ID: 908156490

View in Genome Browser
Species Human (GRCh38)
Location 1:61358792-61358814
Sequence CTATCTCCACAGGTGGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 183}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908156490_908156499 16 Left 908156490 1:61358792-61358814 CCAGCCACCACCTGTGGAGATAG 0: 1
1: 0
2: 0
3: 19
4: 183
Right 908156499 1:61358831-61358853 CTCCCAACACTTCCAGGTGGAGG No data
908156490_908156496 10 Left 908156490 1:61358792-61358814 CCAGCCACCACCTGTGGAGATAG 0: 1
1: 0
2: 0
3: 19
4: 183
Right 908156496 1:61358825-61358847 GCCTTACTCCCAACACTTCCAGG No data
908156490_908156498 13 Left 908156490 1:61358792-61358814 CCAGCCACCACCTGTGGAGATAG 0: 1
1: 0
2: 0
3: 19
4: 183
Right 908156498 1:61358828-61358850 TTACTCCCAACACTTCCAGGTGG No data
908156490_908156502 20 Left 908156490 1:61358792-61358814 CCAGCCACCACCTGTGGAGATAG 0: 1
1: 0
2: 0
3: 19
4: 183
Right 908156502 1:61358835-61358857 CAACACTTCCAGGTGGAGGCAGG 0: 1
1: 0
2: 2
3: 23
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908156490 Original CRISPR CTATCTCCACAGGTGGTGGC TGG (reversed) Intronic
900896319 1:5485418-5485440 CTAGCTGCACAGGTGAGGGCTGG - Intergenic
900911923 1:5602881-5602903 TTATCTCCACATGTTGTGGGAGG - Intergenic
901449080 1:9325240-9325262 CCATCTGCACCGGTGGAGGCGGG - Intronic
902538600 1:17136508-17136530 AGATCCCCACAGGTGGTGGAAGG - Intergenic
902636936 1:17740830-17740852 TTATATCCACAGGTAGTGGGAGG - Intergenic
904152455 1:28453508-28453530 ATATATACATAGGTGGTGGCTGG + Intronic
904895927 1:33818220-33818242 CTCTCTGCACAGCTGGTGTCTGG + Intronic
908156490 1:61358792-61358814 CTATCTCCACAGGTGGTGGCTGG - Intronic
910563706 1:88619779-88619801 CAATCTCCACATGTTGTGGGGGG - Intergenic
912441951 1:109705913-109705935 CTACCTCCACAGTAGGGGGCAGG + Intronic
913973273 1:143433020-143433042 CTATGTCCTCATGTGGTGGAAGG - Intergenic
914067659 1:144258627-144258649 CTATGTCCTCATGTGGTGGAAGG - Intergenic
914111496 1:144707727-144707749 CTATGTCCTCATGTGGTGGAAGG + Intergenic
915217391 1:154349293-154349315 CTAGCTCCCCAGCTGGTGGAAGG - Exonic
915233022 1:154459947-154459969 CTACCTCCACAGCTGGGGGACGG + Intronic
916252829 1:162755144-162755166 CTCTCTCCTCAGGTGCTGGATGG + Exonic
916606880 1:166351749-166351771 CCAACTCCCCAGGTGGTAGCAGG + Intergenic
917498215 1:175562023-175562045 CTTCTTCCACAGGTGATGGCAGG - Intronic
921603176 1:217128888-217128910 CTATCTCCTCAGGCGGAGGTAGG + Intronic
923081593 1:230661964-230661986 CTATCTCCAAGGGTGGGGGTAGG - Intronic
923913498 1:238476807-238476829 CTCTCTCTACAGGAGGTGCCTGG - Intergenic
924855626 1:247872704-247872726 CTATCTACCCGGGTGCTGGCTGG - Intronic
1064014342 10:11761093-11761115 CCATCTCCACCCATGGTGGCAGG + Intronic
1065847978 10:29761915-29761937 CTGTCTCTCCAGCTGGTGGCTGG + Intergenic
1068144140 10:53044665-53044687 ATAGCTCCTCAGGTGGTGCCTGG + Intergenic
1068945857 10:62728143-62728165 CTGTTTCCTCATGTGGTGGCAGG + Intergenic
1074473085 10:113744814-113744836 CTGTCTGCAGAGGTGGAGGCAGG - Intergenic
1075411583 10:122232374-122232396 CGCTCTCCAAAGGAGGTGGCAGG - Intronic
1075516261 10:123110960-123110982 TCATCTCCACATGTGGTGGGAGG + Intergenic
1076223491 10:128754416-128754438 CTCTCTCCTCAGTTGGTGGATGG - Intergenic
1076656472 10:132027122-132027144 CTACCTCCAGAGGTGGTTGTAGG - Intergenic
1077307025 11:1873051-1873073 CTCTCCCCAGAGGTGGAGGCAGG + Intronic
1077375650 11:2204117-2204139 CTATCTCCAGAGGGAGCGGCTGG + Intergenic
1078062261 11:8055806-8055828 CCAACTCCACAGGTGCTGTCAGG - Intronic
1082841384 11:57692950-57692972 CTTTTTCCACAGATGGGGGCTGG + Intronic
1083960587 11:66012814-66012836 CTATGCCCCCAGCTGGTGGCCGG + Exonic
1084148895 11:67278951-67278973 CTGTTTCCCCAGGTGGTAGCTGG - Intronic
1084621042 11:70270578-70270600 CTGTCTCCTCAGGAGGGGGCGGG - Intergenic
1088425135 11:109693822-109693844 CTTTCTCCCAGGGTGGTGGCAGG + Intergenic
1090974323 11:131668955-131668977 CTTGTTCCACTGGTGGTGGCCGG + Intronic
1092524971 12:9304250-9304272 CTCTACCCACAGGTGGTGACAGG - Intergenic
1092542297 12:9427568-9427590 CTCTACCCACAGGTGGTGACAGG + Intergenic
1094510717 12:31094865-31094887 CTTTACCCACAGGTGGTGACAGG - Intronic
1095501071 12:42839372-42839394 CTCACTCCAGAGGAGGTGGCAGG + Intergenic
1095884719 12:47176956-47176978 CTATCTCCAGTGGGGATGGCAGG + Intronic
1097053704 12:56238134-56238156 CTAGCACCACAGGTGGTTCCGGG + Exonic
1097883977 12:64710781-64710803 TTATATCCACTGGTGGTGGCTGG + Intergenic
1098101950 12:67027310-67027332 CTATCACCACACGTGGTCACTGG + Intergenic
1100448646 12:94684395-94684417 CTTTCTCCACAGGTGGCCCCTGG - Intergenic
1103602879 12:122065244-122065266 CTCTCTCCACAGGTGGGGTTGGG + Intergenic
1104684966 12:130778893-130778915 CCATCTAGACAGGAGGTGGCGGG - Intergenic
1104914557 12:132257998-132258020 CTAGCTCAGCAGGGGGTGGCAGG - Intronic
1107990086 13:45812062-45812084 CCATCTCCACCGGTGCTGGGCGG - Intronic
1111257818 13:85695991-85696013 CAATCCCCACAGGTTGTGGGAGG + Intergenic
1111752020 13:92344713-92344735 CTTTCTCCTCTGGTGCTGGCAGG - Intronic
1112623753 13:101078870-101078892 TTATCTCCACATGTTGTGGGAGG + Intronic
1113116407 13:106878890-106878912 CAATCTCCACATGTGGAGGGAGG + Intergenic
1113485873 13:110652055-110652077 CTGTCTTCTGAGGTGGTGGCAGG - Intronic
1115913540 14:38283640-38283662 CTGTGTCCTCAGGTGGTGGAAGG - Intergenic
1116250685 14:42479219-42479241 CTGTGTCCACACGTGGTGGAAGG - Intergenic
1118035810 14:61864859-61864881 CTGTCTCCGCCGGGGGTGGCTGG - Intergenic
1118943046 14:70356188-70356210 ATTTTTCCACAGATGGTGGCGGG + Intronic
1122657345 14:103270909-103270931 CTGTCTCCCCAGATGGTGGCTGG - Intergenic
1123482968 15:20652302-20652324 AGATCCCCACAGGTGGTGTCAGG + Intergenic
1125318757 15:38459541-38459563 CTAATTCCACAGGTGCGGGCTGG + Intronic
1130028430 15:80290114-80290136 CTTTGTCCACAGGTGCTGTCAGG + Intergenic
1131067276 15:89442491-89442513 CTACCTTCCCAGGGGGTGGCAGG - Intergenic
1131869231 15:96744401-96744423 CTGTCTCCATAGGAGGTGGCAGG - Intergenic
1132835546 16:1951123-1951145 CTATGTTCAAAGATGGTGGCTGG - Intronic
1133169263 16:3970956-3970978 CTGCCTGCAAAGGTGGTGGCTGG + Intronic
1133640714 16:7714682-7714704 TTATCCTCACAGGTGGTGGGAGG + Intergenic
1135845327 16:25913378-25913400 CTGTGTCCTCAGGTGGTGGAAGG - Intronic
1138267921 16:55673352-55673374 CTCTCTACACAGGAGGAGGCTGG - Intronic
1139312868 16:66041964-66041986 CTGCCTCCACAGGAAGTGGCAGG - Intergenic
1139632211 16:68237555-68237577 CTTTCCCTACAGGTGGAGGCGGG + Intronic
1143672267 17:8405031-8405053 CTGTCCCCACAGGGAGTGGCAGG - Intergenic
1147537019 17:41327850-41327872 CTATCTCCACAGTGGGTGAGAGG - Intergenic
1148638352 17:49166279-49166301 CCATCTCTACAGATTGTGGCTGG - Intronic
1149852758 17:60050206-60050228 CTGTGTCCTCAGGTGGTGGAAGG - Intronic
1149864841 17:60145562-60145584 CAGCCTCCACAGGTGCTGGCAGG + Intergenic
1150618754 17:66792801-66792823 CCATCTCCCCTGGTGGTGGCAGG + Intronic
1150624956 17:66835632-66835654 CCAGCTCAACAGGTGGTGGTGGG - Intronic
1151465387 17:74281734-74281756 CTATCTCCACAGGTCCTGCCAGG - Exonic
1152258487 17:79254034-79254056 CCTTCTCCCCAGCTGGTGGCAGG + Intronic
1154338543 18:13484714-13484736 CTGTCTCTCCAGGTGGGGGCAGG - Intronic
1157397763 18:47356924-47356946 CCATCTCCACAGTTGGAAGCTGG - Intergenic
1157640614 18:49209688-49209710 ATATCTCCGCAAGTGGCGGCAGG + Intronic
1157935851 18:51872421-51872443 TAATCTCCACATGTGGTGGGAGG + Intergenic
1159510446 18:69391817-69391839 CTCTCTCCACAGCTGGTAGATGG + Intergenic
1159590774 18:70332740-70332762 TTGTATCCACAGGTGGTGGTTGG - Intergenic
1160086056 18:75778357-75778379 CTACCTGCAGATGTGGTGGCAGG - Intergenic
1160192521 18:76725809-76725831 GTTTTTCCACAGATGGTGGCAGG + Intergenic
1160342272 18:78099882-78099904 CCATCTCCACGGGTGGGTGCAGG + Intergenic
1160684073 19:425320-425342 CCAGCAGCACAGGTGGTGGCCGG - Intronic
1164373227 19:27659500-27659522 CTATCTCCATTGGTGGGAGCTGG + Intergenic
1165379590 19:35468895-35468917 TTATCTGCCCAGGAGGTGGCAGG - Intergenic
1166407140 19:42529214-42529236 CCTTCCCCACAGGTGGTGCCAGG + Intronic
1166772223 19:45290783-45290805 CAGTCCTCACAGGTGGTGGCAGG - Intronic
1167663299 19:50809016-50809038 CTAAGTCCAGAGGTGGAGGCAGG - Intergenic
925431997 2:3802624-3802646 CTATGTCCTCATGTGGTGGAAGG + Intronic
926787935 2:16536915-16536937 TAATCTCCACATGTGGTGGGAGG - Intergenic
928180026 2:29062381-29062403 GCATCTCCACAGCTGATGGCAGG + Exonic
928539637 2:32272322-32272344 CTATATCCTCACGTGGTGGAAGG - Intergenic
929888526 2:45899827-45899849 CTTTCTCCCCAGGTGGTGTCAGG - Intronic
930194539 2:48496235-48496257 ATTTGTCCACAGTTGGTGGCTGG + Intronic
932796673 2:74701627-74701649 CTATCTTCACAGCTGGGGGCAGG + Intergenic
932959979 2:76402245-76402267 ATTTTTCCACAGGTGGTGGCAGG - Intergenic
933170897 2:79123432-79123454 CTATTTCCACAGCTGATGCCTGG + Intergenic
934177968 2:89593977-89593999 CTATGTCCTCATGTGGTGGAAGG - Intergenic
934288266 2:91668278-91668300 CTATGTCCTCATGTGGTGGAAGG - Intergenic
934653822 2:96107208-96107230 GCATCTGCAGAGGTGGTGGCAGG - Intergenic
935964898 2:108463857-108463879 CCATATCCACAGGTGGTGCATGG + Intronic
936088303 2:109484541-109484563 GTAACTCCACAGGAGGGGGCGGG - Intronic
937134351 2:119540115-119540137 CTATGTCCTCACGTGGTGGAAGG - Intergenic
937611977 2:123872719-123872741 CTAACTCCACAGCATGTGGCAGG + Intergenic
937857327 2:126682075-126682097 CAAGCTCCACCGGAGGTGGCTGG - Intronic
940378569 2:152986963-152986985 CTGTGTCCAAAGGTGGTGGAGGG - Intergenic
941342803 2:164328761-164328783 CTATATCCCCAGGTGGTTGGAGG - Intergenic
941702161 2:168614978-168615000 CCAGCTCCAGAGGAGGTGGCAGG - Intronic
941718640 2:168789524-168789546 CAATCTCCACATGTTGTGGGAGG - Intronic
943318539 2:186417553-186417575 CTTCCTCCACAGGTTATGGCTGG - Intergenic
944669552 2:201983806-201983828 GTATTTCCAAAGGTGGTGGCAGG - Intergenic
946534619 2:220612811-220612833 CTATCTCCACGGGTGATAGTTGG + Intergenic
946562929 2:220933481-220933503 AAATCTCTACAGGTGGTGTCTGG - Intergenic
948803533 2:240443391-240443413 CTGTCTCCTGAGGCGGTGGCTGG + Intronic
949017315 2:241720697-241720719 CTAACTCCCCAGGGTGTGGCAGG - Intronic
1171221189 20:23399392-23399414 CTATGTCCTCACGTGGTGGAAGG - Intronic
1172303903 20:33868240-33868262 CCATCTCCAGAGCTGATGGCGGG - Intergenic
1172902777 20:38346974-38346996 CCATCATCAGAGGTGGTGGCTGG - Intronic
1175396819 20:58670357-58670379 CTATCTCCAATGGGGGTGGAGGG - Intronic
1176065073 20:63190245-63190267 CCTTCTCCAAAGATGGTGGCAGG - Intergenic
1177842984 21:26255401-26255423 CTGTGTCCACACATGGTGGCAGG + Intergenic
1181459911 22:23079795-23079817 CTGGCACCACAGGTTGTGGCTGG - Intronic
1182069885 22:27456081-27456103 CTGGCAGCACAGGTGGTGGCTGG + Intergenic
1182351257 22:29701221-29701243 CTGTCTTCACAGGGGGTGGAAGG - Intergenic
1183361766 22:37386563-37386585 CTTTCTCCAGAGGAGGTGGGAGG + Intronic
1184970815 22:48018748-48018770 CTACCTCCAAGGGTGGAGGCTGG + Intergenic
1185187918 22:49413939-49413961 CTCTCTCCTCAGCTGGTGGACGG + Intergenic
1185192237 22:49446292-49446314 CTCTCTCTCCAGCTGGTGGCTGG + Intronic
952227680 3:31395741-31395763 CTAGCTCAACAGGTGGAGGCAGG + Intergenic
953980380 3:47410433-47410455 CTATCTACTGTGGTGGTGGCTGG - Exonic
954135959 3:48582348-48582370 CTCTCTCCACAGGGGGAGCCTGG - Exonic
954437185 3:50502631-50502653 CTCTCTCCTCAGGTGGAGGGGGG + Intronic
957816636 3:85308623-85308645 CTATTTCCACAGGTGGTATTGGG - Intronic
958178241 3:90023828-90023850 CTATTTCCAGAGATGTTGGCAGG - Intergenic
963278890 3:143361381-143361403 ATCTCTACACTGGTGGTGGCTGG + Intronic
964432501 3:156621729-156621751 CTAATTCCACACGTGGTCGCTGG - Intergenic
965930004 3:174030674-174030696 CTTAATCCACAGGTGGTGGCAGG + Intronic
966614613 3:181899854-181899876 CTATCACCACCAGAGGTGGCAGG - Intergenic
968655396 4:1776398-1776420 CGATCTGAGCAGGTGGTGGCTGG - Intergenic
969831277 4:9799411-9799433 CTATGTCCTCATGTGGTGGAAGG + Intronic
974475627 4:62375479-62375501 CTATCTCCGCAGGTTCTGCCTGG - Intergenic
974998687 4:69194624-69194646 CTACCTCCACAGTAGGGGGCAGG + Intronic
978036174 4:103998019-103998041 TTTTCTCCACAGGTGGATGCAGG + Intergenic
978515083 4:109560574-109560596 CGGTCCCGACAGGTGGTGGCCGG + Intronic
982644965 4:158011642-158011664 GTATCTCACCAGGTAGTGGCTGG + Intergenic
983097827 4:163585824-163585846 CTTTATCCACTGGTGGAGGCAGG + Exonic
984646857 4:182229910-182229932 TTATCTCAACAGGTGGTAGCTGG + Intronic
985994197 5:3587640-3587662 CAATCTTCACTGGAGGTGGCGGG + Intergenic
986851425 5:11817701-11817723 CTGTCTCCACAGGTTACGGCGGG + Intronic
988625764 5:32872797-32872819 TAATCTCCACATGTGGGGGCAGG + Intergenic
989380240 5:40803165-40803187 CTATCTCTAAATATGGTGGCTGG + Intergenic
995625353 5:114070275-114070297 CTAACTCCCCAGGAGGGGGCAGG + Intergenic
997615799 5:135245462-135245484 CTGTGTCCACAGGTGATAGCAGG - Intronic
997715619 5:136040550-136040572 ATATTTCCCCAGATGGTGGCAGG - Intronic
1002521919 5:179796865-179796887 CTCTCTCCCCAGGTGAGGGCAGG + Intergenic
1002541016 5:179906957-179906979 CTCCCTCCGCAGGTGGTGTCCGG - Intronic
1002785123 6:394084-394106 CTCTGCCCACAGGTGGGGGCTGG - Intronic
1004282413 6:14292315-14292337 CTATTTACACAGGTGGTAGCAGG - Intergenic
1008000873 6:46358402-46358424 ATATCTCCAAAGGTGGTGGAAGG + Intronic
1012379479 6:98602902-98602924 CTATCTCCACAGGTCTTTGCAGG + Intergenic
1014724270 6:124956181-124956203 TTATTTGCACAGGTGTTGGCAGG - Intergenic
1017873317 6:158503781-158503803 CTCTCTCCCCAGGTGTGGGCTGG - Exonic
1019918665 7:4149514-4149536 CTATCTGGACAGGAGCTGGCTGG - Intronic
1019925944 7:4191820-4191842 CCATCTCCACAGGTGTGGCCGGG + Intronic
1020566754 7:9807585-9807607 GTATCTCCACAAATGGTGGTGGG - Intergenic
1022950258 7:35331915-35331937 CTCTCTTCCCAGGTGGGGGCAGG + Intergenic
1027173015 7:75886120-75886142 TTTACTCCACAGCTGGTGGCGGG - Intronic
1030170671 7:106599531-106599553 CTATTTACACAGGTGCTGGCAGG - Intergenic
1030905348 7:115174439-115174461 GGAACTCCACAGGTGGTGGAGGG + Intergenic
1037809280 8:22077040-22077062 GTATGTCCACAGCTGGGGGCAGG + Intronic
1043386062 8:79748912-79748934 CTTTCTCCAGAGCTGGTGGAAGG - Intergenic
1046648243 8:116809042-116809064 CTGTCTTCACAGGTGGTTTCAGG + Intronic
1047415070 8:124658018-124658040 CTATATCCTCACGTGGTGGAGGG - Intronic
1048601847 8:135926854-135926876 CTATTTCCAGAGGTGAGGGCAGG - Intergenic
1049439584 8:142602983-142603005 CTTTACCCAGAGGTGGTGGCCGG + Intergenic
1050060942 9:1709172-1709194 CTACCTACACAGGTTGTGGCAGG - Intergenic
1052687483 9:31773898-31773920 CTACCTCCACAGTAGGGGGCAGG + Intergenic
1052820534 9:33135034-33135056 TCATCTGCACTGGTGGTGGCTGG + Intronic
1055271397 9:74563675-74563697 CTATCTACACAGGTATGGGCAGG + Intronic
1057867567 9:98693361-98693383 CCATGTCCTCAGGTGGTAGCAGG + Intronic
1059198951 9:112396787-112396809 CTACCTCCACAGTAGGGGGCGGG - Intronic
1062648077 9:137560266-137560288 CTATCCAAACAGGCGGTGGCTGG + Intronic
1190151527 X:47954052-47954074 CTCTCTCTGCAGATGGTGGCAGG + Intronic
1190161206 X:48032672-48032694 CTCTCTCCGCAGATGGTGGCAGG - Intronic
1190324554 X:49199023-49199045 TTCTCTCCTCAGCTGGTGGCTGG - Exonic
1194426514 X:93745588-93745610 CTTTCTCCTCAGCTTGTGGCAGG + Intergenic
1195033181 X:100946516-100946538 CTATCTACAAAGGTGTGGGCAGG + Intergenic
1195734429 X:107997934-107997956 GTATCTCCACTGGTGGTAGCAGG - Intergenic
1198274804 X:135090284-135090306 CAATCCCCACATGTGGTGGAGGG + Intergenic
1199349063 X:146778466-146778488 GTATCTCCAAAGATGGTGGGAGG - Intergenic
1200152818 X:153959626-153959648 CCATTTCCACAGGTGGGGCCAGG + Intronic
1200235940 X:154467755-154467777 CTGTCCCCACAGGTGCTGGTGGG + Exonic