ID: 908161288

View in Genome Browser
Species Human (GRCh38)
Location 1:61410953-61410975
Sequence CTGATAATACAGAAGACACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 223}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908161288_908161290 12 Left 908161288 1:61410953-61410975 CCAAGTGTCTTCTGTATTATCAG 0: 1
1: 0
2: 1
3: 21
4: 223
Right 908161290 1:61410988-61411010 TCAACTCCCTTATGTATTGATGG 0: 1
1: 0
2: 0
3: 7
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908161288 Original CRISPR CTGATAATACAGAAGACACT TGG (reversed) Intronic
900902579 1:5527015-5527037 CTGATAAGACAGAAGACTCCAGG + Intergenic
903201020 1:21738938-21738960 CTGAAAACACTGAAGATACTGGG + Intronic
907445661 1:54506269-54506291 CAGAAAATACAGAGGAAACTGGG - Intergenic
908161288 1:61410953-61410975 CTGATAATACAGAAGACACTTGG - Intronic
908548332 1:65184509-65184531 CAAATAATTCAGAAAACACTAGG - Intronic
908623171 1:66008489-66008511 CTGATGATACAGGAGACAGCGGG - Intronic
908648069 1:66301289-66301311 CTGAGAATACAGGAGGCCCTTGG - Intronic
910007017 1:82410494-82410516 CTAAAAAGACAGAAGACACTGGG - Intergenic
910465621 1:87496200-87496222 CTGTTAACACAGAAGAGACCAGG + Intergenic
911331361 1:96529407-96529429 ATGTTAATACCGAAGACAATGGG + Intergenic
911702811 1:100974309-100974331 TTGATAATACAGAAGATATTGGG + Intronic
914238317 1:145832621-145832643 CAGAGAAAATAGAAGACACTAGG - Intronic
914360433 1:146931282-146931304 CTGTTAACACAGAAGAGACCAGG + Intergenic
914493314 1:148168616-148168638 CTGTTAACACAGAAGAGACCAGG - Intergenic
918331627 1:183466540-183466562 CTGAGAATAGAAAAGACCCTGGG + Intergenic
919214917 1:194540818-194540840 CTGTTAATACTGAAGACAGAAGG - Intergenic
919430858 1:197489327-197489349 CTTATAAGCCAGAAGACACAGGG + Intergenic
920019148 1:202940840-202940862 AAGAAAGTACAGAAGACACTTGG - Exonic
920089046 1:203439418-203439440 CTGATAATACAAAGGAGAATTGG + Intergenic
921307286 1:213809704-213809726 ATGATGATTCAGAAGGCACTGGG + Intergenic
923427579 1:233887135-233887157 CTGAGAATAATGAAGCCACTAGG - Intergenic
923431750 1:233929024-233929046 CTGTTAATATAGAATACATTTGG + Intronic
923437716 1:233983573-233983595 CTGACAATAGAGGAAACACTTGG - Intronic
923582438 1:235230941-235230963 CTTATAACACAGAAGACACATGG + Intronic
924444992 1:244120722-244120744 CTGAGAAAACAGAAGACAATTGG + Intergenic
1063334094 10:5193637-5193659 CTGATACAACAGTAGACACGTGG + Intergenic
1063356322 10:5402427-5402449 CTGATGATGCAGAAGACATGGGG - Intronic
1063767569 10:9160343-9160365 CTGGTAATACCCAAGACAATGGG + Intergenic
1063812922 10:9734809-9734831 CTAATAATTCAAAACACACTAGG + Intergenic
1063990798 10:11560155-11560177 CTGTTATTATAGAAGACAATGGG - Intronic
1065441663 10:25758815-25758837 CTGATAAAACAAAGTACACTTGG + Intergenic
1068359998 10:55965470-55965492 CTGATATAACAGAAGACCATAGG - Intergenic
1069535135 10:69247648-69247670 AGGATAGTCCAGAAGACACTGGG - Intronic
1070346045 10:75543012-75543034 GTTACAAAACAGAAGACACTGGG + Intronic
1075273322 10:121071989-121072011 TTCAGAATTCAGAAGACACTGGG - Intergenic
1077750981 11:4969793-4969815 CTGATAACTCAGAAGATACAAGG + Intronic
1077942610 11:6859327-6859349 ATGTTAATCCAGAAGACAATGGG - Intergenic
1079218223 11:18534220-18534242 CTGGTGATACTGAAGACACCTGG + Intronic
1079275117 11:19028499-19028521 CAGATAATACAAAAGCCACAAGG - Intergenic
1080392603 11:31862146-31862168 CAGATAAAATAGAAGACACACGG - Intronic
1081715289 11:45245874-45245896 CTGAGAAGAGAGAAGAGACTGGG + Intronic
1082134754 11:48534316-48534338 CTGAAAACACAGAAGTAACTGGG - Intergenic
1082613198 11:55327699-55327721 CTGAAAAGACAGAAGTAACTGGG - Intergenic
1082817271 11:57517391-57517413 TTGAGAATACAAAAGACAGTGGG + Intergenic
1083760467 11:64813869-64813891 GTGATAATACAGAAGTCTTTTGG + Intergenic
1085050494 11:73377631-73377653 CTGAGAATACAGATTACACAGGG - Intronic
1085368148 11:75972295-75972317 GAGAAAATACAGAAGACTCTGGG - Intronic
1085549074 11:77350109-77350131 CTGATATTACAGGATACACTTGG + Intronic
1085703840 11:78768578-78768600 CTGATAACAATGTAGACACTTGG + Intronic
1087178159 11:95114597-95114619 ATGAAACTACAGAAAACACTGGG - Intronic
1089580521 11:119479077-119479099 CTGAGAAAATAGAAGCCACTGGG + Intergenic
1090756868 11:129799569-129799591 CTGATAAGCCAGAAGGTACTGGG + Intergenic
1091039192 11:132261129-132261151 CAGATAAGGAAGAAGACACTGGG - Intronic
1094707389 12:32927454-32927476 TTGATAATAGAGAAAACATTGGG + Intergenic
1094789043 12:33888804-33888826 CTGATATTACACAAAACACATGG + Intergenic
1095693018 12:45111928-45111950 CTAATAATACAGACTTCACTAGG + Intergenic
1100541194 12:95559125-95559147 TTGATAATACAGAAGAAAAAAGG - Intergenic
1101422557 12:104561661-104561683 ATAATAATACAGAAGATACAGGG - Intronic
1104761045 12:131297715-131297737 CTGAGAAAAGAGAAGACACAGGG + Intergenic
1104818733 12:131663077-131663099 CTGAGAAAAGAGAAGACACAGGG - Intergenic
1107850834 13:44571772-44571794 CAAATAATACAGAATACATTTGG + Intronic
1108813339 13:54258396-54258418 CTGTTTATACAGAAAACACATGG - Intergenic
1108990651 13:56653139-56653161 AAGATAATACAAATGACACTGGG - Intergenic
1109063771 13:57656801-57656823 CTGACAACACAGAAGAGAATGGG + Intronic
1110382697 13:74872905-74872927 ATGATTATACTGAAGTCACTGGG + Intergenic
1112347738 13:98604978-98605000 GTGAAAATACAGAAGAAAATGGG + Intergenic
1113184495 13:107672514-107672536 CTGATATCAGAGAAGATACTGGG + Intronic
1113247220 13:108411092-108411114 CTGTAAATACAGATGACCCTTGG + Intergenic
1115769505 14:36655549-36655571 ATAAGAACACAGAAGACACTTGG - Intergenic
1115943220 14:38631469-38631491 CTAAAAAGACAGAAGAGACTGGG + Intergenic
1118068782 14:62222554-62222576 CTTATAAACCAGAAGAGACTGGG - Intergenic
1118458507 14:65966698-65966720 CTGATAACACAGAAGAGCCCTGG + Intronic
1121033879 14:90682930-90682952 CTGATTCTACAGAAGACATAGGG + Intronic
1125958284 15:43806709-43806731 CTAAAAATACAAAAAACACTAGG + Intronic
1126474232 15:49049412-49049434 CTGAGAAAACAGAAGCCATTAGG - Intergenic
1127063550 15:55213562-55213584 CTGTAAATACAGATGAAACTTGG - Intronic
1127204011 15:56693913-56693935 CTGATAAGACAGAAGATTCCTGG - Intronic
1128051173 15:64666123-64666145 CTGAGATTACAGTAGTCACTAGG - Intronic
1128182889 15:65620594-65620616 ATAATAAGACAGAAGAAACTGGG + Intronic
1133062958 16:3187192-3187214 CAGACAATACATAAGACACCGGG + Intergenic
1134008802 16:10835914-10835936 CTGACACTATAGCAGACACTGGG - Intergenic
1134538836 16:15048031-15048053 CTGAACATACAGAAGGCCCTGGG + Exonic
1134886020 16:17792242-17792264 CTGCAAATTTAGAAGACACTAGG + Intergenic
1136386546 16:29930083-29930105 CTGATAACAAATAAGACTCTCGG - Intergenic
1138139302 16:54553738-54553760 CTGAGAAGACAGAAGACAAGAGG - Intergenic
1140563083 16:76007214-76007236 GTGAGCATACAGAAGCCACTCGG - Intergenic
1142893766 17:2961681-2961703 CTCATTTTACAGATGACACTGGG + Intronic
1145305283 17:21670783-21670805 CTGATTATAAATAAGACAATAGG + Intergenic
1147803974 17:43116516-43116538 CTCAAAAAAAAGAAGACACTTGG - Intronic
1150550545 17:66205516-66205538 CTGAAAATACAAAATTCACTGGG + Intergenic
1153602730 18:6797525-6797547 CTGCTATTACAGAAGACAAAAGG - Intronic
1155541986 18:26878350-26878372 CTGATAATACAAAAGTCACATGG + Intergenic
1155860840 18:30897386-30897408 CTGTTAACACAGTAGACAATTGG - Intergenic
1158533680 18:58287045-58287067 CTGATAATACTTGAGAAACTAGG + Intronic
1165374655 19:35433152-35433174 CTGGTAATACTGAAAAAACTAGG + Intergenic
1166547398 19:43641428-43641450 CTGAGGACAGAGAAGACACTGGG - Intergenic
1166604853 19:44132017-44132039 CTGATGATTCAAAAGACACGAGG - Exonic
925196293 2:1928863-1928885 CTGATATTCAGGAAGACACTGGG + Intronic
926098343 2:10097375-10097397 TTCATTATATAGAAGACACTGGG - Intergenic
927949004 2:27154964-27154986 CTGATAATAGAGTAGACTTTGGG + Exonic
928919185 2:36508456-36508478 GTAATAACACAGAAGTCACTGGG - Intronic
929384110 2:41384039-41384061 ATGATTATACAGAAGATAGTAGG - Intergenic
931660100 2:64552496-64552518 CTGATAATTCAGAAGCCATTAGG + Exonic
932006170 2:67929294-67929316 CTGATCTCACAGAAGAGACTGGG - Intergenic
932859438 2:75274563-75274585 CTGATACCACAGGAAACACTGGG - Intergenic
935096444 2:99948803-99948825 CTCATGATACAGAAGACAGTTGG - Intronic
938440286 2:131324285-131324307 CTGAAAATACTTAAGAAACTTGG - Intronic
939048641 2:137280675-137280697 CTGATAAAGCACAAGACTCTGGG - Intronic
939123985 2:138152906-138152928 CTGATTAGACAGATGGCACTAGG + Intergenic
940390153 2:153123044-153123066 GTGAAGATACAGAAGACACAGGG + Intergenic
940390159 2:153123112-153123134 ATGAAGATACAGAAGACACAGGG + Intergenic
946523480 2:220492450-220492472 CTCCTAATACAGATGATACTCGG - Intergenic
947541289 2:230981526-230981548 ATGATAAGACAGGAGACACACGG - Intergenic
1173749419 20:45465253-45465275 CTGTTGATAAAGAAGACTCTTGG + Intergenic
1175368834 20:58472955-58472977 CTGCTTCTTCAGAAGACACTGGG + Intronic
1176810561 21:13533605-13533627 CTTATAAGCCAGAAGAGACTGGG - Intergenic
1177101770 21:16906912-16906934 CTGATAATCCAGAATATACAAGG + Intergenic
1180203923 21:46245198-46245220 CTGAGAAGAAAGAAGAGACTTGG + Intronic
1181873667 22:25923186-25923208 TTGTTAAACCAGAAGACACTGGG + Intronic
1185135888 22:49072235-49072257 CTAATAATACAAAAGTCAGTTGG + Intergenic
949696424 3:6701044-6701066 CTTATAAGACAGAAGAGATTGGG + Intergenic
951773542 3:26284153-26284175 ATGTTAATACACAAGACAATGGG - Intergenic
952237952 3:31499565-31499587 TTGATAATACATAAGCCCCTAGG + Intergenic
952275690 3:31873689-31873711 CTGAGAATAAAGAAGAAACACGG + Intronic
952951392 3:38528287-38528309 GTGAGGATACAGAAGGCACTTGG - Intronic
954272963 3:49523832-49523854 CTGATTTTACAGATGACACTGGG + Intronic
959330513 3:104998579-104998601 CTGACAAGCCAGAAGAGACTGGG + Intergenic
960493128 3:118341841-118341863 CTGAGATTACAGAACATACTTGG - Intergenic
961597016 3:128025916-128025938 CTGATAAAACAAAAGACCCCCGG - Intergenic
962078940 3:132116561-132116583 CTTATAAGCCAGAAGAGACTGGG - Intronic
971976323 4:33692862-33692884 ATGATATTATAGAAAACACTGGG - Intergenic
972006098 4:34108761-34108783 CAGATAATGCAGAAGTCACTGGG - Intergenic
974965742 4:68759178-68759200 TTTATAATCCAGAAGAGACTTGG - Intergenic
976809776 4:89088692-89088714 CTTATAAGCCAGAAGACAGTGGG - Intronic
977696082 4:99968249-99968271 TTGAGGATACAGAAGATACTAGG - Intergenic
978449944 4:108821529-108821551 GTGATAATACCCAAGACACCTGG - Intronic
980431432 4:132703496-132703518 CAGATAAAATATAAGACACTCGG - Intergenic
980962367 4:139488219-139488241 GAGATAATACAAAATACACTAGG - Intergenic
981401976 4:144323535-144323557 CTTATAAACCAGAAGAGACTGGG + Intergenic
981535025 4:145790807-145790829 CTGTTAATACAGAATTCAATAGG - Intronic
982569989 4:157037067-157037089 ATGATGATACAGAAAACAGTTGG + Intergenic
982576944 4:157124480-157124502 CATAAAATACAGAAGACATTAGG + Intronic
983888192 4:173004280-173004302 CTGGAAAGACAGAAGACACTAGG - Intronic
983991028 4:174119918-174119940 CAGAAAATCCAGAAGACTCTGGG + Intergenic
985188525 4:187345625-187345647 CTGATAAAACAGAAGCCATCAGG + Intergenic
986090929 5:4504969-4504991 CTGATAATAGAGAAGATATCTGG - Intergenic
987543513 5:19284408-19284430 ATGCTGATACAAAAGACACTGGG - Intergenic
987821189 5:22968944-22968966 CTTACAAAACAGAAGAGACTGGG - Intergenic
988366255 5:30304148-30304170 CTGAAAGTACAAAAGACAGTGGG - Intergenic
990546257 5:56824797-56824819 CAGATAATAGATAAGACATTCGG - Intronic
990855364 5:60260797-60260819 CTTCTAGTACAGAAGACACATGG - Intronic
992362366 5:76053217-76053239 CTGAAAAGACAAATGACACTTGG - Intergenic
992980031 5:82159754-82159776 CTAATAATACAGATGACAGAGGG - Intronic
993012155 5:82495252-82495274 CTGATAATATACTAGATACTGGG + Intergenic
993085384 5:83357500-83357522 ATGAGAATACAGAAGGTACTGGG + Intergenic
993941980 5:94069546-94069568 TTGATAATCCAGAATACACAAGG + Intronic
994753603 5:103768040-103768062 GTGATAATAAAGAAGTCACACGG - Intergenic
995953746 5:117748750-117748772 CTGATAATACAGAAGTTATTAGG - Intergenic
996607203 5:125337347-125337369 TTGATATAACAGAGGACACTGGG - Intergenic
996921294 5:128770451-128770473 CTGATAAGATAGCAGACACCAGG - Intronic
996925555 5:128822290-128822312 CTGCTAATACAGAAGACACGAGG - Intronic
997018331 5:129964335-129964357 CTGATGAAACAGAAGATGCTAGG - Intronic
997387196 5:133482866-133482888 CTGATAATCCAGACTACCCTGGG + Intronic
998730407 5:145069124-145069146 TTGATAATATGGCAGACACTTGG + Intergenic
1000379879 5:160619569-160619591 CTGATAATGCAGGAGGCACAGGG + Intronic
1000486847 5:161857196-161857218 GTCATAATAAAGAAGACAGTGGG - Intronic
1003079242 6:3007714-3007736 CTGATAACAAAGAGGACTCTAGG - Intronic
1004627522 6:17391000-17391022 CTGATAACACAGTAGACTCAGGG - Intergenic
1005019080 6:21400641-21400663 TTGACAATAGAAAAGACACTAGG + Intergenic
1008363959 6:50653960-50653982 TTTTTAAAACAGAAGACACTGGG + Intergenic
1009054504 6:58318243-58318265 CCGACAAGACAGAAGAGACTGGG + Intergenic
1009236638 6:61132331-61132353 CTGACAGGACAGAAGAGACTGGG - Intergenic
1010524086 6:76878984-76879006 TTGACAATTCAGAAGACACTTGG + Intergenic
1010988940 6:82458060-82458082 CTGATGATCCAGGAGAGACTGGG - Intergenic
1012563407 6:100615912-100615934 TTGATAAAACAGAAAGCACTTGG + Intronic
1013489497 6:110631896-110631918 CTAGGAATACAGAAGACAATAGG + Intronic
1013829125 6:114251930-114251952 CTGTTATAACAGAAGACACAAGG - Intronic
1014576491 6:123081015-123081037 TTGAACATACAGAAAACACTAGG - Intergenic
1016692983 6:146960504-146960526 CTGATTATTCAGAAGATAATTGG - Intergenic
1019279960 7:194598-194620 GTGTTTAGACAGAAGACACTGGG - Intronic
1021052191 7:16001502-16001524 CTGATAATACAAATAACACCAGG + Intergenic
1021539783 7:21744713-21744735 CTGTGAATCCAGAATACACTTGG + Intronic
1022804089 7:33804453-33804475 AAGATAACACAGAAGACACATGG - Intergenic
1023537912 7:41232982-41233004 CTGATAATTCAGAAGATTTTTGG + Intergenic
1024450129 7:49530023-49530045 CTGATAATTCCTAAGACATTGGG + Intergenic
1024872010 7:53974714-53974736 TTGCTGATAAAGAAGACACTTGG - Intergenic
1024886581 7:54148996-54149018 CAGATGTCACAGAAGACACTTGG - Intergenic
1025254347 7:57373277-57373299 CTGATTACACATAAGACCCTCGG - Intergenic
1025283241 7:57643182-57643204 CTGATTATAAATAAGACAATAGG + Intergenic
1026799525 7:73390745-73390767 CTTGTAAGACAGAAGTCACTTGG - Intergenic
1027937349 7:84625432-84625454 CTGAAAATACATGAGACATTGGG - Intergenic
1028254093 7:88570796-88570818 CTGATATTAAAAAAGATACTGGG - Intergenic
1029047641 7:97646575-97646597 CTGTAAATACAGATGATACTTGG + Intergenic
1029848274 7:103436241-103436263 CTGAAAATTCAGGAGACCCTTGG + Intronic
1032607828 7:133376521-133376543 CTGAGAAAAAAGAACACACTAGG + Intronic
1033459606 7:141533397-141533419 CTGACAATAAAGCAAACACTAGG + Intergenic
1033510315 7:142054282-142054304 CTGACACTGCACAAGACACTAGG - Intronic
1033513109 7:142080314-142080336 CTGACACTGCACAAGACACTAGG - Intronic
1034044845 7:147916941-147916963 CTGATAATACATAAGGCAATGGG - Intronic
1034776166 7:153828702-153828724 CTGATAATTGAGAAGAAGCTAGG + Intergenic
1035235521 7:157495325-157495347 CTGATCATACAGAAAACAGTGGG + Intergenic
1039419374 8:37422999-37423021 CTAATAATAGAGAAGGAACTAGG + Intergenic
1041543688 8:59015919-59015941 AAGATAATACAGAAAATACTTGG + Intronic
1043695060 8:83207770-83207792 TAGATTATACAGAACACACTAGG + Intergenic
1043713006 8:83446331-83446353 ATCATGATGCAGAAGACACTGGG + Intergenic
1043966448 8:86482853-86482875 CTGAACATACAGAAGGCCCTGGG + Intronic
1043967581 8:86495965-86495987 CTTATAAGCCAGAAGAGACTAGG + Intronic
1044086204 8:87945125-87945147 CTGGAAACACAGAAGAAACTTGG + Intergenic
1044185950 8:89252457-89252479 CTTATAAAACAGAAGAAATTGGG - Intergenic
1044270252 8:90234111-90234133 CTGATGATACAGAACTAACTGGG - Intergenic
1044391310 8:91655123-91655145 CTGGAAATACAGTAGCCACTAGG - Intergenic
1045648853 8:104324649-104324671 CTGACAAGACAGAAGACCCTGGG - Intergenic
1048680395 8:136834623-136834645 CTAGAAATAGAGAAGACACTAGG + Intergenic
1050492577 9:6204340-6204362 CTGACAAGCCAGAAGAGACTGGG + Intergenic
1050921504 9:11207479-11207501 CTAAAAATACAAAATACACTAGG - Intergenic
1051045723 9:12871139-12871161 CTGAAAATACAGAAGTAGCTTGG + Intergenic
1051666446 9:19471055-19471077 CTTATGATAAAGAAGACAGTTGG - Intergenic
1051712885 9:19949794-19949816 GTGAAAAGAAAGAAGACACTTGG + Intergenic
1051932875 9:22407710-22407732 CTTATAAACCAGAAGACACTGGG + Intergenic
1052226802 9:26099234-26099256 CTCAAAAAACAGAAGCCACTGGG + Intergenic
1052769276 9:32672581-32672603 GTGCTGATTCAGAAGACACTTGG + Intergenic
1053130468 9:35611803-35611825 CTGATGATACACAACGCACTAGG - Exonic
1054958834 9:70944351-70944373 CTCAGAATACAGAAAACAATGGG - Intronic
1055895401 9:81168755-81168777 GTGAAAAAACAAAAGACACTTGG - Intergenic
1057060305 9:91998293-91998315 CTAAAAATACAGAAGACAGCCGG + Intergenic
1058271684 9:102980207-102980229 TTCATAGTACAAAAGACACTTGG + Intergenic
1061868989 9:133510159-133510181 CTGATCAAACAGAACACTCTGGG + Intergenic
1186289890 X:8085381-8085403 AAGATATTTCAGAAGACACTTGG - Intergenic
1186418497 X:9404529-9404551 CTGATCACACAGAAGGCATTTGG + Intergenic
1188805447 X:34582875-34582897 CTGATAATTTAGTAGTCACTTGG - Intergenic
1188968719 X:36586199-36586221 ATGAAAGTTCAGAAGACACTGGG - Intergenic
1190181854 X:48198967-48198989 CTGAAAATACAGAACAAAATGGG + Intronic
1190194897 X:48308454-48308476 CTGAAAATACAGAACAAAATGGG + Intergenic
1190661334 X:52656656-52656678 CTGAAAATACAGAAAACAATAGG + Intronic
1190712513 X:53080984-53081006 CTTAAAATACAGCATACACTGGG + Intergenic
1191244196 X:58213029-58213051 ATGCTAATAATGAAGACACTTGG + Intergenic
1192934652 X:75847034-75847056 CCAACAAGACAGAAGACACTAGG - Intergenic
1193480903 X:82027524-82027546 CTGATAATACAGAATACAAAAGG + Intergenic
1193545146 X:82817858-82817880 CTGACAATACTCTAGACACTTGG - Intergenic
1195769766 X:108338139-108338161 CTGATAATAGAGAAATCACTGGG + Intronic
1195814960 X:108874726-108874748 GTGGTAGTACATAAGACACTGGG - Intergenic
1196192640 X:112810812-112810834 CTGATAATATTGAAGACTTTGGG - Intronic
1197671951 X:129286656-129286678 CTCATAAGCCAGAAGCCACTGGG + Intergenic
1198079901 X:133229690-133229712 GTGCTGATACAAAAGACACTGGG - Intergenic
1198853314 X:140988955-140988977 CTGATAAAAAAGAAAACACAGGG - Intergenic
1198959791 X:142172232-142172254 CTGATAAAACAGGAGATTCTTGG - Intergenic