGGCCAGGCATGG + Intronic
1158466905 18:57698623-57698645 AGAAGTTAACCGGCCAGGTGAGG - Intronic
1158524874 18:58204034-58204056 AAAACCTAGCTGGCCGGGCGTGG + Intronic
1158551650 18:58441154-58441176 AAGAGTAAACTGGCCAGGCGCGG - Intergenic
1158941190 18:62406912-62406934 ATAAGAGAATTGGCCGGGCGCGG + Intergenic
1158985303 18:62809408-62809430 AAAAGGTAACAGGCCAGGTGCGG + Intronic
1159132547 18:64296105-64296127 ATAAGTTTTTTGGCCAGGCGTGG + Intergenic
1159164555 18:64684364-64684386 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1159953897 18:74506288-74506310 ATAAAAAAACTAGCCAGGCGTGG - Intronic
1159965939 18:74596697-74596719 GGAAGATCACTGGCCAGGCGGGG - Intergenic
1159967390 18:74608635-74608657 CTAAAGGAACTGGCCAGGCGCGG - Intronic
1160168912 18:76536771-76536793 ATAAGAAAACCGTCCAGGCGCGG - Intergenic
1160366610 18:78331696-78331718 AAAAGCGAAAGGGCCAGGCGTGG - Intergenic
1160683683 19:423713-423735 ACATGCTGACTGGCCAGGCTAGG - Intronic
1160778048 19:865709-865731 ATTAGCTGGGTGGCCAGGCGAGG - Intergenic
1160786978 19:904914-904936 ACAAGCTGATTGGCCGGGCGTGG + Intronic
1161078387 19:2297892-2297914 AAAAACAAACAGGCCAGGCGCGG - Intronic
1161247990 19:3265180-3265202 ATAAGAAAACTAGCCAGGTGTGG + Intronic
1161493101 19:4573256-4573278 ATAAAATAGCTGGCCAGGCGCGG + Intergenic
1161661812 19:5551211-5551233 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1161779494 19:6281622-6281644 ATAACCAAACTAGCCGGGCGTGG - Intergenic
1161863757 19:6818823-6818845 AGAAACAAACTGGCCGGGCGTGG + Intronic
1161876927 19:6918878-6918900 ATAAAAAAACTAGCCAGGCGTGG - Intronic
1162020890 19:7868034-7868056 ATAAAAAAACAGGCCAGGCGCGG + Intergenic
1162126724 19:8503458-8503480 AGAAACTAGTTGGCCAGGCGTGG - Intergenic
1162130525 19:8523321-8523343 AAAAAATAATTGGCCAGGCGCGG - Intronic
1162257273 19:9500863-9500885 TTAAGAAAACTGGCCAGGCGTGG - Intergenic
1162286764 19:9744561-9744583 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1162415516 19:10534271-10534293 ATAAATTAGCTGGCCAGGCGCGG + Intergenic
1162593102 19:11606049-11606071 ATAATCTCCTTGGCCAGGCGCGG + Intronic
1162644627 19:12039871-12039893 AAAAAAAAACTGGCCAGGCGCGG + Intronic
1162644676 19:12040179-12040201 AAAAAAAAACTGGCCAGGCGCGG + Intronic
1162738828 19:12762190-12762212 AAAAGCTTAGTGGCCAGGCGTGG + Intergenic
1162884396 19:13685581-13685603 AAATGCAATCTGGCCAGGCGTGG - Intergenic
1162940083 19:14004193-14004215 AAAAGCTAACTGAGCAGGCTGGG - Intronic
1162955603 19:14096334-14096356 AAAAACAAACTGGCCGGGCGCGG - Intronic
1162970857 19:14180544-14180566 AAAAACAAACAGGCCAGGCGTGG - Intronic
1163209738 19:15831544-15831566 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1163269092 19:16239221-16239243 AAAAGAGAACTGGCCGGGCGCGG - Intronic
1163275980 19:16284482-16284504 AAAAGAAAACTAGCCAGGCGTGG - Intergenic
1163357529 19:16823921-16823943 AAGAAATAACTGGCCAGGCGCGG + Intergenic
1163413953 19:17174319-17174341 AGCAGCTCATTGGCCAGGCGTGG - Intronic
1163440173 19:17318819-17318841 AAAAACAAACTTGCCAGGCGCGG - Intronic
1163473531 19:17511861-17511883 CTAAGCTAGCTGGCCCGGCAGGG - Exonic
1163814480 19:19455858-19455880 AAAAGTTTACTGGCCAGGCGTGG + Intronic
1163900130 19:20093594-20093616 ATAAGGGAACTGGGCAGGTGGGG + Intronic
1163907272 19:20158273-20158295 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1163994069 19:21026342-21026364 ATACAAAAACTGGCCAGGCGTGG - Intronic
1164030587 19:21400119-21400141 ATAAGCAACTTGGCCGGGCGCGG + Intronic
1164153060 19:22570980-22571002 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1164202428 19:23029831-23029853 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1164297355 19:23924342-23924364 ATGAGCTAAGAGGCCAGGCAAGG - Intronic
1164459141 19:28432834-28432856 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1164628605 19:29746164-29746186 AAAAGATACATGGCCAGGCGCGG - Intergenic
1164715021 19:30384868-30384890 ATAAAATAATTAGCCAGGCGTGG + Intronic
1165014277 19:32869500-32869522 AAAAAGTACCTGGCCAGGCGTGG - Intronic
1165033438 19:33015132-33015154 ATTATCTAACTGGCCAGGCACGG + Intronic
1165041106 19:33068196-33068218 AAAAGATTATTGGCCAGGCGTGG - Intergenic
1165496925 19:36158397-36158419 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1165536382 19:36450353-36450375 ATAAGGGAAATGGCCAGGCATGG + Intronic
1165815454 19:38639282-38639304 ATAAGTAAGTTGGCCAGGCGCGG + Intergenic
1165954771 19:39495600-39495622 AAAAACAAACAGGCCAGGCGTGG + Intergenic
1165998514 19:39863078-39863100 AGAAGATAAATGGCCAGGCACGG - Intergenic
1166079504 19:40434718-40434740 AAAAACAAACAGGCCAGGCGCGG - Intergenic
1166295326 19:41886569-41886591 ATTTGCAAACTGGCCAGGTGAGG - Intronic
1166498852 19:43326481-43326503 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1166751549 19:45166200-45166222 AAAAGAAAACTCGCCAGGCGCGG - Intronic
1166848911 19:45748231-45748253 AAAAACTAATTGGCCGGGCGTGG - Intronic
1166905701 19:46107028-46107050 ATAAGGTAACTGGGCAAGTGGGG + Intergenic
1166984471 19:46651369-46651391 ACAGGATAAATGGCCAGGCGCGG - Intronic
1167011505 19:46811519-46811541 ATAAAATGATTGGCCAGGCGCGG - Intergenic
1167099545 19:47395781-47395803 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1167128372 19:47567548-47567570 TAAATTTAACTGGCCAGGCGCGG - Intergenic
1167131929 19:47592521-47592543 CTTAGCTGACTGGCCAGGAGCGG + Intergenic
1167167437 19:47808403-47808425 ATAAGAAAATTGGCCAGGCATGG - Intronic
1167261416 19:48461028-48461050 AGAAGGTGGCTGGCCAGGCGCGG + Intronic
1167343311 19:48929279-48929301 AAAAGAAAAATGGCCAGGCGCGG - Intergenic
1167447471 19:49546366-49546388 AAAACCGAACTGGCCAGGCACGG - Intronic
1167783533 19:51616619-51616641 AATAGAAAACTGGCCAGGCGTGG + Intronic
1167901191 19:52623483-52623505 ATAAGGGAACTGGGCAGGTGGGG - Intronic
1168051726 19:53834338-53834360 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1168144368 19:54412127-54412149 ATAAACAAACAGGCCAGGCATGG - Intergenic
1168212039 19:54897858-54897880 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1168227901 19:55009770-55009792 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1168248235 19:55125276-55125298 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1168342041 19:55630281-55630303 ACAAACAAACTGGCCCGGCGCGG - Intergenic
1168527155 19:57098452-57098474 ATTAGTGAACTGGCCAGGCACGG + Intergenic
924972909 2:146242-146264 AGAAGCAACCAGGCCAGGCGTGG - Intergenic
925433777 2:3818881-3818903 ATAAGGGAACTGGGCAGGTGGGG + Intronic
925544640 2:5003718-5003740 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
925828731 2:7875631-7875653 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
926028324 2:9564021-9564043 ATAAGATAAATGGCCAGGTGCGG - Intergenic
926169232 2:10540935-10540957 ATTAGCTAACTGGGCATGCTAGG - Intergenic
926216079 2:10906120-10906142 AAACGTTAAGTGGCCAGGCGCGG + Intergenic
926266924 2:11331634-11331656 ATAACCCAATTAGCCAGGCGCGG + Intronic
926322148 2:11756009-11756031 AAGAACTAAGTGGCCAGGCGTGG - Intronic
926413680 2:12629238-12629260 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
926464005 2:13166967-13166989 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
926815458 2:16794911-16794933 ATAAGGGAACTGGGCAGGCGGGG + Intergenic
927134239 2:20085051-20085073 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
927408578 2:22799796-22799818 TTATGCTTACAGGCCAGGCGTGG - Intergenic
927689685 2:25199415-25199437 ATCAATAAACTGGCCAGGCGCGG + Intergenic
927907641 2:26872399-26872421 AAAAGTTAATGGGCCAGGCGCGG + Intronic
928029972 2:27769700-27769722 ATAACACAACTGGCCGGGCGCGG - Intergenic
928067184 2:28176277-28176299 AGAAGCTCACTGGCCAGGCACGG + Intronic
928152036 2:28839790-28839812 AAAAGTTAATTGGCCGGGCGCGG - Intronic
928288527 2:30015883-30015905 ATACGATAACTAGCCAGGCATGG + Intergenic
928440349 2:31286953-31286975 ATAAGATTCCTAGCCAGGCGCGG - Intergenic
928494249 2:31815770-31815792 ATAAACAATCAGGCCAGGCGTGG + Intergenic
928628116 2:33161555-33161577 AGAAGCTTCCTGGCCGGGCGTGG - Intronic
928770254 2:34696584-34696606 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
928770737 2:34700066-34700088 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
928779625 2:34803939-34803961 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
928827573 2:35440074-35440096 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
928857259 2:35815821-35815843 ATAAGGGAACTGGGCAGGTGAGG - Intergenic
928928649 2:36601772-36601794 ATAAGGGAACTGGGCAGGTGGGG - Intronic
929004758 2:37383959-37383981 ATAAGGGAACTGGGCAGGTGAGG + Intergenic
929076591 2:38083740-38083762 ATAAGGGAACTGGGCAGGTGTGG + Intronic
929154267 2:38775212-38775234 AAAGGGTAACTGGCCAGGCAGGG + Intronic
929383629 2:41380674-41380696 GTAAGGTAACTGGGCAGGTGGGG - Intergenic
929469936 2:42181584-42181606 ATATGAAACCTGGCCAGGCGCGG - Intronic
929792982 2:45037410-45037432 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
930098993 2:47588639-47588661 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
930119365 2:47747655-47747677 AAAAGCCCACTGGCCAGGTGTGG + Intronic
930139373 2:47935934-47935956 AGAAGATAAGTGGCCAGGTGCGG - Intergenic
930168646 2:48229298-48229320 GGAGGCAAACTGGCCAGGCGTGG - Intergenic
930205616 2:48584421-48584443 ATAAAAAAACTAGCCAGGCGTGG - Intronic
930487278 2:52025082-52025104 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
930672913 2:54170441-54170463 AGAAATGAACTGGCCAGGCGTGG - Intronic
930798145 2:55414773-55414795 ATAAGGTTCCTGGCCAGGTGTGG + Intronic
930955184 2:57195695-57195717 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
931026309 2:58116395-58116417 ATAAGGGAACTGGGCAGGTGGGG + Intronic
931042701 2:58316430-58316452 ATAAGGAAACTGGGCAGGTGGGG - Intergenic
931205060 2:60138908-60138930 ATAGATTAATTGGCCAGGCGTGG - Intergenic
931237023 2:60420340-60420362 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
931288947 2:60855695-60855717 AGAAAAAAACTGGCCAGGCGTGG + Intergenic
931355289 2:61532545-61532567 AAAAGATTTCTGGCCAGGCGCGG + Intronic
931405853 2:61977532-61977554 ATTAGCAGACTGGCCAGGCGCGG - Intronic
931565219 2:63609074-63609096 ATGTGCTAATGGGCCAGGCGCGG + Intronic
931625868 2:64255269-64255291 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
931662896 2:64584884-64584906 ATATCATGACTGGCCAGGCGCGG - Intronic
931696268 2:64873025-64873047 AAAACAAAACTGGCCAGGCGCGG - Intergenic
931948344 2:67334337-67334359 ATAAGGAAACTGGGCAGGTGGGG - Intergenic
932159365 2:69446626-69446648 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
932295933 2:70623367-70623389 ATAAGGGAACTGGGCAGGTGGGG - Intronic
932358732 2:71088017-71088039 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
932367559 2:71162660-71162682 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
932674629 2:73768664-73768686 ATAAGGAGTCTGGCCAGGCGCGG + Intronic
932854121 2:75216746-75216768 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
932933177 2:76067151-76067173 ATAAGCAAACAGGCCGGGCGCGG + Intergenic
932973862 2:76576823-76576845 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
933013177 2:77091107-77091129 ATAAGGGAACTGGGCAGGTGGGG - Intronic
933042819 2:77489957-77489979 AAAAACTACTTGGCCAGGCGTGG + Intronic
933079356 2:77967840-77967862 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
933163804 2:79054111-79054133 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
933179685 2:79214790-79214812 ATAAGGGAACTGGGCAGGTGGGG + Intronic
933605538 2:84378439-84378461 ATAAATAAACTGGCCAGGTGTGG + Intergenic
933809558 2:86024602-86024624 AAAAATTAACTGGCCAGGCACGG + Exonic
933838618 2:86266715-86266737 ACAAACTAAAAGGCCAGGCGTGG + Intronic
934918974 2:98326603-98326625 ATAAAATAATTAGCCAGGCGTGG + Intergenic
934964192 2:98705651-98705673 ATCAACTAACAGGCCGGGCGCGG + Intronic
935166867 2:100577375-100577397 ATTAGTTAACAGGCCAGGCATGG - Intergenic
935230416 2:101090990-101091012 ATAAGAAAACCGGCCAGGAGTGG + Intronic
935791822 2:106599072-106599094 TTAAACAAACTGGCCAGGTGCGG - Intergenic
935960868 2:108424314-108424336 AAAATCTATCTGGCCAGGCATGG + Intergenic
936883419 2:117281472-117281494 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
937167542 2:119835469-119835491 ATAACATAAATGGCCAGGCACGG - Intronic
937181481 2:119999888-119999910 ATAAATTCCCTGGCCAGGCGCGG + Intergenic
937408942 2:121655955-121655977 AAAAGCAAATTGGCCAGGCATGG - Intergenic
937452059 2:122010111-122010133 AGAAGCTAAAAGGCCAGGTGTGG + Intergenic
937695358 2:124802832-124802854 GAAATCTAACTGGCCAGGCGCGG + Intronic
937918883 2:127116197-127116219 ACAATCTAAATGTCCAGGCGTGG + Intergenic
938007278 2:127797719-127797741 ACAAGCCAACAGGCCAGGCACGG + Intronic
938949088 2:136240866-136240888 GAAACCAAACTGGCCAGGCGCGG + Intergenic
939280570 2:140058968-140058990 AAAAGTTCACTGGCCAGGCTCGG + Intergenic
939307494 2:140428873-140428895 ATAAGGGAACTGGGCAGGTGGGG - Intronic
939572046 2:143851979-143852001 ATAAACAAATTAGCCAGGCGTGG - Intergenic
939682048 2:145148441-145148463 AAAAACAAACAGGCCAGGCGTGG - Intergenic
940183031 2:150955780-150955802 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
940183775 2:150961043-150961065 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
940216908 2:151311564-151311586 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
940473200 2:154126343-154126365 ATAAATTAATGGGCCAGGCGCGG + Intronic
940508700 2:154586208-154586230 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
940530269 2:154870051-154870073 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
940675720 2:156723039-156723061 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
940799683 2:158119718-158119740 AAAAACTATCTGGCCAGGCATGG + Intronic
941116125 2:161474368-161474390 ATATACAAACTAGCCAGGCGTGG - Intronic
941179155 2:162236880-162236902 AACAGATAACAGGCCAGGCGTGG - Intronic
941353474 2:164461849-164461871 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
941456107 2:165713475-165713497 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
941797907 2:169621799-169621821 AAAAGTTAAGTGGCCAGGCACGG + Intronic
941807429 2:169722932-169722954 AGAAAATACCTGGCCAGGCGTGG - Intronic
941935809 2:170980613-170980635 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
941967370 2:171313117-171313139 AATAACTAACTAGCCAGGCGCGG + Intergenic
942104292 2:172617241-172617263 TTAAAATAACTGGCCAGGCGTGG - Intergenic
942990375 2:182193274-182193296 AAAACAAAACTGGCCAGGCGCGG - Intronic
943025561 2:182623833-182623855 ATAAGAAGACAGGCCAGGCGCGG + Intergenic
943412845 2:187563460-187563482 ATAAGGGAACTGGGCAGGTGGGG + Intronic
943421498 2:187673458-187673480 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
943450208 2:188035944-188035966 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
943505610 2:188753258-188753280 ATAAACCTAATGGCCAGGCGTGG + Intronic
943603559 2:189949918-189949940 AGTAGGTAACAGGCCAGGCGTGG - Intronic
943806728 2:192133150-192133172 ATAAGGGAACTGGGCAGGTGGGG - Intronic
943807562 2:192141160-192141182 ATAAGCATATTGGCCAGGCGCGG + Intronic
943835477 2:192510210-192510232 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
943951207 2:194133858-194133880 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
944064495 2:195604432-195604454 AGAATTTAACTGGCCAGGTGTGG + Intronic
944104341 2:196063170-196063192 AGAACCAACCTGGCCAGGCGTGG - Intronic
944115133 2:196177880-196177902 ATAAGAAAACTAGCCAGGCACGG + Intergenic
944166451 2:196727113-196727135 AAAATCAAACAGGCCAGGCGAGG + Intronic
944182665 2:196912342-196912364 ATAACTAAACTGGCCAGGCATGG + Intronic
944251115 2:197580849-197580871 ATAAGGGAACTGGGCAGGTGGGG - Intronic
944387536 2:199182105-199182127 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
944394225 2:199249666-199249688 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
944734779 2:202552141-202552163 ATAAAAAAATTGGCCAGGCGTGG - Intronic
944756710 2:202770462-202770484 ATAAAATAATTAGCCAGGCGTGG - Intergenic
944876039 2:203964890-203964912 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
945153013 2:206809827-206809849 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
945218125 2:207456474-207456496 TTAAGGTTACTGGCCAGGCATGG + Intergenic
945226521 2:207536697-207536719 ATGTGCTATTTGGCCAGGCGTGG + Intronic
945361724 2:208901973-208901995 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
945376187 2:209080807-209080829 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
945394385 2:209301954-209301976 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
945554775 2:211264204-211264226 ATAAGGGAACTGGGCAGGTGAGG - Intergenic
945637378 2:212372457-212372479 AAAAGATGCCTGGCCAGGCGCGG + Intronic
945938412 2:215925112-215925134 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
946214953 2:218177011-218177033 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
946272878 2:218608846-218608868 ATAAAAGAACTGGCCGGGCGCGG + Intronic
946677723 2:222180211-222180233 ATAACATTACTGGCCAGGCATGG + Intergenic
946780958 2:223192810-223192832 ATAAGGGAACTGGGCAGGTGGGG + Intronic
946821714 2:223636528-223636550 AAAAAATAACAGGCCAGGCGTGG + Intergenic
946848791 2:223885106-223885128 AAATGCTAACTGGCCGGGCATGG - Intronic
946871677 2:224090821-224090843 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
946893361 2:224299411-224299433 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
946976982 2:225164054-225164076 ATAATTAATCTGGCCAGGCGCGG - Intergenic
947224967 2:227831271-227831293 ATAAAATAATTAGCCAGGCGTGG - Intergenic
947409957 2:229826988-229827010 AGAAATTAACTGGCCAGGCATGG + Intronic
947587859 2:231367690-231367712 ATAAGTTAACTGGCCGGGCGCGG + Intronic
947865250 2:233393316-233393338 AAAAGGAAACAGGCCAGGCGTGG - Intronic
948390103 2:237605843-237605865 AAAAGCAAATGGGCCAGGCGCGG + Intergenic
948390778 2:237609691-237609713 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1169036536 20:2457506-2457528 ATAAGAGTACTGGCCAGGCATGG + Intergenic
1169435871 20:5589319-5589341 AAAAATTAACAGGCCAGGCGTGG + Intronic
1169444757 20:5662145-5662167 AAAAAATTACTGGCCAGGCGTGG + Intergenic
1169662301 20:7993438-7993460 ATGAGCTAACTGAGCAGGCAGGG + Intronic
1169860453 20:10145960-10145982 ATGGGCTGACTGGCCTGGCGTGG + Intergenic
1170018396 20:11808922-11808944 ATAAGATACTTGGCCGGGCGCGG - Intergenic
1170068783 20:12343245-12343267 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1170106321 20:12756613-12756635 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1170165829 20:13359698-13359720 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1170214065 20:13873648-13873670 ATCAGTAAACTGGCCAGGCATGG - Intronic
1171723546 20:28592429-28592451 TTAAGATTACTGGCCAGGTGCGG - Intergenic
1171859803 20:30387499-30387521 TTAAGATTACTGGCCGGGCGCGG + Intronic
1171969207 20:31553005-31553027 AAAAATTAAATGGCCAGGCGTGG + Intronic
1172490773 20:35335885-35335907 ATAAGATGCCTGGCTAGGCGTGG + Intronic
1172723401 20:37016634-37016656 AGAAGCAACCTGGCCAGGCATGG + Intronic
1172932382 20:38595686-38595708 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1173049268 20:39543380-39543402 ATAAAAAAACTAGCCAGGCGTGG - Intergenic
1173101998 20:40096079-40096101 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1173209392 20:41020372-41020394 AGAAGCTACCTGGCCAGGCACGG + Intergenic
1173781819 20:45762534-45762556 ATAAGGGAACTGGGCAGGTGGGG - Intronic
1174241728 20:49141602-49141624 ACAAGGCAACGGGCCAGGCGAGG + Intronic
1174250185 20:49213516-49213538 AAAAGCAAATAGGCCAGGCGCGG - Intergenic
1174255419 20:49250997-49251019 ATAAGAATTCTGGCCAGGCGCGG - Intronic
1174325550 20:49775919-49775941 TTAAAATAACAGGCCAGGCGTGG + Intergenic
1174384508 20:50179261-50179283 GAAAGCTTACAGGCCAGGCGCGG - Intergenic
1174618854 20:51858422-51858444 ACAAACAAACAGGCCAGGCGCGG + Intergenic
1175276909 20:57777719-57777741 AGAAGGAAATTGGCCAGGCGCGG - Intergenic
1175897003 20:62342010-62342032 GGAAGAAAACTGGCCAGGCGTGG + Intronic
1176188822 20:63796877-63796899 GTAATCTAACAGGCCAGGCACGG + Intronic
1176287664 21:5027168-5027190 ACAAACTAATTGGCCAGGCGCGG - Intronic
1176972404 21:15281859-15281881 AGAAGCTAACTGGCCAGTTGTGG - Intergenic
1177031093 21:15982767-15982789 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1177119649 21:17124229-17124251 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1177151817 21:17462839-17462861 AAAATCAAACTGGCCGGGCGCGG + Intergenic
1177324139 21:19561602-19561624 GTAAGCAAACTGGCCGGGCGCGG - Intergenic
1177840670 21:26231023-26231045 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1178219245 21:30637532-30637554 ACAAGGAAATTGGCCAGGCGTGG - Intergenic
1178321224 21:31607320-31607342 ATAAAATAATTAGCCAGGCGTGG - Intergenic
1178925423 21:36770927-36770949 ATAAGACAATTGGCCGGGCGTGG + Intronic
1178989889 21:37344090-37344112 ATAACCTGAGTGGCCAGGCGCGG - Intergenic
1179015196 21:37589980-37590002 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1179206000 21:39279346-39279368 ATTTTCTAACAGGCCAGGCGTGG + Intronic
1179216194 21:39369049-39369071 ATAGTATAACTGGCCAGGCATGG + Intergenic
1179387647 21:40957686-40957708 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1179574702 21:42300705-42300727 ACAACCCAACTGGCCAGGCGGGG + Intergenic
1179650287 21:42804015-42804037 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1179869517 21:44236307-44236329 ACAAACTAATTGGCCAGGCGCGG + Intronic
1180018317 21:45102180-45102202 ATAAGCACATTGGCCAGGCATGG - Intronic
1180637961 22:17275765-17275787 ATAAACCAATAGGCCAGGCGCGG + Intergenic
1180648022 22:17355728-17355750 ATAAAAAAAGTGGCCAGGCGTGG + Intergenic
1181004539 22:20006285-20006307 AGAGGCTCCCTGGCCAGGCGTGG + Intronic
1181031836 22:20152083-20152105 AGAGGATAACAGGCCAGGCGCGG - Intergenic
1181403320 22:22664962-22664984 AGAAGCTCACTGGCCAGACTTGG - Intergenic
1181408325 22:22700948-22700970 AGAAGCTCACTGGCCAGACTTGG - Intergenic
1181538311 22:23558741-23558763 AAAAGGTATCTGGCCAGGTGTGG + Intergenic
1182401903 22:30084853-30084875 ATGAGCTAAACGGCCAGGCGTGG + Intronic
1182732362 22:32505508-32505530 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1182799838 22:33023057-33023079 AAAATCTAAGTGGCCAGGCATGG + Intronic
1182998684 22:34837049-34837071 ATAAGGGAACTGGGCAGGTGCGG - Intergenic
1183146648 22:35998665-35998687 ATAACCTAATTGGCCAGGCGCGG - Intronic
1183844339 22:40528445-40528467 TAAAACTAAGTGGCCAGGCGTGG + Intronic
1183891829 22:40935994-40936016 ATATTCTCACTGGCCGGGCGCGG + Intergenic
1183983749 22:41557901-41557923 ATAAGCTGATTGGCCAGCAGAGG - Intergenic
1184028271 22:41874610-41874632 TTAAGATAACTGTCCAGGCTAGG + Intronic
1184485102 22:44773104-44773126 AAAAGCTTCCTGGCCAGGCTTGG - Intronic
949162008 3:893642-893664 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
949190309 3:1242781-1242803 ATAAGGGAACTGGGCAGGTGGGG + Intronic
949291369 3:2470363-2470385 ATAAGCAACATGGCCAGGCGCGG - Intronic
949671242 3:6400415-6400437 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
949827529 3:8179746-8179768 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
950051153 3:9990801-9990823 ATAAAAGAATTGGCCAGGCGTGG - Intronic
950350521 3:12346788-12346810 ATAAAATAATTGGCCAGGCATGG - Intronic
950578869 3:13850193-13850215 CGAAGCTGACTGGCCAGGCCAGG - Intronic
950651312 3:14409096-14409118 AAAACAAAACTGGCCAGGCGTGG - Intronic
950827201 3:15836784-15836806 TGGAGCTAACAGGCCAGGCGTGG + Intronic
950926582 3:16747052-16747074 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
951316235 3:21192171-21192193 ATAAGGGAACTGGCCAGGTGGGG + Intergenic
951762712 3:26163344-26163366 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
952075384 3:29690157-29690179 ATGACATATCTGGCCAGGCGTGG + Intronic
952296963 3:32070338-32070360 ATAAGGGAACTGGACAGGTGGGG - Intronic
952343490 3:32464392-32464414 ATAAGGGAACTGGGCAGGTGGGG + Intronic
952396569 3:32926431-32926453 AAAAGATACCTGGCCGGGCGCGG + Intergenic
952663380 3:35877300-35877322 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
952855689 3:37769046-37769068 ATATACTAATAGGCCAGGCGTGG + Intronic
952895131 3:38073633-38073655 ATAAGGGAACTGGGCAGGTGGGG + Intronic
952895967 3:38079250-38079272 ATAAGGGAACTGGGCAGGTGGGG + Intronic
953077040 3:39580773-39580795 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
953177285 3:40563713-40563735 ATAAGGGAACTGGGCAGGTGGGG - Intronic
953245431 3:41186860-41186882 ATAAAATAAATAGCCAGGCGTGG + Intergenic
953484308 3:43280495-43280517 AGAAACTGACTGGCCAGGCACGG + Intergenic
953614120 3:44474839-44474861 AAAAGTTTGCTGGCCAGGCGCGG + Intronic
953619341 3:44519548-44519570 GAAAGCAAACTGGCCAGGCGCGG + Intergenic
953825622 3:46249283-46249305 ATAAGGGAACTGGGCAGGTGGGG + Intronic
954047464 3:47945060-47945082 ATCAGATTGCTGGCCAGGCGCGG + Intronic
954176636 3:48850222-48850244 AAAAACAAACAGGCCAGGCGTGG - Intergenic
954266381 3:49473123-49473145 ACAAAACAACTGGCCAGGCGCGG + Intronic
954646608 3:52135540-52135562 ATCAGCTAATGGGCCAGGTGTGG - Intronic
954728360 3:52636017-52636039 AAAACCAAATTGGCCAGGCGTGG - Intronic
954930880 3:54280369-54280391 ATGAACGAACAGGCCAGGCGCGG - Intronic
954969186 3:54637464-54637486 ATAAGGGAACTGGGCAGGTGGGG + Intronic
955100803 3:55847950-55847972 ATAAAATAATTAGCCAGGCGTGG - Intronic
955173280 3:56586236-56586258 CTAAAGTAACCGGCCAGGCGTGG + Intronic
955253451 3:57306418-57306440 ATAAGGGAACTGGGCAGGTGGGG - Intronic
955256962 3:57342348-57342370 ATTTGCAAACTGGCCAGACGTGG + Intronic
955339049 3:58110734-58110756 ATTAGCTGAGTGGCCAGGCACGG - Intronic
955470431 3:59281319-59281341 AAAAGCAAATCGGCCAGGCGTGG - Intergenic
955608600 3:60732974-60732996 ATATGCAATCAGGCCAGGCGTGG - Intronic
955754760 3:62216060-62216082 ATATGAAAATTGGCCAGGCGTGG + Intronic
955768945 3:62371199-62371221 AAAAGGTAACGTGCCAGGCGAGG - Exonic
956233419 3:67041655-67041677 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
956366340 3:68507191-68507213 ATAAGCTAACTGGCTATCCAAGG - Intronic
956548912 3:70437836-70437858 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
956709299 3:72025728-72025750 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
957059819 3:75473002-75473024 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
957157877 3:76568594-76568616 AAAAGCAATGTGGCCAGGCGCGG - Intronic
957230171 3:77503233-77503255 ATAATATAAATGGCCAGGCGCGG + Intronic
957295324 3:78326542-78326564 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
957317219 3:78586117-78586139 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
957847820 3:85761663-85761685 ATAAGTTTTGTGGCCAGGCGTGG - Intronic
957904773 3:86541357-86541379 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
958521354 3:95191337-95191359 AGAAAATAACTGGCCGGGCGCGG - Intergenic
958676727 3:97275955-97275977 ATAAGGGAGCTGGGCAGGCGGGG + Intronic
958716883 3:97794502-97794524 ATAACCAAAGTGGCCGGGCGCGG - Intronic
959134498 3:102400107-102400129 TTAAACTCTCTGGCCAGGCGTGG - Intronic
959288266 3:104442888-104442910 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
959393353 3:105804363-105804385 ACAAAAAAACTGGCCAGGCGTGG + Intronic
959485694 3:106925699-106925721 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
959549262 3:107636176-107636198 ATAAGCTGAGTGGCCAAGCCTGG + Intronic
959673059 3:109001286-109001308 ATAAGCTAATTTCCCAGGCGTGG - Intronic
959969653 3:112395046-112395068 ATACGATAATTAGCCAGGCGTGG + Intergenic
959972176 3:112420534-112420556 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
960117607 3:113912015-113912037 TTAAGTTAATTGGCCAGGTGCGG - Intronic
960282788 3:115796475-115796497 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
960310036 3:116108292-116108314 ATAAGGGAACTGGGCAGGTGGGG + Intronic
960622021 3:119646338-119646360 AGCAGCAAACTGGCCAGGCATGG + Intronic
960834356 3:121889735-121889757 ATACGAAAACTGGCCAGGCGTGG - Intergenic
961026962 3:123566603-123566625 ATAAGGTTCTTGGCCAGGCGTGG + Intronic
961293587 3:125866435-125866457 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
961681082 3:128600599-128600621 ATAAGGAAACTGGCCTGGCATGG - Intergenic
961730672 3:128962436-128962458 ATAAGGGAACTGGGCAGGTGGGG - Intronic
961893639 3:130150126-130150148 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
962210812 3:133476108-133476130 AGAAGCAAGGTGGCCAGGCGCGG + Intergenic
962302801 3:134257994-134258016 AAAAATTAACAGGCCAGGCGCGG - Intergenic
962533691 3:136307683-136307705 ATAATATGACAGGCCAGGCGTGG + Intronic
962657701 3:137565468-137565490 AAAAGCTCCCTGGCCGGGCGCGG + Intergenic
963058708 3:141207704-141207726 ATAAGGAAACTGGGCAGGTGGGG - Intergenic
963178843 3:142332061-142332083 ATAATATAACTGGCCAGGTGTGG - Intronic
963417516 3:145016729-145016751 ATAAAATACCTGGCCGGGCGTGG + Intergenic
963425300 3:145115720-145115742 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
963456582 3:145554158-145554180 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
963656756 3:148062283-148062305 AAAAACTTACTGGCCAGGCGCGG - Intergenic
963663428 3:148154387-148154409 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
963684420 3:148417084-148417106 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
963743145 3:149098937-149098959 AAAAGCTAAGTGGCTGGGCGCGG - Intergenic
964067978 3:152600183-152600205 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
964109415 3:153073396-153073418 ATGTGTTAACTGGCCAGGCTCGG + Intergenic
964125372 3:153229663-153229685 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
964247890 3:154674831-154674853 TGAAGGTGACTGGCCAGGCGCGG - Intergenic
964300169 3:155278157-155278179 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
964315746 3:155442701-155442723 ATCATTTAACTGGCCGGGCGCGG + Intronic
964352887 3:155820506-155820528 AAAAGATAAAGGGCCAGGCGAGG - Intergenic
964395707 3:156243516-156243538 ATAAGCACACCAGCCAGGCGTGG - Intronic
964906440 3:161724859-161724881 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
964984793 3:162725498-162725520 ATAAGGAAACTGGACAGGTGGGG + Intergenic
965070407 3:163910283-163910305 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
965105155 3:164345104-164345126 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
965262566 3:166503756-166503778 ATAAGGAAACTGGGCAGGTGGGG + Intergenic
965286649 3:166827086-166827108 ATAAGTGAACTGGGCAGGTGGGG + Intergenic
965336414 3:167433955-167433977 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
965409894 3:168317821-168317843 ATAATGTGCCTGGCCAGGCGTGG + Intergenic
965414283 3:168373115-168373137 ATAAGCTGTCTGGCCGGGTGTGG + Intergenic
965600854 3:170453640-170453662 ATACGAAAACTAGCCAGGCGTGG - Intronic
965626237 3:170686304-170686326 ATAAGGGAACTGGGCAGGTGGGG + Intronic
965639958 3:170820937-170820959 ATAAGGGAACTGGGCAGGTGGGG + Intronic
965713497 3:171579154-171579176 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
965976193 3:174625346-174625368 ATAAACTTATAGGCCAGGCGTGG - Intronic
966066915 3:175830441-175830463 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
966085512 3:176064075-176064097 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
966105009 3:176324603-176324625 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
966232768 3:177668823-177668845 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
966725842 3:183107696-183107718 AAAAGAAAACTAGCCAGGCGTGG - Intronic
966797741 3:183731848-183731870 AACAGCTAACTGCTCAGGCGTGG - Intronic
966845370 3:184124939-184124961 AATAGCTAACTGGCCAGGTACGG - Intergenic
966878871 3:184338597-184338619 AGAAGCTGGCTGGCCAGGCGTGG - Intronic
967152204 3:186660754-186660776 ATAAGGGAACTGGGCAGGTGGGG - Intronic
967212077 3:187178503-187178525 ATAAGGGAACTGGGCAGGTGGGG + Intronic
967244091 3:187469246-187469268 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
967348787 3:188488925-188488947 TAAAACTAACTGGCCGGGCGCGG - Intronic
967431512 3:189391417-189391439 AAAAGATATCTGGCCAGGTGTGG - Intergenic
967496310 3:190147240-190147262 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
967561471 3:190922846-190922868 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
967624563 3:191669458-191669480 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
967643740 3:191898329-191898351 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
967658028 3:192074060-192074082 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
967740561 3:192998422-192998444 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
968114347 3:196078366-196078388 AAAAGCTTTCTGGCCAGGCACGG + Intronic
968144918 3:196289895-196289917 ATAAAATTACTGGCCAGGTGTGG + Intronic
968413163 4:406488-406510 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
968513875 4:1008006-1008028 ATAAAAAAACTAGCCAGGCGTGG - Intergenic
968842013 4:3014501-3014523 ATGAGATCTCTGGCCAGGCGCGG + Intronic
968993464 4:3930108-3930130 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
969380075 4:6789560-6789582 ATGAGATGACTGGCCAGGCACGG - Intronic
969749136 4:9096998-9097020 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
969810197 4:9641638-9641660 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
970029149 4:11656703-11656725 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
970087625 4:12366502-12366524 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
970133807 4:12899922-12899944 ATATGCACACTGGCCAGGCCTGG - Intergenic
970256338 4:14173500-14173522 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
970532822 4:17000397-17000419 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
970863795 4:20735823-20735845 ACAAGAAATCTGGCCAGGCGTGG - Intronic
970941322 4:21637486-21637508 ATGAGAAAACAGGCCAGGCGCGG + Intronic
971200221 4:24503747-24503769 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
971210490 4:24611443-24611465 ATAACCTCACTGGCCAGGTGCGG + Intergenic
971215361 4:24657495-24657517 ATAAAAAAATTGGCCAGGCGTGG - Intergenic
971218827 4:24686593-24686615 ATCTGCTTACAGGCCAGGCGTGG + Intergenic
971395442 4:26222863-26222885 ATACTTTAATTGGCCAGGCGTGG + Intronic
971883829 4:32415733-32415755 AAGAGCTAACTGGCCGGGTGTGG - Intergenic
972071052 4:35019754-35019776 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
972274571 4:37545144-37545166 CCAAGCAACCTGGCCAGGCGCGG - Intronic
972426300 4:38936382-38936404 AAAAACAAACAGGCCAGGCGCGG - Intronic
972627208 4:40811396-40811418 ATATACAAATTGGCCAGGCGTGG + Intronic
973148388 4:46858383-46858405 ATAAGCGATGTGGCCAAGCGTGG - Intronic
973221609 4:47732851-47732873 AGTAGATTACTGGCCAGGCGCGG - Intronic
973287687 4:48438154-48438176 AGAAAAAAACTGGCCAGGCGTGG - Intergenic
973536831 4:51891425-51891447 ATAAGATAACTTGCCATGGGTGG + Intronic
973561341 4:52139518-52139540 ATAAGAAAAGGGGCCAGGCGCGG + Intergenic
973908988 4:55560316-55560338 ATAAGCAAACAGGCCAGGCTTGG + Intronic
974048082 4:56913932-56913954 AAAAAAAAACTGGCCAGGCGCGG - Intronic
974129449 4:57735111-57735133 ATATACTAAGAGGCCAGGCGTGG - Intergenic
974300915 4:60066426-60066448 AAAAGAAAACTGGCCAGGAGAGG - Intergenic
974428314 4:61767274-61767296 ATAAGGGAACTGGGCAGGTGGGG + Intronic
974441315 4:61921694-61921716 AAAAGCTAACAGGCCGGGCATGG - Intronic
974763686 4:66311922-66311944 ATAAGAGAGCTGGCCAGGCGGGG + Intergenic
974846487 4:67357239-67357261 ATCAATTGACTGGCCAGGCGTGG + Intergenic
974903856 4:68033348-68033370 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
975102136 4:70525742-70525764 ATAAAATAAATAGCCAGGCGTGG + Intronic
975159980 4:71113955-71113977 AAAAGCAAACAGGCCGGGCGCGG + Intergenic
975463816 4:74686899-74686921 ATATCCTAGCTGGCCAGGTGCGG - Intergenic
975635579 4:76444782-76444804 ATGAGAAAACTGGCCAGGCGTGG - Intronic
975783970 4:77868044-77868066 AAGAAATAACTGGCCAGGCGCGG - Intronic
975933803 4:79556951-79556973 ATAAGAAAACTGGGCAGGTGGGG + Intergenic
976024353 4:80669441-80669463 ATCAAGTAACTGGCCAGGCACGG - Intronic
976074782 4:81285210-81285232 ATAAGGTAATTGACCAGGCATGG - Intergenic
976285344 4:83365653-83365675 ATACACTAACTGGCCAGGCGTGG + Intergenic
976558644 4:86477322-86477344 ATAAGGGAACTGGGCAGGTGGGG - Intronic
976578377 4:86703880-86703902 ATAATAAAATTGGCCAGGCGTGG + Intronic
976654298 4:87471788-87471810 TTAAGGTAATTGGCCAGGTGTGG + Intergenic
976696627 4:87924600-87924622 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
976800035 4:88979681-88979703 AAAAACTAATTGGCCAGGCATGG + Intronic
976884486 4:89967771-89967793 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
976938049 4:90664608-90664630 AGAAACTAATTGGCCAGGCACGG + Intronic
977010402 4:91626816-91626838 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
977012839 4:91657596-91657618 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
977075118 4:92441940-92441962 ATAAGGGAACTGGGCAGGTGGGG + Intronic
977198346 4:94087608-94087630 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
977217069 4:94296202-94296224 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
977224631 4:94380894-94380916 ATATGTTCATTGGCCAGGCGCGG + Intergenic
977225260 4:94386443-94386465 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
977596857 4:98892386-98892408 ATAAGACAAGGGGCCAGGCGCGG + Intronic
977667591 4:99658842-99658864 AACAGCTAACTGGCCAGCAGTGG - Intergenic
977693315 4:99940300-99940322 AAAACATAACAGGCCAGGCGTGG + Intronic
977870127 4:102081206-102081228 ATAAGATCTGTGGCCAGGCGCGG - Intergenic
978001032 4:103556737-103556759 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
978031565 4:103943872-103943894 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
978134846 4:105244878-105244900 GTAAGATTTCTGGCCAGGCGCGG - Intronic
978438690 4:108711750-108711772 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
978438706 4:108711886-108711908 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
978446251 4:108782841-108782863 ATAAAATTATTGGCCAGGCGCGG - Intergenic
978876802 4:113649789-113649811 GGAAGACAACTGGCCAGGCGTGG + Intronic
979054538 4:115978632-115978654 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
979146696 4:117254828-117254850 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
979171331 4:117603290-117603312 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
979248760 4:118541274-118541296 ATAAGAAAATTAGCCAGGCGTGG + Intergenic
979335532 4:119456607-119456629 ATGAGCAAAATCGCCAGGCGCGG - Intergenic
979380025 4:119996658-119996680 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
980003272 4:127514425-127514447 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
980036859 4:127894516-127894538 ATAAAACAACTAGCCAGGCGTGG - Intronic
980049803 4:128027692-128027714 TTAAAATTACTGGCCAGGCGCGG - Intronic
980111842 4:128643841-128643863 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
980491276 4:133532172-133532194 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
980527949 4:134014911-134014933 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
980575547 4:134680886-134680908 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
980611699 4:135170274-135170296 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
980904021 4:138930600-138930622 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
980931051 4:139183474-139183496 TTAATCTGATTGGCCAGGCGCGG - Intergenic
980939535 4:139260630-139260652 ATTAGCTGACTGGCTGGGCGCGG + Intergenic
981040328 4:140216230-140216252 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
981129572 4:141143158-141143180 ATGAGATACCTGACCAGGCGCGG - Intronic
981396529 4:144256080-144256102 ATATGAAAATTGGCCAGGCGCGG - Intergenic
981539807 4:145835482-145835504 ATAAGGGAACTGGGCAGGTGGGG - Intronic
981720090 4:147792857-147792879 ACAAGGTAGTTGGCCAGGCGAGG + Intronic
981732249 4:147911650-147911672 TTAAGTTAAGAGGCCAGGCGCGG - Intronic
982151665 4:152465552-152465574 ATTACCCATCTGGCCAGGCGCGG + Intronic
982180394 4:152744306-152744328 ATAAGGGAACTGGGCAGGTGGGG + Intronic
982215468 4:153079481-153079503 ATATTCTCACTGGCCAGGCTGGG + Intergenic
982318894 4:154059010-154059032 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
982535530 4:156603017-156603039 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
982542928 4:156697184-156697206 ATAACCTTACAGGCCAGGAGTGG - Intergenic
982572578 4:157068725-157068747 ATAATATAACAGGCCAGGTGTGG + Intergenic
982650200 4:158078843-158078865 ATCAACCAACTGGCCAGGCAGGG - Intergenic
983023958 4:162711834-162711856 ATAAGGCAACTGGGCAGGTGGGG - Intergenic
983183780 4:164678369-164678391 ATAAGCAAACAGGCCAGGCAAGG + Intergenic
983207142 4:164922320-164922342 TTAAGATAACTGGCCAGGTGTGG - Intergenic
983260706 4:165453245-165453267 ATAAGAAAATTGGCCAGGCATGG - Intronic
983264834 4:165497208-165497230 AAGATGTAACTGGCCAGGCGCGG - Intronic
983345643 4:166523259-166523281 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
983372384 4:166877984-166878006 ATAAACAAAATGGCCGGGCGCGG + Intronic
983414622 4:167438778-167438800 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
983448136 4:167878988-167879010 ATAAGGGAACTGGGCAGGTGCGG - Intergenic
983452418 4:167925626-167925648 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
983472024 4:168168707-168168729 ATACACTGATTGGCCAGGCGCGG - Intronic
983510641 4:168606382-168606404 TTAAGCTTCCTGGCCAGGCGTGG + Intronic
983659659 4:170119186-170119208 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
983707750 4:170680229-170680251 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
983805712 4:171989005-171989027 ATAAGGGAACTGGGCAGGTGGGG + Intronic
984098963 4:175464414-175464436 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
984165273 4:176297825-176297847 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
984322273 4:178209830-178209852 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
984437344 4:179723181-179723203 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
984463642 4:180069814-180069836 ACAACCAAACTGGCCAGGCACGG - Intergenic
984676298 4:182551859-182551881 AAAAAATAACTAGCCAGGCGTGG + Intronic
984700756 4:182817255-182817277 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
984848401 4:184128469-184128491 ATAGGCTAACTGCCCAGGCATGG - Intronic
985038721 4:185867298-185867320 ATAAACCTTCTGGCCAGGCGCGG - Intronic
985057313 4:186047175-186047197 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
985313228 4:188626783-188626805 AAAAGACAACTGGCCAGGCACGG + Intergenic
985389781 4:189482437-189482459 ATAAGAGAACTGGGCAGGTGGGG + Intergenic
985435800 4:189928590-189928612 ATAAGAGAACTGGGCAGGTGGGG - Intergenic
985437959 4:189951197-189951219 TTAAGATTACTGGCCAGGCGCGG + Intronic
985582432 5:705522-705544 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
986193612 5:5518279-5518301 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
986388963 5:7266320-7266342 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
986432932 5:7699385-7699407 AAATGCTTACTGGCCGGGCGCGG - Intronic
986554964 5:9001520-9001542 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
986703619 5:10436006-10436028 ATAATCAAGTTGGCCAGGCGTGG - Exonic
986919501 5:12665514-12665536 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
986956631 5:13158517-13158539 TTAAGATTATTGGCCAGGCGTGG + Intergenic
987139576 5:14931567-14931589 AAAAGTTTACAGGCCAGGCGCGG + Intergenic
987487583 5:18541046-18541068 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
987498039 5:18671832-18671854 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
987636397 5:20547271-20547293 AGAATCAAACTGGCCAGGCATGG + Intronic
987755903 5:22097573-22097595 ATAAGGGAACTGGGCAGGTGGGG - Intronic
988486274 5:31670709-31670731 AAACGCAAACTGGCCGGGCGCGG - Intronic
988951265 5:36263815-36263837 AGAAGTGAAGTGGCCAGGCGTGG - Intronic
989154008 5:38326780-38326802 ATACCCTTACGGGCCAGGCGCGG - Intronic
989595390 5:43151723-43151745 ATACGATGACTGGCAAGGCGCGG - Intronic
989660010 5:43788842-43788864 ATAAGGGGACTGGCCAGGTGGGG - Intergenic
990352728 5:54934953-54934975 ATAAGCCAACAGCCCAGGCAGGG + Intergenic
990427269 5:55698961-55698983 AAAAACAAACTGGCCAGGAGTGG + Intronic
990555387 5:56929407-56929429 AAAAACAAACTAGCCAGGCGTGG + Intronic
991049937 5:62261995-62262017 AGAAGGAAACCGGCCAGGCGCGG + Intergenic
991331058 5:65492369-65492391 ATATGCAATTTGGCCAGGCGTGG - Intergenic
991773136 5:70058490-70058512 ATAACAGAACTGGCCAGGCATGG - Intronic
991779372 5:70117499-70117521 ATAAGCTCAACTGCCAGGCGCGG + Intergenic
991812037 5:70484321-70484343 ATAAGCTCAACTGCCAGGCGCGG - Intergenic
991852429 5:70933914-70933936 ATAACAGAACTGGCCAGGCATGG - Intronic
991858664 5:70992972-70992994 ATAAGCTCAACTGCCAGGCGCGG + Intronic
991871822 5:71117855-71117877 ATAAGCTCAACTGCCAGGCGCGG + Intergenic
992394751 5:76360091-76360113 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
992664004 5:78988048-78988070 ATAAGCGTTCTGGCCAGGCGTGG - Intergenic
992745658 5:79817798-79817820 AAAAGATTATTGGCCAGGCGCGG - Intergenic
993091633 5:83433630-83433652 GTAAGCTTTGTGGCCAGGCGTGG + Intergenic
993318841 5:86446597-86446619 ATAAGACAATAGGCCAGGCGAGG + Intergenic
993913896 5:93718117-93718139 ATAAGAATATTGGCCAGGCGGGG - Intronic
994062266 5:95492344-95492366 ACAAGACAACTGGCCGGGCGCGG + Intronic
994295228 5:98081802-98081824 ATAAGAGAACTGGGCAGGTGGGG - Intergenic
994652730 5:102549623-102549645 TTAAGAAAACTGGCCAGGTGTGG + Intergenic
994775765 5:104034344-104034366 ATAAGTGAACTGGGCAGGTGGGG - Intergenic
994846175 5:104991164-104991186 ATAAACAAACTGGCAGGGCGCGG - Intergenic
994981883 5:106885874-106885896 AAAAGATAGCTGGCCAGGTGAGG + Intergenic
994989633 5:106981106-106981128 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
995095960 5:108236219-108236241 ACAAGCAAACAGGCCAGGCAGGG + Intronic
995107983 5:108397338-108397360 ACAAGACAACTGGCCAGGCGTGG - Intergenic
995296758 5:110532577-110532599 ATAAGGGAACTGGGCAGGTGGGG - Intronic
995899286 5:117049351-117049373 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
996203171 5:120700564-120700586 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
996332884 5:122351244-122351266 AAATGTGAACTGGCCAGGCGCGG + Intronic
996344733 5:122476578-122476600 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
996358537 5:122621844-122621866 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
996380559 5:122858901-122858923 ATACAATAATTGGCCAGGCGTGG - Intronic
996416376 5:123215205-123215227 ATACGAAAACTAGCCAGGCGTGG - Intergenic
996421608 5:123268860-123268882 ATTCGTTAAATGGCCAGGCGCGG - Intergenic
996509977 5:124306524-124306546 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
996528129 5:124499786-124499808 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
996732508 5:126729430-126729452 AAAAAATAAATGGCCAGGCGCGG + Intergenic
996745354 5:126842532-126842554 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
996917757 5:128732238-128732260 ATAAGGGAACTGGGCAGGTGGGG - Intronic
997157379 5:131574600-131574622 ATAAGGGAACTGGGCAGGTGGGG - Intronic
997276423 5:132596283-132596305 ATAAGCTTACTGGCTATGCACGG - Intronic
997312319 5:132897419-132897441 AGAAGATAAGTGGCCAGGCACGG + Intronic
997393180 5:133533534-133533556 ATAAACTTACTGGCCAGGCATGG - Intronic
997469066 5:134106694-134106716 ATAGGATGACGGGCCAGGCGCGG - Intergenic
997517434 5:134500648-134500670 AAAAGTTAATTGTCCAGGCGCGG - Intergenic
997548239 5:134729375-134729397 AAAAGATAACTGGCCAGGCGCGG + Intergenic
997644569 5:135472897-135472919 ATAGGCTAAGGGGCCAGGTGTGG + Intergenic
997746486 5:136304046-136304068 ATAAGGGAACTGGGCAGGTGGGG - Intronic
997772560 5:136568325-136568347 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
997805559 5:136913708-136913730 AAAAACAAACAGGCCAGGCGTGG - Intergenic
997960965 5:138321461-138321483 ATCAACTTAGTGGCCAGGCGCGG + Intronic
998097585 5:139405199-139405221 ATAAGAAAATTAGCCAGGCGTGG - Intergenic
998371987 5:141667749-141667771 ATAATATAAGTGGCCAGGTGCGG + Intronic
998419739 5:141972879-141972901 TTAAGTTAATTTGCCAGGCGCGG - Intronic
998693624 5:144614316-144614338 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
998772569 5:145563101-145563123 ATAAGATCATTGGCCAAGCGTGG - Intronic
998831852 5:146167972-146167994 ATTATCTTTCTGGCCAGGCGCGG - Intronic
998995479 5:147866012-147866034 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
998996316 5:147871960-147871982 ATAAGGGAACTGGGCAGGTGGGG + Intronic
999244365 5:150145743-150145765 AAAAGTTAATTAGCCAGGCGTGG + Intronic
999407107 5:151316448-151316470 AAAAGAGATCTGGCCAGGCGAGG + Exonic
999495808 5:152095777-152095799 ATAAAATAAGGGGCCAGGCGCGG + Intergenic
999545849 5:152627562-152627584 AGAAGCTTTTTGGCCAGGCGCGG - Intergenic
999618782 5:153452683-153452705 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
999751828 5:154633207-154633229 ATGAGATAGCTGGCCGGGCGTGG - Intergenic
999769633 5:154765547-154765569 ATTAAAAAACTGGCCAGGCGTGG - Intronic
999989765 5:157038961-157038983 AAAATAAAACTGGCCAGGCGTGG + Intronic
999989871 5:157040004-157040026 ATAACCTCACCGGCCAGGCGCGG + Intronic
1000093128 5:157947379-157947401 ATAATCTTCCTGGCCAGCCGTGG - Intergenic
1000306231 5:159996952-159996974 ACAAACAAACTGGCCAGGTGTGG + Intergenic
1000344721 5:160305102-160305124 ATCAGTGACCTGGCCAGGCGCGG - Intronic
1000438665 5:161242704-161242726 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1000439802 5:161251229-161251251 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1000519328 5:162278374-162278396 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1000607016 5:163336756-163336778 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1000747515 5:165052708-165052730 ATAAGACTTCTGGCCAGGCGTGG - Intergenic
1001331368 5:170765020-170765042 ATAAGGGAACTGGGCAGGTGGGG + Intronic
1001354221 5:171004367-171004389 ATAAGGGAACTGGGCAGGTGGGG + Intronic
1001583284 5:172815015-172815037 AAAAGCAAAGGGGCCAGGCGTGG + Intergenic
1001614467 5:173031526-173031548 ACAGGCTTCCTGGCCAGGCGAGG + Intronic
1002122054 5:177012535-177012557 ATACGAAAACTAGCCAGGCGCGG + Intronic
1002362453 5:178683303-178683325 ATATACTATCTGGCCGGGCGTGG - Intergenic
1002610872 5:180417701-180417723 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1002954346 6:1847209-1847231 ATAAGAAAATTAGCCAGGCGTGG - Intronic
1003099824 6:3168600-3168622 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1003419135 6:5940064-5940086 AAAATCTTACTGGCCAGGCTAGG + Intergenic
1003664260 6:8095208-8095230 AACAGTTTACTGGCCAGGCGAGG + Intronic
1003665309 6:8106373-8106395 AGAAGGCACCTGGCCAGGCGCGG + Intergenic
1003751784 6:9066726-9066748 AGAACCTATCAGGCCAGGCGTGG - Intergenic
1003944689 6:11064071-11064093 CTTAGGTATCTGGCCAGGCGCGG + Intergenic
1004105044 6:12659811-12659833 AATAGGTAACAGGCCAGGCGTGG + Intergenic
1004106339 6:12670105-12670127 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1004172905 6:13312394-13312416 ATGAGAAAACAGGCCAGGCGTGG + Intronic
1004283434 6:14299931-14299953 ATAAGGGAACTGGTCAGGTGGGG + Intergenic
1004504026 6:16233064-16233086 GTAAGCTGGCTGGCCAGGTGCGG + Intergenic
1004507910 6:16261967-16261989 ATAAGGGAACTGGGCAGGTGGGG + Intronic
1004575309 6:16888684-16888706 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1004618733 6:17314704-17314726 ATAAAATAATTAGCCAGGCGTGG + Intergenic
1004632831 6:17438075-17438097 ATAACATTGCTGGCCAGGCGTGG + Intronic
1004644215 6:17543832-17543854 TACAGCTAACTGGCCAGGCATGG + Intronic
1004662652 6:17723735-17723757 ATGAGCTAAAAGGCCAGGCGCGG - Intergenic
1004722762 6:18282361-18282383 TTAAGATATCTGGCCAGGCGTGG + Intergenic
1004768488 6:18757044-18757066 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1004837088 6:19541639-19541661 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1005014569 6:21364481-21364503 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1005046102 6:21643968-21643990 ATAAGACAATAGGCCAGGCGAGG - Intergenic
1005064662 6:21806555-21806577 AAGATATAACTGGCCAGGCGTGG - Intergenic
1005244034 6:23861553-23861575 ATAATGTTATTGGCCAGGCGGGG - Intergenic
1005336449 6:24801393-24801415 AAAAAATAAATGGCCAGGCGCGG + Intronic
1005474928 6:26198620-26198642 ATAAGCAAATTGGCGGGGCGCGG - Intergenic
1005505733 6:26467600-26467622 ATATGATCTCTGGCCAGGCGTGG - Intronic
1005666652 6:28064040-28064062 ATGAGCTAACTGGCTGGGTGTGG - Intergenic
1006234673 6:32618490-32618512 AAACAATAACTGGCCAGGCGTGG + Intergenic
1006456694 6:34135996-34136018 AGATGCTAACTGGCCAGCTGTGG + Intronic
1006469217 6:34217254-34217276 AAAAGATTAGTGGCCAGGCGTGG + Intergenic
1006543536 6:34760266-34760288 ATAAGAAAACTAGCCAGGTGTGG - Intronic
1006762278 6:36473480-36473502 ATAAATTAACTGGCCAGGCGTGG + Intronic
1006820876 6:36893639-36893661 AAAGGCTTACAGGCCAGGCGCGG + Intronic
1006852118 6:37106364-37106386 ATAACCAGGCTGGCCAGGCGTGG + Intergenic
1007020116 6:38511496-38511518 ATAAAATAATTAGCCAGGCGTGG - Intronic
1007553915 6:42750452-42750474 AAAAGGGAAGTGGCCAGGCGTGG - Intronic
1007563144 6:42827075-42827097 ATGAGGAAATTGGCCAGGCGCGG - Intronic
1007571196 6:42892092-42892114 CAAAGCTTAATGGCCAGGCGTGG + Intergenic
1007652240 6:43430244-43430266 ATACGAAAACTGGCCAGGCATGG - Intronic
1007989587 6:46241183-46241205 ATAAGCTATTTTGCCAGGCTGGG + Intronic
1008476610 6:51940915-51940937 ATAAGGGAACTGGGCAGGTGGGG - Intronic
1008490943 6:52086399-52086421 ATAAATTAAATGGCCAGGTGTGG - Intronic
1008759067 6:54832258-54832280 ATAAGATTGCTGGCCAGGCACGG - Intergenic
1010071644 6:71751526-71751548 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1010142948 6:72632429-72632451 AAAAAAAAACTGGCCAGGCGCGG - Intronic
1010322220 6:74525158-74525180 ATATACAAACTGGCCAGGCATGG - Intergenic
1010586609 6:77663529-77663551 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1010841222 6:80650743-80650765 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1010894463 6:81348121-81348143 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1010996590 6:82540532-82540554 ATAAGAGAATCGGCCAGGCGAGG - Intergenic
1011061338 6:83272882-83272904 ATAGGCAAAAGGGCCAGGCGTGG + Intronic
1011234070 6:85196484-85196506 AAAAGCAAACAGGCCGGGCGCGG + Intergenic
1011240961 6:85270878-85270900 ACAAACAAACTGGCCGGGCGCGG - Intergenic
1011266438 6:85524486-85524508 ATGAGATCACTGGCCAGGCATGG + Intronic
1011475659 6:87748596-87748618 AAAAGCAAAAAGGCCAGGCGCGG + Intergenic
1011607506 6:89118605-89118627 AAAATCCAACAGGCCAGGCGCGG - Intergenic
1011652244 6:89517158-89517180 AACAGCAATCTGGCCAGGCGTGG - Intronic
1011770853 6:90673186-90673208 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1012492718 6:99800106-99800128 AGACACTAAATGGCCAGGCGCGG - Intergenic
1012689658 6:102295663-102295685 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1012876383 6:104733560-104733582 AAAAAGTAATTGGCCAGGCGCGG + Intronic
1012894087 6:104929184-104929206 TTAAGATGACTGGCCAGGTGTGG + Intergenic
1012952609 6:105534752-105534774 AAAAGCTAGTTGGCCAGGCATGG - Intergenic
1012992450 6:105939837-105939859 AAAAACTGACAGGCCAGGCGTGG + Intergenic
1013032664 6:106350113-106350135 AGAAGAAAACAGGCCAGGCGGGG - Intergenic
1013261841 6:108452004-108452026 AGAAACAAACTGGCCGGGCGTGG - Intronic
1013407803 6:109858739-109858761 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1013496294 6:110700914-110700936 ATAAATTAATTGGCCGGGCGCGG + Intronic
1013843595 6:114425312-114425334 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1013891791 6:115034616-115034638 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1014360079 6:120465257-120465279 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1014396154 6:120927910-120927932 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1014454783 6:121623413-121623435 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1014555935 6:122842565-122842587 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1014793902 6:125704835-125704857 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1014891629 6:126851480-126851502 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1015165301 6:130195075-130195097 ATAAGGGAACTGGGCAGGTGGGG - Intronic
1015266829 6:131298188-131298210 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1015269740 6:131326129-131326151 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1015271457 6:131341607-131341629 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1015287955 6:131507258-131507280 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1015323919 6:131904419-131904441 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1015490240 6:133817036-133817058 ATTAGGAACCTGGCCAGGCGCGG + Intergenic
1015577287 6:134685613-134685635 ATAAGATAAATGGCTGGGCGCGG - Intergenic
1015801296 6:137064304-137064326 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1015881725 6:137876590-137876612 AACAGCTAACAGGCCAGGCATGG - Intronic
1015969422 6:138729422-138729444 ATAGTCAAGCTGGCCAGGCGCGG - Intergenic
1015975262 6:138784031-138784053 ATCAGCCAATTAGCCAGGCGTGG - Intronic
1016077054 6:139808592-139808614 GTAAGCTACTGGGCCAGGCGCGG + Intergenic
1016114060 6:140260422-140260444 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1016150431 6:140735097-140735119 ATAAGATATTTGGCCCGGCGCGG + Intergenic
1016421647 6:143891408-143891430 ATTGACTAGCTGGCCAGGCGTGG + Intronic
1016518889 6:144925905-144925927 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1016535675 6:145106128-145106150 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1016650208 6:146453399-146453421 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1017099644 6:150836524-150836546 AAAAGCTCAGAGGCCAGGCGAGG + Intronic
1017389589 6:153924221-153924243 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1017529072 6:155269610-155269632 ACAAGAAAACTGGCCGGGCGTGG - Intronic
1017779258 6:157703630-157703652 ATAAGGTAACTGGGCAGGTGGGG + Intronic
1017892225 6:158648299-158648321 ATAAAATAATAGGCCAGGCGTGG + Intergenic
1017922741 6:158886006-158886028 ATAAGGGAACTGGGCAGGTGGGG + Intronic
1017934471 6:158992582-158992604 ATATGCTCAGAGGCCAGGCGTGG - Intronic
1018077690 6:160231231-160231253 ATAAGGGAACTGGGCAGGTGGGG - Intronic
1018084412 6:160289550-160289572 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1018263250 6:161991549-161991571 ATGGCCCAACTGGCCAGGCGTGG + Intronic
1018289799 6:162280498-162280520 AAAAGCTAAAAGGCCAGGCATGG + Intronic
1018366144 6:163121950-163121972 AAAAGATCACCGGCCAGGCGTGG - Intronic
1018441592 6:163819149-163819171 ATAAAAAAGCTGGCCAGGCGTGG + Intergenic
1018495311 6:164341714-164341736 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1018521390 6:164655132-164655154 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1018567342 6:165168693-165168715 AAAACCTAAGAGGCCAGGCGTGG + Intergenic
1018668537 6:166161630-166161652 AAAAGCACACTGGCCAGGCGTGG + Intronic
1019101850 6:169638024-169638046 AGAAACTAATTGGCCGGGCGCGG + Intronic
1019141331 6:169946085-169946107 ATAAGAAAAATGGCCAGGTGTGG - Intergenic
1019691204 7:2414017-2414039 ATGAGATAACTGGCCGGGCGTGG - Intronic
1019729120 7:2620719-2620741 AAAAGATATCTGGCCAGGCATGG + Intergenic
1019957664 7:4428096-4428118 ATAAGGGAACTGGCTGGGCGTGG - Intergenic
1019966920 7:4506923-4506945 AAGAGCCAACAGGCCAGGCGCGG - Intergenic
1020184627 7:5949538-5949560 AGAAATTAACTGGCCGGGCGTGG + Intronic
1020298289 7:6775206-6775228 AGAAATTAACTGGCCGGGCGTGG - Intronic
1020316130 7:6906515-6906537 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1020323865 7:6959642-6959664 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1020421630 7:8012733-8012755 AAAGGCAACCTGGCCAGGCGTGG - Intronic
1020459122 7:8408336-8408358 ATACGATAACTGGCCTGGCGTGG + Intergenic
1020541063 7:9461536-9461558 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1020891826 7:13888073-13888095 TAAAGCTATCAGGCCAGGCGCGG + Intergenic
1021099303 7:16570526-16570548 AAAATATAACTCGCCAGGCGTGG + Intronic
1021326169 7:19272488-19272510 ATAACACAACTGGCCGGGCGCGG + Intergenic
1021429928 7:20548175-20548197 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1021739157 7:23668075-23668097 ATAAGAAAACAGGCCAGGCATGG + Intergenic
1021810744 7:24399003-24399025 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1021884006 7:25120832-25120854 ATTACATAATTGGCCAGGCGTGG + Exonic
1021977810 7:26027171-26027193 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1022060417 7:26787615-26787637 AAAAGCTTCCTGGCCAGGTGTGG - Intronic
1022294473 7:29037252-29037274 ATAAGAAAAGTGGCCAGGCGTGG + Intronic
1022300045 7:29094554-29094576 ATAAGGAAATGGGCCAGGCGTGG + Intronic
1022372956 7:29787573-29787595 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1022447481 7:30481953-30481975 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1022507930 7:30918280-30918302 ATAAAAGAACTGGCCAGGCGCGG - Intronic
1022572712 7:31470004-31470026 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1022709960 7:32840889-32840911 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1022863417 7:34391635-34391657 ACAAGTGAACAGGCCAGGCGCGG - Intergenic
1023376528 7:39561642-39561664 ATATACAAATTGGCCAGGCGCGG + Intergenic
1023380208 7:39599528-39599550 ATACAAAAACTGGCCAGGCGTGG - Intronic
1023438103 7:40159208-40159230 AGAAATTATCTGGCCAGGCGTGG - Intronic
1023599749 7:41870079-41870101 TTAAGCTAACTGGAAAGGCAAGG - Intergenic
1023698802 7:42873591-42873613 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1023729880 7:43180683-43180705 AAAATAAAACTGGCCAGGCGCGG - Intronic
1023904874 7:44514855-44514877 ATAAATAAATTGGCCAGGCGTGG + Intronic
1024068555 7:45767162-45767184 ATGAGCAAAATCGCCAGGCGCGG + Intergenic
1024103887 7:46060769-46060791 ACAAAGAAACTGGCCAGGCGTGG - Intergenic
1024662608 7:51512596-51512618 ATATGCAAATTAGCCAGGCGTGG - Intergenic
1024941967 7:54772834-54772856 ATGGTGTAACTGGCCAGGCGCGG + Intergenic
1024994793 7:55265296-55265318 ATAGACTAATTGGCCAGGCAAGG + Intergenic
1025791626 7:64693301-64693323 AAAAAAAAACTGGCCAGGCGTGG - Intronic
1025845673 7:65194629-65194651 TTAAACTAACTGGCCGGGCGCGG + Intergenic
1025895894 7:65700342-65700364 TTAAACTAACTGGCCGGGCGCGG + Intergenic
1025977610 7:66381389-66381411 TTAAACTATCTGGCCGGGCGCGG + Intronic
1025981979 7:66414152-66414174 AAAAGCGATCGGGCCAGGCGTGG + Intronic
1025990671 7:66494255-66494277 ATAAGCGATCGGGCCGGGCGCGG + Intergenic
1026022886 7:66723868-66723890 AAAAGATAATTGGCCAGGCATGG - Intronic
1026092663 7:67314453-67314475 TTAAGCTTAGAGGCCAGGCGTGG - Intergenic
1026255629 7:68708850-68708872 ATAAGCAAGCAGGCCAGGCGTGG - Intergenic
1026260191 7:68748227-68748249 ATATGCAAATTAGCCAGGCGTGG + Intergenic
1026352376 7:69528697-69528719 AGAAGCAAACTGGCCGGGTGTGG - Intergenic
1026403368 7:70039047-70039069 ATAAGAAACCTGGCCAGGTGTGG - Intronic
1026454139 7:70556094-70556116 AGAAGCTTCTTGGCCAGGCGTGG - Intronic
1026659076 7:72283232-72283254 ATAAGATAAACGGCCAGGCATGG + Intronic
1026748729 7:73032968-73032990 ATAAGAAAAGTGGCCAGGTGTGG - Intergenic
1026752377 7:73061113-73061135 ATAAGAAAAGTGGCCAGGTGTGG - Intergenic
1026756028 7:73089240-73089262 ATAAGAAAAGTGGCCAGGTGTGG - Intergenic
1027005370 7:74688367-74688389 AAAAACATACTGGCCAGGCGTGG - Intronic
1027034925 7:74918234-74918256 ATAAGAAAAGTGGCCAGGTGTGG - Intergenic
1027091377 7:75304189-75304211 ATAAGAAAAGTGGCCAGGTGTGG + Intergenic
1027095021 7:75332160-75332182 ATAAGAAAAGTGGCCAGGTGTGG + Intergenic
1027310626 7:76950702-76950724 ATAAGATTTTTGGCCAGGCGTGG - Intergenic
1027324318 7:77035514-77035536 ATAAGAAAAGTGGCCAGGTGTGG - Intergenic
1027354509 7:77342430-77342452 ATAAGGGAACTGGGCAGGTGGGG - Intronic
1027646009 7:80799550-80799572 ATAAGAAAATTGGCCAGGCACGG + Intronic
1027663833 7:81019847-81019869 ATGAAATAACTGGCCAGGCATGG + Intergenic
1027764403 7:82321834-82321856 ACAAGCTAAGTGGCCGGGCGCGG + Intronic
1027852035 7:83462397-83462419 ATAAGGGAACTGGGCAGGTGGGG - Intronic
1028168550 7:87567802-87567824 AAAAGCAAACAGGCCAGGCGTGG + Intronic
1028223722 7:88225542-88225564 ATAATCTAACTGGCATGGCTGGG - Intronic
1028328527 7:89558792-89558814 ATAATATTCCTGGCCAGGCGCGG - Intergenic
1028490028 7:91400853-91400875 ATCAGCCATCTGGCCAGGCGTGG + Intergenic
1028551542 7:92073204-92073226 AAAAGGAAACAGGCCAGGCGTGG + Intronic
1028589820 7:92482762-92482784 ATAAGGGAACTGGGCAGGTGAGG + Intergenic
1028670593 7:93396667-93396689 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1028690255 7:93642592-93642614 ATAAGGGAACTGGGCAGGTGGGG - Intronic
1028834168 7:95356086-95356108 ATATGTTAACTGGCCGGGCACGG - Intergenic
1029016692 7:97322118-97322140 ATTAAGCAACTGGCCAGGCGTGG + Intergenic
1029064435 7:97835181-97835203 ATAAGATAATTAGCCAGGCACGG + Intergenic
1029102082 7:98139403-98139425 ATAAGAAAAATGGCCAGGCCCGG - Intronic
1029158621 7:98535108-98535130 AAAACCAAACAGGCCAGGCGCGG - Intergenic
1029198199 7:98821206-98821228 ATGAGCTAACATGCCAGGCCAGG + Intergenic
1029253969 7:99256481-99256503 ATAAAATAACTGGCCAGGCATGG + Intergenic
1029395130 7:100302896-100302918 ATAAGAAAAGTGGCCAGGTGTGG + Intergenic
1029500286 7:100924894-100924916 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1029501937 7:100936668-100936690 AGAAGTTGGCTGGCCAGGCGTGG - Intergenic
1029582275 7:101445129-101445151 ATAAAGTACCTGGCCAGGCATGG - Intronic
1029680985 7:102109491-102109513 ACAAGAAAAGTGGCCAGGCGAGG + Intronic
1030127627 7:106169406-106169428 ATATAATTACTGGCCAGGCGTGG + Intergenic
1030302950 7:107992604-107992626 AGAAGGGAACAGGCCAGGCGCGG + Intronic
1030472110 7:109978138-109978160 ATAAAATAAGAGGCCAGGCGTGG + Intergenic
1030751420 7:113236562-113236584 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1031004757 7:116458237-116458259 ATAAGGGAACTGGGCAGGTGGGG - Intronic
1031106256 7:117546280-117546302 ATTAGGTAGGTGGCCAGGCGTGG - Intronic
1031296692 7:120011615-120011637 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1031400070 7:121318302-121318324 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1031422379 7:121566953-121566975 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1031525679 7:122819658-122819680 ATAAGGGAACTGGGCAGGTGGGG - Intronic
1031777421 7:125920341-125920363 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1032166401 7:129548605-129548627 ATACGTAGACTGGCCAGGCGCGG + Intergenic
1032313755 7:130814590-130814612 ATAAGGGATATGGCCAGGCGTGG - Intergenic
1032320254 7:130879979-130880001 AAAACCAAACTAGCCAGGCGTGG + Intergenic
1032718148 7:134528431-134528453 AAATGCAAACTGGCCAGGTGTGG + Intronic
1032766209 7:134996370-134996392 GTAAACAAACTGGCCATGCGGGG + Intronic
1033087360 7:138354689-138354711 AAAAACAAACTGGCCAGGTGTGG - Intergenic
1033206618 7:139428547-139428569 AAAATGTAACTGGCCAGGCAGGG - Intergenic
1033370763 7:140705388-140705410 ATCAGATACATGGCCAGGCGTGG - Intronic
1033463687 7:141570979-141571001 AGAAGCTATCTGCCCAGTCGAGG - Intronic
1033675860 7:143540200-143540222 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1033695974 7:143789243-143789265 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1033856355 7:145565785-145565807 ATAAGTCAACGGGCCGGGCGGGG - Intergenic
1033909384 7:146246360-146246382 ATAAGGGAACTGGGCAGGTGGGG + Intronic
1034021397 7:147647289-147647311 AAAAGTGAACTGGCCGGGCGCGG - Intronic
1034178320 7:149117940-149117962 CTAAGTAATCTGGCCAGGCGCGG - Intronic
1034334212 7:150310086-150310108 ATAAGGGAACTGGGCAGGTGGGG - Intronic
1034392578 7:150798563-150798585 AAAAGAGAACTGGCCGGGCGCGG - Intronic
1034993503 7:155563133-155563155 ATAAAGAAACAGGCCAGGCGCGG + Intergenic
1035000412 7:155608297-155608319 ACATGACAACTGGCCAGGCGTGG + Intergenic
1035195555 7:157217544-157217566 AAAATTTAAGTGGCCAGGCGCGG + Intronic
1035880584 8:3241190-3241212 ATAAGGGAACTGGGCAGGTGGGG + Intronic
1036281565 8:7405172-7405194 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1036339905 8:7906400-7906422 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1036372205 8:8171342-8171364 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1036427903 8:8663394-8663416 ATATGCAAGGTGGCCAGGCGTGG + Intergenic
1036639567 8:10574004-10574026 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1036654115 8:10664614-10664636 AAAAGAGAACTGGCCAGGCGTGG + Intronic
1036878698 8:12494299-12494321 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1036948853 8:13121842-13121864 AAAAGCTCCCTGGCCAGGCACGG - Intronic
1037075347 8:14710074-14710096 ATAAATTAATGGGCCAGGCGCGG + Intronic
1037199776 8:16238436-16238458 TTAACATAACTGGCCAGGCGTGG - Intronic
1037319141 8:17627764-17627786 ATTTGCAATCTGGCCAGGCGTGG - Intronic
1037552893 8:19992270-19992292 AATAGATAACTGGCCCGGCGTGG + Intergenic
1037593862 8:20337421-20337443 AGAAACTATCTGGCCAGGTGTGG + Intergenic
1037654942 8:20874991-20875013 GAAAACAAACTGGCCAGGCGCGG + Intergenic
1038184529 8:25260949-25260971 ATAAAATAACTAGCCAGGTGAGG - Intronic
1038212436 8:25532048-25532070 ATGAGAAAACTGGCCAGGCGCGG + Intergenic
1038396140 8:27246962-27246984 ATGATCTATGTGGCCAGGCGTGG + Intronic
1038464206 8:27745150-27745172 ATCAAATAACTAGCCAGGCGTGG - Intronic
1038723254 8:30057045-30057067 ATTAGGTTGCTGGCCAGGCGCGG + Intergenic
1038755194 8:30334122-30334144 ATAAGGAAAGCGGCCAGGCGCGG + Intergenic
1038971323 8:32639113-32639135 AAATGTGAACTGGCCAGGCGTGG + Intronic
1039596287 8:38792753-38792775 ATAAAAAAACTGGCCAGGCGTGG - Intronic
1040004263 8:42605408-42605430 ATAAAAAAACTGGCCGGGCGTGG - Intergenic
1040018162 8:42717081-42717103 AGAAGCAGACTGGCCGGGCGCGG + Intronic
1040472795 8:47749574-47749596 ATTTGCGAACTGGCCAGGCATGG + Intergenic
1040511032 8:48095008-48095030 AAAAGAAAACTGGCCGGGCGTGG - Intergenic
1040569746 8:48597143-48597165 GTAAGCCACCTGGCCAAGCGTGG - Intergenic
1040923651 8:52652765-52652787 ACAAGTTTGCTGGCCAGGCGTGG + Intronic
1041442956 8:57918367-57918389 AAAAGATAAGTGGCCAGGTGCGG + Intergenic
1041516572 8:58705937-58705959 ATAGGCAATCTGGCCAGGCGCGG - Intergenic
1042266630 8:66915170-66915192 ATAAAATAAATGGCCAGGAGCGG + Intronic
1042291820 8:67176779-67176801 ATGACCTCACTGGCCAGGCGTGG + Intronic
1042453648 8:68975907-68975929 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1042551647 8:69999303-69999325 AATAGCTATCAGGCCAGGCGCGG - Intergenic
1042707459 8:71677646-71677668 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1042882568 8:73510358-73510380 ATATACTTTCTGGCCAGGCGCGG - Intronic
1043353584 8:79389080-79389102 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1043717816 8:83508126-83508148 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1043837809 8:85065704-85065726 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1043947495 8:86271085-86271107 AAACATTAACTGGCCAGGCGTGG + Intronic
1044148432 8:88745189-88745211 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1044229221 8:89756320-89756342 AAAAGCTTATTGGCCGGGCGCGG + Intergenic
1044242147 8:89901030-89901052 ATAAAGTACCTGGCCGGGCGCGG - Intergenic
1044258537 8:90093189-90093211 ATAAGGGAACTGGGCAGGTGGGG + Intronic
1044417171 8:91950695-91950717 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1044583814 8:93850273-93850295 ATAGGGTAATTGGCCAGGCACGG + Intergenic
1044712406 8:95071098-95071120 ATAAGGCAACCGGCCGGGCGCGG + Intronic
1044763207 8:95544786-95544808 ATAACCTTATTGGCCAGGCACGG + Intergenic
1044925247 8:97203651-97203673 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1045099583 8:98830678-98830700 GTAAGGTAATCGGCCAGGCGCGG + Intronic
1045197612 8:99946606-99946628 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1045472104 8:102521676-102521698 ATACTCTTTCTGGCCAGGCGTGG + Intergenic
1045540942 8:103084550-103084572 ATAAGCCAAATAGCCAGGTGTGG + Intergenic
1045626310 8:104056112-104056134 GTCAACTAACCGGCCAGGCGTGG + Intronic
1045644868 8:104288670-104288692 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1045656305 8:104390787-104390809 ATTAGAGAACTGGCCAGGTGTGG - Intronic
1046038844 8:108877863-108877885 AAAAGAAAATTGGCCAGGCGCGG - Intergenic
1046084938 8:109421490-109421512 ATATAATAACTGGCCGGGCGCGG + Intronic
1046294202 8:112198559-112198581 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1046386257 8:113512489-113512511 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1046440096 8:114244073-114244095 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1046443331 8:114284721-114284743 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1046512168 8:115214961-115214983 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1046627867 8:116594404-116594426 ATAAAAGAATTGGCCAGGCGTGG + Intergenic
1046960042 8:120101932-120101954 ATAACCAAACTGGCCAGGCACGG - Intronic
1047389890 8:124441742-124441764 ATAAGGGAGCTGGCCAGGCATGG + Intergenic
1047699433 8:127434464-127434486 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1047856458 8:128917148-128917170 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1047925330 8:129677141-129677163 ATAAGCGAACAGGCCGGGCACGG + Intergenic
1048097680 8:131312931-131312953 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1048585344 8:135770125-135770147 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1048764157 8:137827801-137827823 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1048895999 8:138992935-138992957 AGAAGAACACTGGCCAGGCGTGG + Intergenic
1049532922 8:143165138-143165160 AAAAAGTACCTGGCCAGGCGCGG + Intergenic
1049566558 8:143343049-143343071 ATAAGTTAGCAGGCCAGGCGTGG - Intronic
1050099220 9:2100410-2100432 TTCACCTAACTGGCCAGGTGTGG + Intronic
1050117688 9:2278296-2278318 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1050258022 9:3814143-3814165 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1050473478 9:6017209-6017231 AGAAACAAACTGGCCAGGCGCGG - Intergenic
1050896156 9:10887501-10887523 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1051052713 9:12951058-12951080 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1051311468 9:15778346-15778368 AAAAAATCACTGGCCAGGCGCGG + Intronic
1051440696 9:17079751-17079773 AAAGGCTCACTGGCCGGGCGTGG + Intergenic
1051640638 9:19221561-19221583 ATAAACAAATAGGCCAGGCGCGG + Intergenic
1051803870 9:20968727-20968749 ATAAGAAAACAGGCCGGGCGAGG - Intronic
1051849197 9:21488679-21488701 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1051953328 9:22661545-22661567 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1052191910 9:25671658-25671680 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1052235875 9:26213273-26213295 ATAAGCTACCTGGCTGGGCGCGG + Intergenic
1052653418 9:31329143-31329165 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1052720568 9:32167504-32167526 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1052813078 9:33078360-33078382 ATAATAAATCTGGCCAGGCGTGG + Intergenic
1052922121 9:33979590-33979612 AAAAAATAACTGGCCAGGTGCGG + Intronic
1052940636 9:34129558-34129580 AAAAGATATCAGGCCAGGCGTGG + Intergenic
1053169204 9:35866789-35866811 ATAAGATTCCTGGCCAGGCATGG + Intergenic
1053324792 9:37133877-37133899 ATACAATAACTGGCCAGGCACGG - Intronic
1053362675 9:37500473-37500495 AAGAACTAAGTGGCCAGGCGCGG - Intronic
1053385137 9:37681055-37681077 ATAAGAAAACTAGCCAGGCGTGG + Intronic
1053409732 9:37907857-37907879 ATAAAATAATTAGCCAGGCGTGG + Intronic
1053545063 9:39014252-39014274 ATCTGCTATCTGGCCAGGCACGG - Intergenic
1054757967 9:68977935-68977957 AGAAGCCAATAGGCCAGGCGCGG - Intronic
1054807405 9:69407726-69407748 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1055233155 9:74088396-74088418 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1055442009 9:76345710-76345732 ACAAACAAACAGGCCAGGCGCGG - Intronic
1055463657 9:76542955-76542977 ATCAATTAACTGGGCAGGCGCGG + Intergenic
1055626808 9:78183544-78183566 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1055810134 9:80140146-80140168 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1055881828 9:81011744-81011766 ATAAGGGAACTGGGCAGGTGCGG - Intergenic
1056044652 9:82703695-82703717 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1056061240 9:82886482-82886504 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1056192950 9:84202893-84202915 ATGAGCTATCAGGCCGGGCGCGG + Intergenic
1056323974 9:85461379-85461401 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1056325090 9:85471203-85471225 AGAAGCTGATTGGCCGGGCGCGG + Intergenic
1056598980 9:88031219-88031241 AAGAGATAACAGGCCAGGCGTGG - Intergenic
1056741280 9:89257530-89257552 ATAAGCTGTCCGGCCGGGCGCGG + Intergenic
1056883063 9:90415309-90415331 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1057059546 9:91991347-91991369 AAATGCTAAGTGGCCGGGCGCGG + Intergenic
1057325347 9:94058406-94058428 AAAAGCTATTGGGCCAGGCGCGG + Intronic
1057375950 9:94523345-94523367 ATCAGCTTTTTGGCCAGGCGCGG + Intergenic
1057378070 9:94542551-94542573 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1057580973 9:96287418-96287440 ATAACTTTACTGGCCGGGCGTGG + Intronic
1057615575 9:96586880-96586902 ATGAGAAAACAGGCCAGGCGCGG + Intronic
1057684081 9:97217568-97217590 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1057689845 9:97273920-97273942 GTAAGGAAACTGGCCAGGCATGG - Intergenic
1057771106 9:97968814-97968836 ATAATAAAATTGGCCAGGCGTGG + Intergenic
1057813049 9:98272699-98272721 ACAGGCTGTCTGGCCAGGCGCGG - Intergenic
1057982169 9:99672895-99672917 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1058026125 9:100143667-100143689 ATAAGGGAACTGGGCAGGTGGGG + Intronic
1058043850 9:100334953-100334975 ACAAAGTGACTGGCCAGGCGCGG - Intronic
1058144523 9:101397168-101397190 AAATTCTAACTGGCCAGGTGTGG + Intronic
1058302105 9:103388813-103388835 ATATGCAATCAGGCCAGGCGTGG + Intergenic
1058437745 9:104978899-104978921 ATAAAATAGTTGGCCAGGCGTGG + Intergenic
1058612477 9:106790933-106790955 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1058688176 9:107496463-107496485 ATAAGCAACCTGGCCGGGTGTGG - Intergenic
1058808792 9:108618989-108619011 AAAAGCTTTCTGGCCGGGCGTGG - Intergenic
1058852168 9:109023542-109023564 ATAAGCAATGTGGCCAGGCGCGG + Intronic
1059157518 9:112003211-112003233 ATAAAACAACTGGCCGGGCGTGG + Intergenic
1059369038 9:113810181-113810203 ATGCACAAACTGGCCAGGCGAGG - Intergenic
1059491808 9:114674094-114674116 AAAATCTTTCTGGCCAGGCGCGG - Intergenic
1059546093 9:115177598-115177620 ATAAGGGAACTGGGCAGGTGGGG + Intronic
1059574697 9:115476081-115476103 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1059606617 9:115842178-115842200 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1059790389 9:117636187-117636209 AAAACCCGACTGGCCAGGCGTGG + Intergenic
1059863403 9:118488645-118488667 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1060226290 9:121793061-121793083 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1060318390 9:122533611-122533633 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1060369413 9:123055839-123055861 ATAAAATAAATGGCCAGGCACGG - Intronic
1060498071 9:124132567-124132589 ATAAGCTTCTTGGCCAGGCGTGG - Intergenic
1060590495 9:124813237-124813259 ATGAAGAAACTGGCCAGGCGTGG - Exonic
1060628465 9:125134964-125134986 ATTAGGAAACTGGCCGGGCGTGG - Intronic
1060632951 9:125176363-125176385 GAAAACAAACTGGCCAGGCGTGG + Intronic
1060737797 9:126077602-126077624 ATAAGGGAACTCGCCAGGTGGGG + Intergenic
1060949370 9:127591508-127591530 ATAAATGAACTGGCCAGGCAGGG - Intergenic
1060990585 9:127846584-127846606 ATCAGATAACAGGCCTGGCGGGG + Intronic
1061166224 9:128923825-128923847 AAAATAAAACTGGCCAGGCGCGG + Intronic
1061319232 9:129817408-129817430 ATGGGGGAACTGGCCAGGCGTGG + Intronic
1061341505 9:129985529-129985551 ATAAGCAACATGGCCAGGGGTGG + Intronic
1061543768 9:131291870-131291892 ACAAGAAAACTGGCCAGGCACGG - Intronic
1061606884 9:131717483-131717505 AGAAGCAAATAGGCCAGGCGCGG + Intronic
1062465759 9:136680515-136680537 AGAAACTAGCTGGCCGGGCGCGG - Intronic
1062482467 9:136758969-136758991 ATCAGGAAACTGGCCTGGCGCGG - Intergenic
1062661815 9:137640223-137640245 ATAAGGTTACAGGCCAGGCACGG - Intronic
1062692036 9:137846852-137846874 ATAAGTGAACTGGGCAGGTGGGG - Intronic
1185578004 X:1189253-1189275 ATAAGGTTGCTGGCCAGGCACGG + Intronic
1185657964 X:1701386-1701408 ACAAGGGAATTGGCCAGGCGCGG - Intergenic
1185858346 X:3556107-3556129 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1185960610 X:4543457-4543479 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1185991143 X:4894319-4894341 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1186112773 X:6275160-6275182 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1186194106 X:7094648-7094670 ATCAGCTTATTGGCCAGGCGCGG - Intronic
1186454077 X:9697613-9697635 ATACGATAACTAGCCAGGCGTGG + Intronic
1186493037 X:9989987-9990009 AGAAAAGAACTGGCCAGGCGTGG + Intergenic
1186784154 X:12942571-12942593 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1187353099 X:18540465-18540487 AAAAGATAACCAGCCAGGCGTGG - Intronic
1187382799 X:18820673-18820695 AAAAGTTTGCTGGCCAGGCGCGG - Intronic
1187457828 X:19458386-19458408 ATCAGCTAGCTGGCCAGGCACGG + Intronic
1187523705 X:20035598-20035620 ATAAAATAGTTGGCCAGGCGTGG + Intronic
1187556857 X:20359853-20359875 ATAACCTAAATGGCCAGGAATGG - Intergenic
1187876241 X:23806317-23806339 AGAATCAAATTGGCCAGGCGTGG - Intergenic
1188300968 X:28505400-28505422 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1188332938 X:28895568-28895590 ATAAGGGAACTGGGCAGGTGGGG + Intronic
1188365477 X:29309803-29309825 AAAAAAAAACTGGCCAGGCGCGG + Intronic
1188419569 X:29978010-29978032 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1188419579 X:29978072-29978094 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1188431109 X:30106081-30106103 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1188463300 X:30452076-30452098 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1188527735 X:31104619-31104641 ATAAAATAATTAGCCAGGCGTGG - Intronic
1188546177 X:31309939-31309961 ATAAGCTATCTAGCCAGGCCAGG + Intronic
1188908406 X:35815795-35815817 AGCAGCTTACTGGCCAGGCAAGG - Intergenic
1189013022 X:37065691-37065713 ATCAGTTCACTGGCCAGGCATGG + Intergenic
1189031718 X:37458745-37458767 ATAAGGGAACTGGGCAGGTGGGG + Intronic
1189073414 X:37888773-37888795 ATAAAATAATTAGCCAGGCGAGG + Intronic
1189152540 X:38723327-38723349 GAAAGTTAGCTGGCCAGGCGCGG + Intergenic
1189413973 X:40798140-40798162 AAAAGAAAACTGGCCAGGTGTGG + Intergenic
1189524356 X:41804055-41804077 TTATGATAATTGGCCAGGCGCGG + Intronic
1189774830 X:44461326-44461348 AAAAACAAACTGGCCAGGTGCGG + Intergenic
1189809079 X:44764274-44764296 GTAAGCTTTCTGGCCAGGCATGG + Intergenic
1190076197 X:47319031-47319053 ACAAGCAAACAGGCCAGGTGCGG + Intergenic
1190261296 X:48799134-48799156 AAAAAATTACTGGCCAGGCGTGG - Intergenic
1190474087 X:50811019-50811041 ATTAGCTATTTGGCCAGGAGTGG + Intronic
1190545658 X:51523785-51523807 ATAAGGTATTGGGCCAGGCGTGG + Intergenic
1190883638 X:54511654-54511676 ATACGAAAATTGGCCAGGCGTGG - Intergenic
1191701023 X:64043297-64043319 ATAGGCTAAACAGCCAGGCGTGG + Intergenic
1191761364 X:64651646-64651668 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1192165973 X:68828061-68828083 ATAAGCAAAGAGGCAAGGCGGGG + Intergenic
1192176178 X:68886929-68886951 AGGAGCTAACTGGCCAAGCCTGG - Intergenic
1192443087 X:71189544-71189566 ATAACCTTACTGGCCGGGTGTGG + Intergenic
1192454720 X:71267218-71267240 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1192618299 X:72650875-72650897 ATAAACTAATTAGCCAGGCGTGG - Intronic
1192764499 X:74127786-74127808 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1193212456 X:78823174-78823196 AAAGGATACCTGGCCAGGCGCGG + Intergenic
1193268264 X:79498970-79498992 ATCAGATAGTTGGCCAGGCGCGG - Intergenic
1193540565 X:82766807-82766829 ATAAAATAATTGGCCAGGTGTGG - Intergenic
1193886009 X:86984533-86984555 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1193941585 X:87684627-87684649 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1194186168 X:90776300-90776322 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1194308461 X:92276042-92276064 ATAAGGGAACTGGGCAGGTGGGG + Intronic
1194367190 X:93025666-93025688 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1194502901 X:94701798-94701820 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1194660768 X:96626763-96626785 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1194701945 X:97125182-97125204 AAATGCAAACTGGCCGGGCGCGG + Intronic
1194822684 X:98527243-98527265 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1194873718 X:99162409-99162431 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1194940914 X:100009048-100009070 ATAAGCTAAATGTGCAGGCTAGG - Intergenic
1195326776 X:103764753-103764775 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1195908597 X:109868200-109868222 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1196073170 X:111546656-111546678 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1196084306 X:111667895-111667917 ATATCCTAAAGGGCCAGGCGCGG + Intronic
1196300092 X:114042720-114042742 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1196330908 X:114469500-114469522 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1196332776 X:114491889-114491911 AGAAAATAACTGGCCAGGCCAGG + Intergenic
1196341631 X:114604275-114604297 ATAAGGGAACTGGGCAGGTGGGG + Intronic
1196343826 X:114628547-114628569 ATAAGGATATTGGCCAGGCGCGG - Intronic
1196427174 X:115582747-115582769 TTAAGCTAATAGGCCAAGCGTGG + Intronic
1196525393 X:116723934-116723956 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1196533462 X:116815461-116815483 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1196572585 X:117281887-117281909 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1196610431 X:117708025-117708047 ATAATGGAACCGGCCAGGCGCGG - Intergenic
1196642931 X:118084734-118084756 ATAAGGTAATAGGCCAGGCATGG + Intronic
1196680035 X:118461335-118461357 ATTACCCCACTGGCCAGGCGTGG + Intergenic
1196691113 X:118559607-118559629 ATAAGCAAATAGGCCAGGCAGGG + Intronic
1196773779 X:119320750-119320772 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1197351971 X:125391821-125391843 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1197499797 X:127229325-127229347 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1197933166 X:131714805-131714827 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1198370212 X:135982762-135982784 AGAAGCTAATTGGCCAGGCATGG - Intergenic
1198464893 X:136896320-136896342 ATAAGAAAATTAGCCAGGCGTGG + Intergenic
1198471251 X:136949080-136949102 ATAAAAGAACTGGCCGGGCGCGG + Intergenic
1198598525 X:138261542-138261564 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1198599321 X:138267294-138267316 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1198960925 X:142182327-142182349 TTAAGATTCCTGGCCAGGCGCGG - Intergenic
1198983674 X:142426546-142426568 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1199209371 X:145188815-145188837 ATAAGCCAACGTGCCAGGCCTGG - Intergenic
1199451154 X:147980506-147980528 ATACAAAAACTGGCCAGGCGTGG + Intergenic
1199576559 X:149318394-149318416 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1200297289 X:154933361-154933383 ATAAGCTATCTGGCCAAGTTGGG + Intronic
1200532760 Y:4358380-4358402 ATAAGGGAACTGGGCAGGTGGGG + Intergenic
1200675404 Y:6141923-6141945 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1201581468 Y:15515107-15515129 ATAAGGGAACTGGGCAGGTGAGG - Intergenic
1201890107 Y:18934285-18934307 ATAAGTAAACAGGCCAGGCGTGG + Intergenic
1201937214 Y:19421705-19421727 ATAAGGGAACTGGACAGGTGGGG - Intergenic
1202062168 Y:20899307-20899329 ATAAGGGAACTGGGCAGGTGGGG - Intergenic
1202167766 Y:22010809-22010831 AAAAACAAACAGGCCAGGCGCGG + Intergenic
1202223595 Y:22575560-22575582 AAAAACAAACAGGCCAGGCGCGG - Intergenic
1202319521 Y:23620101-23620123 AAAAACAAACAGGCCAGGCGCGG + Intergenic
1202551248 Y:26049956-26049978 AAAAACAAACAGGCCAGGCGCGG - Intergenic