ID: 908163024

View in Genome Browser
Species Human (GRCh38)
Location 1:61430242-61430264
Sequence CAGAGTACCCACTATGTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1570
Summary {0: 1, 1: 0, 2: 28, 3: 245, 4: 1296}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908163024_908163027 1 Left 908163024 1:61430242-61430264 CCCAGCACATAGTGGGTACTCTG 0: 1
1: 0
2: 28
3: 245
4: 1296
Right 908163027 1:61430266-61430288 ATACATTGGCTGAGTCTAAATGG 0: 1
1: 0
2: 0
3: 13
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908163024 Original CRISPR CAGAGTACCCACTATGTGCT GGG (reversed) Intronic
900009029 1:89128-89150 CTGAGCACCTACTATGTGCCAGG - Intergenic
900471634 1:2857826-2857848 CAGAGCACCCACGGTGTGCAGGG - Intergenic
900616581 1:3568273-3568295 CAGTGCACCCAGTGTGTGCTTGG + Intronic
900882491 1:5392169-5392191 TAGAGTACCTACTGTGTGCCAGG - Intergenic
900916080 1:5639599-5639621 TTGAGCACCTACTATGTGCTGGG + Intergenic
900929585 1:5728074-5728096 CAGAGCACCTATGATGTGCTGGG - Intergenic
901024527 1:6272074-6272096 CTGAGTGCCCACTGTGGGCTAGG + Intronic
901046530 1:6399510-6399532 TTGAGTACCTACTATGTGCTAGG - Intergenic
901054396 1:6441994-6442016 CAGAGTGCTCACTACCTGCTGGG - Intronic
901119369 1:6877937-6877959 CTGAGTATCTACTATGTGCAAGG - Intronic
901689901 1:10965981-10966003 CTGAGTACCTACTGTGTGCCAGG + Intronic
901782458 1:11602848-11602870 CAGTGTCCCCACCATGTGATGGG + Intergenic
901885581 1:12220631-12220653 CTGAGCACCTACTATGTGCCTGG - Intergenic
902178746 1:14671334-14671356 CTGAGCACCTACTATGTGCCAGG - Intronic
902256000 1:15188997-15189019 CTGAGTGCCCTCTATGAGCTGGG - Intronic
902404362 1:16174820-16174842 CCGAGAACCTACTATGTGCTGGG - Intergenic
902538040 1:17132984-17133006 CAGAGTACCTACCATGAGCTGGG - Intergenic
902604450 1:17561141-17561163 CTGAGCACCTACTACGTGCTGGG - Intronic
902642229 1:17774365-17774387 CGGAGCACCTACTATGTGCCTGG - Intronic
902723440 1:18319990-18320012 CTGAGTACCTACTATGTACCAGG - Intronic
902772313 1:18652313-18652335 TTGAGAACCCACTATGTGCCAGG + Intronic
902835191 1:19042847-19042869 CAAAGCACCTACTATGTGCCGGG + Intergenic
902846662 1:19116139-19116161 CTGAGTACTTACTATGTACTAGG + Intronic
902912875 1:19613658-19613680 CCGTGTACCCACTGTGTGCCAGG - Intronic
902937945 1:19778182-19778204 TTGAGTGCCTACTATGTGCTAGG + Intronic
902939163 1:19787321-19787343 CTGAGCACTCACCATGTGCTGGG + Intronic
902996788 1:20231865-20231887 TTGAGTACCCACTATATGGTTGG - Intergenic
903139164 1:21328374-21328396 CTGAGGACCCACTATGTGCCAGG - Intronic
903144898 1:21365045-21365067 CTGAGCACCTACTATGTGCCAGG - Intergenic
903183273 1:21615805-21615827 CTGAGTACCAACCATGTGTTTGG + Intronic
903227857 1:21904040-21904062 CGGGGTACCTACTATGTGCTGGG + Intronic
903268962 1:22176035-22176057 CTGAGCACCTACTATGTGCCGGG - Intergenic
903354579 1:22738732-22738754 CTGAGGACCAACTATGTGCCTGG + Intronic
903580927 1:24370269-24370291 CAAAGCATCCACTATGTGCTAGG - Intronic
903685661 1:25130031-25130053 CTGAGTACTCACTATGTGCTAGG + Intergenic
903770403 1:25760164-25760186 CTGAGCACCCGCTATGTGCTGGG + Intronic
903994827 1:27299209-27299231 CTGAGCTCCTACTATGTGCTAGG + Intronic
904136137 1:28314038-28314060 CAGAGTTCACAGTCTGTGCTTGG + Intergenic
904258043 1:29269449-29269471 CTGAATGCCCACTTTGTGCTGGG + Intronic
904295219 1:29515878-29515900 TTGGGTACCTACTATGTGCTAGG + Intergenic
904321473 1:29700276-29700298 CTGTGTACCTACTATGTGCCCGG - Intergenic
904325533 1:29725306-29725328 CTGAGCACCTACTATGTGCCAGG + Intergenic
904330308 1:29754249-29754271 CAGAGTTCCCACTGAGTGCCAGG + Intergenic
904338347 1:29812370-29812392 CTGAGCACCTACTATGTGCCAGG - Intergenic
904342587 1:29846463-29846485 CTGAGCACCTACTATGTGCCAGG + Intergenic
904358918 1:29959915-29959937 CTGAGCACCTACTATGTGCTGGG + Intergenic
904380086 1:30104750-30104772 CTGAGCACCTACTATGTGCCAGG + Intergenic
904399554 1:30247251-30247273 CGGAGCACCTACTATGTGCCAGG - Intergenic
904407636 1:30303572-30303594 CTGAGCACCTACTATGTGCCAGG + Intergenic
904456843 1:30652907-30652929 CTGAGCATCTACTATGTGCTAGG + Intergenic
904461470 1:30683075-30683097 CTGAGCACCTACTATGTGCCAGG + Intergenic
904681118 1:32229974-32229996 TAGAGTGCCTACTATGTGCTGGG - Intronic
904846977 1:33427238-33427260 TTGAGTGCTCACTATGTGCTAGG - Intronic
904894425 1:33803541-33803563 CCGAGTACCTACTATGTGCCTGG + Intronic
904911902 1:33940709-33940731 TTAAGCACCCACTATGTGCTTGG - Intronic
905004127 1:34696688-34696710 ATGAATACCAACTATGTGCTAGG - Intergenic
905087211 1:35391397-35391419 AGGACTACACACTATGTGCTAGG + Intronic
905241726 1:36585963-36585985 TTGAGTGCCCACTATGTGCCAGG + Intergenic
905294961 1:36948470-36948492 CAGTGCACCTACTGTGTGCTAGG + Intronic
905364210 1:37440035-37440057 CTGAGGACCTACTATGTGCCAGG - Intergenic
905504044 1:38462789-38462811 CTGAGTGCCTACTATGTGCCAGG - Intergenic
905512584 1:38534326-38534348 CTGAGTACCTACTAAGTGCCTGG - Intergenic
905701523 1:40019446-40019468 ATGAGTAACTACTATGTGCTAGG - Intergenic
905774436 1:40659538-40659560 CTGTGTACCTACTATGTGCCGGG + Intronic
905884871 1:41486249-41486271 CTGAGCACCTACTACGTGCTTGG + Intergenic
906135846 1:43500338-43500360 CTGAGTGCCTACTATGTGCCAGG + Intergenic
906141768 1:43537976-43537998 CTAAGCACCTACTATGTGCTGGG - Intronic
906188779 1:43881999-43882021 CTGAGCACCTGCTATGTGCTTGG + Intronic
906212638 1:44020721-44020743 GTGAGTCCCCACTATGTGCCAGG + Intronic
906267220 1:44441783-44441805 TTGAGTACCTACTATGTGCTAGG + Intronic
906272322 1:44489513-44489535 TTGAGTTCCCACTATGTGCCAGG + Intronic
906365700 1:45207364-45207386 TTGAGCACCCACTATGTGCCAGG - Intronic
906504626 1:46369350-46369372 TTGAGTACCTCCTATGTGCTAGG + Intergenic
906554476 1:46697563-46697585 CAGAGTACCCACCAGTTTCTGGG + Intronic
906645181 1:47469763-47469785 CTGAGTACCCACTATGTGCCAGG + Intergenic
906748688 1:48239731-48239753 GTGAGTACTTACTATGTGCTAGG + Intronic
906777604 1:48543778-48543800 CGGAGCACCTACTATGTGCCAGG + Intronic
906824020 1:48959394-48959416 TTGAGAACCTACTATGTGCTGGG + Intronic
906946909 1:50302164-50302186 TTGAGTACCCACTATATGCCAGG - Intergenic
906952811 1:50348535-50348557 CAAAGCACCCACTCGGTGCTGGG + Intergenic
907217514 1:52878027-52878049 TATAGTACCTACTATATGCTAGG + Intronic
907353202 1:53850473-53850495 CTGAGCACCTACTATGTGCTGGG - Intergenic
907388426 1:54140745-54140767 TTGAGTACCTACTATGTGCCAGG + Intronic
907391670 1:54162228-54162250 TTGAGTACCTACTATGTGCCAGG + Intronic
907501794 1:54886679-54886701 CAAAGTGCCCACTGTGTGCAGGG - Intronic
907517751 1:55003739-55003761 CTGAGTAGTTACTATGTGCTGGG + Intronic
907551150 1:55305751-55305773 CTGAGTACCTACTATGTGCAAGG - Intergenic
907659714 1:56380812-56380834 CTGAGTATCTATTATGTGCTTGG + Intergenic
907678837 1:56544502-56544524 TTGGGCACCCACTATGTGCTAGG + Intronic
907855070 1:58295225-58295247 CCAAGTACCTACTATGTGCCAGG - Intronic
907925952 1:58955355-58955377 TTGAGTACCCACTATGTGGCAGG - Intergenic
908056041 1:60288338-60288360 ATGAATACCTACTATGTGCTAGG + Intergenic
908104153 1:60824256-60824278 TTGAGTACTCACTATGTGCCTGG - Intergenic
908163024 1:61430242-61430264 CAGAGTACCCACTATGTGCTGGG - Intronic
908235637 1:62145206-62145228 CTGAGCACCTGCTATGTGCTAGG + Intronic
908338873 1:63155686-63155708 CTGAGTACCTAGTATGTGCTAGG + Intergenic
908819245 1:68066380-68066402 CTGAGTGTCTACTATGTGCTAGG - Intergenic
909547610 1:76865296-76865318 TTGAGTACCTACTATGTGCCAGG - Intergenic
909566311 1:77057108-77057130 CTGAGTACCTACTATATGCCAGG + Intronic
910007368 1:82415154-82415176 CTGTGTATCTACTATGTGCTAGG - Intergenic
910072615 1:83237249-83237271 TTGAGTACCTACTATGTGCAAGG + Intergenic
910072695 1:83238080-83238102 CTGAGTGCTCACTATGTTCTAGG + Intergenic
910075512 1:83272805-83272827 CTGAGTGCCTACTATGTGCTGGG + Intergenic
910078857 1:83315004-83315026 CTGAGTATTCACTATGTGCCAGG - Intergenic
910134205 1:83947553-83947575 TAGAGTACACACTCTGTGCTAGG + Intronic
910334615 1:86113161-86113183 CTGAGTACCTACTATGTGCTAGG + Intronic
910443781 1:87280115-87280137 CAAAGCACCTACTATGTGTTAGG + Intergenic
910594280 1:88962203-88962225 CTGTGTACCTACTATGGGCTAGG + Intronic
910934178 1:92473933-92473955 TTGAGCACCCAGTATGTGCTGGG - Intergenic
911044868 1:93620012-93620034 TAGAGTGCCTACTATGTGTTGGG - Intronic
911715343 1:101126249-101126271 CTGAGCACCTACTATGTGCCAGG - Intergenic
912210031 1:107547135-107547157 CTGAGTGTCCACTATGTGCAAGG + Intergenic
912248222 1:107983617-107983639 CAGCGTGCCTACTGTGTGCTGGG - Intergenic
912498533 1:110106760-110106782 CTGAGCACCTACTATGTGCCAGG + Intergenic
912563327 1:110565943-110565965 CAAAGTGCCCACTATGTGGCTGG + Intergenic
912688695 1:111787219-111787241 TAGAGTATCTACTATGTGCCAGG + Intronic
912788680 1:112629488-112629510 CAGAAGACCCACTATGTTTTAGG - Intronic
912806548 1:112760919-112760941 CAGAGTGCCTACCATGTGCCAGG + Intergenic
913053555 1:115137609-115137631 TTGAGTGCCTACTATGTGCTGGG + Intergenic
913335524 1:117706272-117706294 CAGAGTCCCGGCTATGTGGTGGG + Intergenic
913359905 1:117968901-117968923 TTGAGTACCCACTATGTGCCTGG + Intronic
913570472 1:120114974-120114996 TTGAGCACCTACTATGTGCTAGG - Intergenic
914291277 1:146275952-146275974 TTGAGCACCTACTATGTGCTAGG - Intergenic
914334583 1:146702806-146702828 TTGAGTACCCACCATGTGCCAGG + Intergenic
914349679 1:146830189-146830211 CAGAATACCTACTATGTGCTAGG - Intergenic
914402832 1:147339540-147339562 TTGAGTACCTACTATGTGCATGG - Intergenic
914426372 1:147580822-147580844 TTGAGGACCTACTATGTGCTGGG + Intronic
914552321 1:148726735-148726757 TTGAGCACCTACTATGTGCTAGG - Intergenic
914701779 1:150140629-150140651 CTGAGTGTCTACTATGTGCTAGG - Intronic
915102352 1:153509532-153509554 CTGAGTACCCACCATGTGGCAGG + Intergenic
915279745 1:154814302-154814324 AATAGCACCTACTATGTGCTAGG + Intronic
915432824 1:155879741-155879763 TATAGTGCGCACTATGTGCTGGG + Intronic
915638592 1:157203840-157203862 CTGAGTGCCTACCATGTGCTGGG - Intergenic
915680575 1:157578391-157578413 CTGAGCACCTCCTATGTGCTAGG - Intronic
916214260 1:162382413-162382435 CTGAGTGCCCACCATGTCCTCGG + Intronic
916238633 1:162616029-162616051 CAGAGTACACACTCTCTGTTAGG - Intergenic
916242340 1:162652638-162652660 CTGAGTACCCACTATGTGGTAGG + Intronic
916246184 1:162690476-162690498 CAGCATACCTACCATGTGCTAGG + Intronic
916313844 1:163426204-163426226 CTGAGTGCCTAGTATGTGCTAGG + Intergenic
916572247 1:166038085-166038107 CAGACTAACCACCATGTGGTTGG - Intergenic
916743675 1:167667893-167667915 CTGAGTACCTACTATGGGCTAGG + Intronic
916745112 1:167679312-167679334 CAGAGTACCTCCTATGTGGGAGG - Intronic
916809050 1:168289697-168289719 CAGAGCACTCACTAGGTGCCAGG - Intronic
916962028 1:169898199-169898221 CTGAGTACCTAGTATGTTCTAGG - Intergenic
917019065 1:170566696-170566718 TTGAGTATCTACTATGTGCTAGG - Intergenic
917254090 1:173096054-173096076 CAGAGCATCTACTATGTCCTAGG - Intergenic
917379287 1:174386184-174386206 CAGTGTACTTACTATGTGCCAGG + Intronic
917518823 1:175731499-175731521 CAGAGTACCTATTAAGTGCCCGG + Intronic
917654249 1:177110582-177110604 TGGAGTACCTACTATGTGCAAGG + Intronic
917966887 1:180184419-180184441 TTGAGTACTCACTATGTGCTAGG + Intronic
918061286 1:181063448-181063470 CTGAGTGCCTACTATGTGCCAGG - Intergenic
918105242 1:181410966-181410988 TTGAGCACCCACTATGTGTTGGG - Intergenic
918118292 1:181515829-181515851 CTGAGTACCAACTATATGCCAGG - Intronic
918118461 1:181517013-181517035 CTGAATACCCACTGTGTGCCAGG + Intronic
918589936 1:186229651-186229673 CACAGTACCTATTATGTTCTTGG - Intergenic
919504564 1:198383247-198383269 CAGTGTACCTATTGTGTGCTAGG + Intergenic
919556793 1:199065782-199065804 CTGAGTACCCGCTATGTGCCAGG - Intergenic
919739768 1:200974527-200974549 GTGAGTGCCCACCATGTGCTGGG - Intronic
919975360 1:202607233-202607255 CAGAGTGCCCGCTGTGTGCTTGG - Intronic
920394373 1:205633050-205633072 CTGGGTATCTACTATGTGCTAGG - Intergenic
920442776 1:205992420-205992442 ATGAGCACCCACTATGTGCCAGG - Intronic
920459588 1:206128965-206128987 TTGAGTACCCATTATGTGCCAGG - Intergenic
920950765 1:210569941-210569963 CTGAGTACCAACTATAGGCTAGG - Intronic
920982606 1:210852398-210852420 CTGAGGGCCTACTATGTGCTAGG - Intronic
921055834 1:211541787-211541809 CTCAAAACCCACTATGTGCTAGG - Intergenic
921114824 1:212079685-212079707 CAGAGCACCTACTATGTGTCTGG - Intronic
921515144 1:216081545-216081567 CGGAGTGCCTATTATGTGCTTGG - Intronic
921532446 1:216301406-216301428 TTGAGTACCTACTATGTTCTAGG - Intronic
921864652 1:220075505-220075527 TAGAGCACCTACTGTGTGCTAGG - Intronic
922198085 1:223376935-223376957 CTGAGCACTTACTATGTGCTAGG - Intergenic
922597455 1:226824898-226824920 TAGAGCATCTACTATGTGCTAGG + Intergenic
923154044 1:231260163-231260185 GAGAGAAGCCACTATTTGCTAGG + Intronic
923160377 1:231309742-231309764 TTGATCACCCACTATGTGCTAGG - Intergenic
923330669 1:232921152-232921174 TTGAATACCTACTATGTGCTGGG - Intergenic
923805885 1:237257575-237257597 CTGAATATCTACTATGTGCTGGG + Intronic
924614523 1:245601648-245601670 TTGAGCACCTACTATGTGCTGGG - Intronic
1062783825 10:243253-243275 TTGAGTACTCACTATGTGCTAGG - Intronic
1063060648 10:2547926-2547948 TTGAATACCAACTATGTGCTAGG - Intergenic
1063194628 10:3729920-3729942 CAATGTACCTACTATGTTCTCGG + Intergenic
1063441141 10:6074328-6074350 TTGAGTACCTACTATGTGCCAGG + Intergenic
1063484981 10:6411302-6411324 CTGAGTGCCTACTATGTGCCAGG - Intergenic
1063985773 10:11499929-11499951 CAGAGCACCTACCATATGCTAGG + Intronic
1064335924 10:14441218-14441240 CTGAGTAACCAGTATGTGCCGGG + Intronic
1064452778 10:15458417-15458439 TTGAGTACCCACTATATGCCAGG + Intergenic
1064862046 10:19836904-19836926 CTGAGTACCTAATATGTGCAAGG - Intronic
1064904894 10:20335153-20335175 CTGAGCATCTACTATGTGCTGGG - Intergenic
1065537913 10:26732676-26732698 CTGAGCGTCCACTATGTGCTAGG - Intronic
1065570362 10:27065324-27065346 TTGAGTACCAACCATGTGCTAGG - Intronic
1065688987 10:28314187-28314209 CTGAGCACCTACTATGTGCCAGG + Intronic
1065872069 10:29964198-29964220 CGGAGCACCCACTCTGTGCCAGG + Intergenic
1066258471 10:33704941-33704963 TAAAGTAGCCACTATGTACTAGG + Intergenic
1066379838 10:34891905-34891927 TAGAGTGCCCACAATGTGCCAGG + Intergenic
1067316667 10:45173036-45173058 CTAAGTACCAACTGTGTGCTAGG + Intergenic
1067467025 10:46508742-46508764 CAGAGCACTTACTGTGTGCTAGG - Intergenic
1067620161 10:47875863-47875885 CAGAGCACTTACTGTGTGCTAGG + Intergenic
1068241199 10:54302741-54302763 TAGAGTACCTATTATGTGTTAGG - Intronic
1068547553 10:58366364-58366386 GTAAGTGCCCACTATGTGCTAGG - Intronic
1068784198 10:60952401-60952423 GTAAGTACCCACTATGTGTTGGG + Intronic
1069083065 10:64108709-64108731 CTGAGTATCTACTCTGTGCTTGG + Intergenic
1069409601 10:68139813-68139835 CTGAGTACCTACCATGTGCCAGG + Intronic
1069514564 10:69067388-69067410 CTGAGCACCTATTATGTGCTAGG - Intergenic
1069745351 10:70711586-70711608 TTGAGTACCCACTATGTGCCAGG - Intronic
1070289805 10:75106757-75106779 CTGAGTATCCACTACGTGCCTGG - Intronic
1070415622 10:76186587-76186609 CAGAGTACCCACTCAGTGCCAGG - Intronic
1070536329 10:77380676-77380698 CTGAGCTCCTACTATGTGCTGGG - Intronic
1070546230 10:77455146-77455168 CTGAGTACCTACCATGTGCTTGG + Intronic
1070644168 10:78189956-78189978 TTGAGCACCCACTATGTGCCAGG + Intergenic
1070708257 10:78657321-78657343 CTGAGCACCTACTATGTGCCGGG - Intergenic
1070829594 10:79410357-79410379 TTGAGTACCTACTATGTGCCAGG - Intronic
1070830784 10:79417032-79417054 CTGAGCACTCACTATGTGCCAGG + Intronic
1071264774 10:83955129-83955151 ATGAGTACCTACTATGTGCAAGG - Intergenic
1071397252 10:85236562-85236584 TTGAGTGCCCACTAGGTGCTAGG + Intergenic
1071777659 10:88807109-88807131 TTGAGTTCCTACTATGTGCTGGG + Intronic
1071815658 10:89230181-89230203 TTGAGTACCAACTATGTGCCAGG + Intronic
1071850697 10:89566890-89566912 CTGAGTACCTACTATGTGCCAGG + Intergenic
1071940978 10:90591675-90591697 TTGAGTACCCAGTATGTGCTAGG + Intergenic
1071973179 10:90929236-90929258 CTGAGTGCCTACTATGTGCTGGG - Intergenic
1072138458 10:92569748-92569770 CTGAGTACCTACTATGTGTCAGG + Intronic
1072195485 10:93114250-93114272 TTGAGGACCTACTATGTGCTAGG + Intergenic
1072199520 10:93145659-93145681 CTGAGCACCTACTTTGTGCTGGG - Intergenic
1072312217 10:94167489-94167511 AAGAGTGCCTACTATGTGCCAGG - Intronic
1072460685 10:95615954-95615976 TTGAGTACCTACTATGTGCAAGG - Intronic
1072709527 10:97707069-97707091 CAGAGCACCTACTCTGTGCCAGG - Intergenic
1072713717 10:97735571-97735593 CAGAATGCCTACTATGTGCCAGG + Intergenic
1072719849 10:97773532-97773554 TAGAGTACCTACTATCTGCAAGG + Intergenic
1072840446 10:98768570-98768592 CTTAGTAACCACTCTGTGCTGGG - Intronic
1073066605 10:100763750-100763772 CTAAGCACCTACTATGTGCTAGG + Intronic
1073067690 10:100773241-100773263 CTGAGTATCTACTATGTGCTAGG - Intronic
1073204964 10:101763994-101764016 CTGAACACCCACCATGTGCTGGG + Intergenic
1073264890 10:102221040-102221062 TTGAGTGCCCACTATGTGCCAGG + Intergenic
1073672847 10:105611305-105611327 CAGACAACCCACTATGTGACAGG + Intergenic
1073704743 10:105970404-105970426 CGCAGTTCCCACTATGTGCAAGG - Intergenic
1073973765 10:109075729-109075751 CAGTGTAGCCAGCATGTGCTGGG + Intergenic
1074060888 10:109964591-109964613 CTGAGTACTTACCATGTGCTGGG - Intergenic
1074064010 10:109996009-109996031 CTGAGCACTCACTATGTGCCAGG - Intergenic
1074260646 10:111850012-111850034 CTGAGCACTCACTATGTGCTGGG - Intergenic
1074296900 10:112198163-112198185 CCTAGTACCCACTCTGTGCCAGG - Intronic
1074301294 10:112235372-112235394 CCGAGTACCTACTGTGTGCCAGG - Intergenic
1074547242 10:114410435-114410457 CTGAGTACCTACTATGTGCCAGG - Intergenic
1074844650 10:117386855-117386877 TGAAGTACCCACTATGTGCTAGG - Intergenic
1074883469 10:117676531-117676553 TTGAGTACCTACTATGTGCCAGG - Intergenic
1074946322 10:118284157-118284179 CTGAATACCTACTATGTGCAAGG - Intergenic
1075107820 10:119553750-119553772 CTGAGTACTCACTATGTACTTGG + Intergenic
1075203421 10:120425631-120425653 CTGAGTACCTAATATGTGCCAGG - Intergenic
1075209317 10:120477760-120477782 CTGAGTATCTACTATGTGCCAGG - Intronic
1075238701 10:120757401-120757423 GTGAGAACCTACTATGTGCTAGG - Intergenic
1075334127 10:121597009-121597031 CAGGGCACCCATTATGTGTTTGG - Intronic
1075880585 10:125847498-125847520 CATAGTACCTACTGTGTGCCAGG + Intronic
1075990414 10:126833615-126833637 CTGAGCACTCACTATGTGCTAGG + Intergenic
1076014467 10:127016211-127016233 CTGAGCACCTACTATGTGCCAGG - Intronic
1076333875 10:129692055-129692077 CTGAGCACCCACTGGGTGCTGGG - Intronic
1077521887 11:3041310-3041332 CTGAGTACCTACCATGTGCCAGG + Intronic
1077637508 11:3853956-3853978 CAGAGAACTTACTATGTGCAGGG + Intergenic
1077871744 11:6268676-6268698 CAGAGGACTCCCTTTGTGCTAGG - Intronic
1078138946 11:8677214-8677236 GAGAGTACCTACTCTTTGCTAGG + Intergenic
1078199182 11:9164684-9164706 CTGGGTACCTACTATGTGCCAGG - Intronic
1078237038 11:9495003-9495025 TAGAGTACCTACCATGTGCCAGG - Intronic
1078261552 11:9714420-9714442 CTGAGTACATACTATGTGCCAGG - Intronic
1078262349 11:9722123-9722145 TGGAGTACCTACTATGTGATGGG + Intronic
1078372184 11:10757673-10757695 CTGAGTACCAACTATGTGGCAGG + Intronic
1078459704 11:11504833-11504855 CTGAGTGCCAATTATGTGCTGGG + Intronic
1078637192 11:13063065-13063087 CAGAGTGCTGACTATGTGCTTGG - Intergenic
1078658509 11:13264581-13264603 CAGAGCACTGACTGTGTGCTAGG - Intergenic
1078784497 11:14475343-14475365 CTGAATACCCACTAAGTGCTAGG - Intronic
1078935496 11:15945833-15945855 GAGAGCACCCACTGTGTGCCAGG + Intergenic
1079105338 11:17568589-17568611 CTGAGCACCAACTATGTGCAAGG - Intronic
1079299324 11:19263690-19263712 CTGAGTGCCTACTATGTGCTAGG + Intergenic
1079356646 11:19735455-19735477 CAGAGCACCTACTATGTTCCAGG + Intronic
1080043333 11:27782700-27782722 CAGAACACCCACTATGAGCCAGG + Intergenic
1080046508 11:27814222-27814244 TTGAGTGTCCACTATGTGCTAGG + Intergenic
1080055428 11:27901836-27901858 CATAGTACTCACTATAAGCTAGG + Intergenic
1080226047 11:29961619-29961641 CTGAGTACCAACTATGTGCCAGG + Intergenic
1080752516 11:35164035-35164057 TAGAGTACCTACTGTGTGCCAGG - Intronic
1081323716 11:41720652-41720674 CTGTGTACCTACTATGTGCCTGG - Intergenic
1081533849 11:43983380-43983402 CTGAGCACCTACTATGTGCCTGG + Intergenic
1081662751 11:44898062-44898084 TTGAGGACCCACTATGTGCCAGG + Intronic
1081730578 11:45369245-45369267 CTGAATACCTACTATGTGCCAGG - Intergenic
1081748901 11:45493855-45493877 CTGAGTGCCTACTATGTGCCAGG - Intergenic
1081759596 11:45568005-45568027 CTGAGCACCTACTATGTGCCAGG - Intergenic
1081768101 11:45626594-45626616 CTGAGGACCTACTATGTGCTAGG + Intergenic
1082556423 11:54567986-54568008 CATACTAAGCACTATGTGCTAGG - Intergenic
1082812605 11:57487541-57487563 CTGAGAACCTACTATGTGCCAGG + Intronic
1083063171 11:59896008-59896030 CGGAGAACCTACTATGTGCCAGG - Intergenic
1083224204 11:61274277-61274299 CAGAGCACCTACTGTGTGCTGGG - Intronic
1083294030 11:61705708-61705730 CAGAGTGCCTACTATGTGCCAGG - Intronic
1083328898 11:61888012-61888034 CTGAGTGCCTACTATGTGCCAGG - Intronic
1083334283 11:61913725-61913747 CTGAGCACCCATTATGTGCCAGG + Intronic
1083447249 11:62716376-62716398 CCGAGTGCCTGCTATGTGCTAGG - Intronic
1083582829 11:63836173-63836195 CTGAGCACCTACTATGTGCAAGG - Intergenic
1083620075 11:64044882-64044904 CTGAGGCCCCACTGTGTGCTGGG + Intronic
1083687180 11:64383520-64383542 CAGAGTACCTACTATGTGCCAGG - Intergenic
1083726414 11:64630853-64630875 CAGAGCACCTACTCTGTGCAAGG + Intronic
1083789070 11:64972283-64972305 CAGAGTCCTTACTGTGTGCTAGG + Intergenic
1083946758 11:65927932-65927954 CTGAGTACCTACTCTGTGCCGGG + Intergenic
1084018701 11:66403739-66403761 CACAGAACCCTCTGTGTGCTGGG - Intergenic
1084268208 11:68015650-68015672 CTGAGCACCTACTATGTGCCAGG + Intronic
1084309734 11:68309971-68309993 CTGAGCACCTACTGTGTGCTAGG + Intergenic
1084482827 11:69431985-69432007 CTGAGCACCTGCTATGTGCTGGG - Intergenic
1084795283 11:71501164-71501186 CAGAGTCCCCACCAGATGCTGGG - Intronic
1084993540 11:72952747-72952769 CAGAACACCTACTATGTGCCAGG + Intronic
1085045455 11:73350268-73350290 CTGAGTGCCCACTATGTGCCAGG + Intronic
1085151619 11:74256938-74256960 CCGAGCACCCAATATGTGCCAGG + Intronic
1085273837 11:75285714-75285736 CAGAGCACCCCCTTTGTGCCAGG - Intronic
1085311490 11:75519547-75519569 CTGAGTGCTCATTATGTGCTGGG + Intronic
1085341674 11:75735459-75735481 CTGAGGACCTACTATGTGCTAGG + Intergenic
1085432389 11:76464155-76464177 CTGAGTGCTTACTATGTGCTTGG + Intronic
1085538093 11:77238723-77238745 CAGTGAAGCCACTATGTCCTGGG - Intronic
1085732626 11:79012417-79012439 CTGAGTACCTACCATGTGCCAGG + Intronic
1086185738 11:84013323-84013345 CCTAGTACCTACTATGGGCTAGG + Intronic
1086379671 11:86239083-86239105 TAAAGTACCTGCTATGTGCTAGG - Intergenic
1087006029 11:93472719-93472741 CAGTGTAACAACTATGTGCCAGG - Intergenic
1087139795 11:94754126-94754148 TAGAGTGCCAAATATGTGCTGGG - Intronic
1087287210 11:96277868-96277890 TAGAGCACCTACTATGTGCCAGG - Intronic
1087508367 11:99057632-99057654 TAGAGTGCCTACTTTGTGCTAGG + Intronic
1087543566 11:99552625-99552647 CAGAGGACACAGTATGTGCTTGG + Intronic
1087587263 11:100138315-100138337 TGGAGTACCTACTATGTACTAGG + Intronic
1088073114 11:105813753-105813775 CTGAGTGCCTAATATGTGCTTGG + Intronic
1088262379 11:107956297-107956319 CTGAATGCCCACTATGTGCTAGG + Intronic
1088422999 11:109669395-109669417 CTGAGTGCTCACTCTGTGCTGGG - Intergenic
1089171526 11:116515022-116515044 CAGAGGGCCTGCTATGTGCTTGG - Intergenic
1089206280 11:116766227-116766249 CAGAGTAGCAACTATGTGCAAGG + Intronic
1089321721 11:117631001-117631023 TTGAGTGCCCACTATGTGCCAGG - Intronic
1089388229 11:118081785-118081807 CTGAGCATCTACTATGTGCTAGG + Intronic
1089392010 11:118108623-118108645 CTGAGTACCTACTGTGTGCTGGG - Intronic
1089399936 11:118158570-118158592 CTGAGTACCTACTCTGTGCCTGG - Intergenic
1089550070 11:119267723-119267745 TTGAGTGCCTACTATGTGCTAGG - Intronic
1089731614 11:120522894-120522916 CAGAGTGCCTCCTATGTGCCAGG + Intronic
1089794587 11:120970043-120970065 CTGAGTAACTACTATGTGCCTGG - Intronic
1089870466 11:121668235-121668257 CTGAGTGCCAAGTATGTGCTAGG + Intergenic
1089909908 11:122087357-122087379 CTGAGCACCTACTACGTGCTGGG - Intergenic
1089924685 11:122245212-122245234 CTCAGTACCAACTATGTACTAGG - Intergenic
1090248304 11:125233510-125233532 CAGAGTGCCCAGCCTGTGCTGGG - Intronic
1090278673 11:125437585-125437607 CCGGGTGCCCACTATGTGCCTGG + Intergenic
1090393177 11:126402693-126402715 CTGAGTACTCACTGTGTGTTAGG + Intronic
1090421184 11:126576050-126576072 CTGAGTGCCTACTATGTGCCTGG - Intronic
1090805744 11:130201086-130201108 CTGAGCACCTACTATGTGCCAGG - Intronic
1090903848 11:131056430-131056452 CTGAGTACCTACTATGTGCAGGG + Intergenic
1091155092 11:133364745-133364767 CAGAGTTCTCACTAAGTGCCAGG - Intronic
1091677560 12:2502280-2502302 CTGAGGACCTACTATGTGCGAGG + Intronic
1091731149 12:2881503-2881525 CTGAGTGCCTACTGTGTGCTAGG - Intronic
1091822737 12:3488792-3488814 CAAAGTACCTACTATGTGCTAGG + Intronic
1091878532 12:3957717-3957739 ATGAGTAACCACTATGTGCCAGG - Intergenic
1092034214 12:5316917-5316939 TAGAGAACCTACTGTGTGCTGGG - Intergenic
1092104414 12:5911235-5911257 CTGAGCACCTACTAGGTGCTGGG - Intronic
1092319037 12:7451885-7451907 CACGGTGCTCACTATGTGCTAGG - Intronic
1092365325 12:7872602-7872624 CTGAGCACCTACTATGTCCTGGG - Intronic
1092893346 12:12990090-12990112 GAGAGTAGCAACTATTTGCTTGG - Intronic
1092896076 12:13011561-13011583 CAGAGCACTTACTATGTGCCAGG - Intergenic
1092970464 12:13689346-13689368 CTGAGTGCCTACTATGTGCCAGG - Intronic
1093314666 12:17633338-17633360 CAGAGTACCTACTAGGTGATAGG - Intergenic
1093390432 12:18612432-18612454 CTGAGTACCTACTATATACTTGG - Intronic
1093501059 12:19812922-19812944 TGGAGTACCTACAATGTGCTAGG + Intergenic
1093685622 12:22050393-22050415 CAGATTACATACTATGTGCCAGG - Intronic
1093731622 12:22571877-22571899 CAAAGTACCCACAATGTGGGTGG + Intergenic
1094214794 12:27929452-27929474 CTGATCACTCACTATGTGCTAGG + Intergenic
1094318504 12:29158974-29158996 CTGAGTACCTACTATGTGCCAGG + Intronic
1094627527 12:32138139-32138161 CACAATACCCAGTATGTGGTAGG - Intronic
1095535179 12:43237694-43237716 TTGAGTACCTATTATGTGCTAGG + Intergenic
1095573809 12:43711763-43711785 TTGAGTACCTACTATGTGCCAGG + Intergenic
1095750975 12:45711002-45711024 CAGAGTACCTACCCTGTGCCAGG - Intergenic
1095787407 12:46124836-46124858 TAGAGTACCTACGATGTGGTAGG + Intergenic
1095876620 12:47086007-47086029 CTGAGCGCCCACTGTGTGCTAGG + Intronic
1095956040 12:47806769-47806791 GGGAGCACCCACCATGTGCTGGG - Intronic
1096034768 12:48457116-48457138 TGGATTACCCACGATGTGCTGGG - Intergenic
1096226733 12:49870834-49870856 CTGAGCACCTGCTATGTGCTAGG + Intronic
1096545787 12:52339317-52339339 CTGAGCACCCACTATATGCCAGG - Intergenic
1096841446 12:54382021-54382043 TTGAGCACCTACTATGTGCTGGG - Intronic
1096968145 12:55645029-55645051 CTGAATACCTACTATGTGCCAGG + Intergenic
1097306111 12:58071000-58071022 TTGAGTACCCACTATGTTCCTGG - Intergenic
1097630668 12:62058429-62058451 TAGAGTGCTCACTATGTGCTGGG + Intronic
1097636636 12:62130612-62130634 CTGAGTACCTACTATGTGGCAGG + Intronic
1097930153 12:65174691-65174713 CAGAGTGTCTACTATGTGCCCGG + Intronic
1098198248 12:68025294-68025316 GAGAGCACCTACTATGTGCTGGG + Intergenic
1098280127 12:68854296-68854318 TTCAGTACCTACTATGTGCTAGG + Exonic
1099168254 12:79334086-79334108 CTGAGTATACGCTATGTGCTAGG + Intronic
1099219951 12:79901707-79901729 CTGAGAACTCACTATGTGCCAGG + Intronic
1099346173 12:81502630-81502652 TCAAGTACCCACTATGTGCTAGG + Intronic
1099468431 12:83016599-83016621 GAGAGTACCTACTATATGCCTGG - Intronic
1099945922 12:89244272-89244294 TAGAGCACCCACTATGTGCCAGG - Intergenic
1100347878 12:93749931-93749953 CTGAGTACCTACTATGTACAAGG - Intronic
1100392350 12:94154873-94154895 CATAGTACCCAGTATGTAGTTGG + Intronic
1100437869 12:94588389-94588411 CAGAGTAGCCACAATGTGTAGGG + Intronic
1100442270 12:94627925-94627947 TTGAGCACCTACTATGTGCTAGG - Intronic
1101337710 12:103811093-103811115 CTGAGTACCTACTTTGTGCCAGG + Intronic
1101421230 12:104552881-104552903 TTGAGTACCTACTATGTGCTAGG - Intronic
1101446694 12:104742053-104742075 CTGAGTGCCTACTATGTGCCAGG + Intronic
1101591908 12:106132364-106132386 TTGAGGACCTACTATGTGCTTGG + Intronic
1101627687 12:106461641-106461663 CTGAATACCCACTATGTGCCAGG - Intronic
1101721359 12:107353217-107353239 GGGAGTACCCACTAAGTGCCTGG + Intronic
1101735183 12:107458191-107458213 CTGAGTGCCTACTGTGTGCTAGG + Intronic
1101746425 12:107544961-107544983 TTGAGCACCTACTATGTGCTGGG - Intronic
1101840566 12:108324819-108324841 CTGAGCACCCACAATGTGGTGGG + Intronic
1102046018 12:109830858-109830880 CTGAGCACCTACTATGTGCCAGG + Intronic
1102072674 12:110034843-110034865 CAGAGTACCTTCTTTGTGCCAGG + Intronic
1102139410 12:110602264-110602286 CTGAGCACCTACTATGTGCCCGG - Intergenic
1102151989 12:110694984-110695006 CTGAGTGCCAACTATGTGCTAGG + Intronic
1102157819 12:110744455-110744477 TGGAGTACCCACTCTGTGCCAGG + Intergenic
1102250000 12:111380346-111380368 CTGAGCACCTACTGTGTGCTAGG - Intergenic
1102387054 12:112518962-112518984 CTGAGCACCCACTATGTGCCAGG - Intergenic
1102407768 12:112688632-112688654 CTTAGTACCTACTAAGTGCTTGG + Intronic
1102455589 12:113069106-113069128 CAGAGGGCCTACTATGTGCCAGG - Intronic
1102528881 12:113531791-113531813 CACAGCACCCACTGTGTGCTGGG + Intergenic
1102545653 12:113653349-113653371 CAGAGCAGCAACTATTTGCTAGG - Intergenic
1102552712 12:113703199-113703221 CTGAGCACCCACGATGTGCTAGG + Intergenic
1102773758 12:115501239-115501261 TTGAGTACTTACTATGTGCTGGG + Intergenic
1102884387 12:116510564-116510586 CTGAGCACCTACTATGTGCCAGG - Intergenic
1103099973 12:118164961-118164983 TTGAGCACCTACTATGTGCTGGG + Intronic
1103175964 12:118863354-118863376 CAGAGCACCTACTATGTGGCAGG - Intergenic
1103185830 12:118956308-118956330 CAGAGTTCCCAGAATTTGCTTGG + Intergenic
1103361509 12:120357152-120357174 TGGAGCACTCACTATGTGCTGGG + Intronic
1103582459 12:121925429-121925451 CTGAGTACTCACTATGTCTTAGG - Intronic
1103754741 12:123195657-123195679 TGGAATACCCACTAGGTGCTAGG + Intronic
1103901322 12:124304905-124304927 CTGAGCACCTACTGTGTGCTGGG - Intronic
1103906818 12:124332067-124332089 CTGGGCACCTACTATGTGCTGGG + Intronic
1104010420 12:124926235-124926257 CTGAGTACCTATTATGTGCCAGG - Intergenic
1104066228 12:125309487-125309509 CTGAGCACCTACTATGTGCCAGG + Intronic
1104390844 12:128389568-128389590 CTGAGCACCTACTATGTGCCAGG - Intronic
1104640560 12:130464372-130464394 CTGAATACCTACTATGTGCCAGG + Intronic
1104640572 12:130464468-130464490 CTGAATACCTACTATGTGCCAGG + Intronic
1104640584 12:130464566-130464588 CTGAATACCTACTATGTGCTTGG + Intronic
1105291738 13:19057850-19057872 CTGTGTGCCCACTGTGTGCTGGG - Intergenic
1105960648 13:25333243-25333265 ATGAGTGCCTACTATGTGCTGGG + Intronic
1106234718 13:27852236-27852258 CTGAGCACCCACTATGTGTATGG + Intergenic
1106317462 13:28607359-28607381 CTGAGAACCCAGTATGTGCTAGG + Intergenic
1106359331 13:29015450-29015472 CAGAGTACTCATTCTGTGCCAGG + Intronic
1106375457 13:29182553-29182575 CTGAGAACCTACTATGTGCTAGG + Intronic
1106401370 13:29434479-29434501 CTGAGTGCCTACTATGTGCCTGG - Intronic
1106457349 13:29938679-29938701 CTGAGTGCTCACTATGTGCCAGG + Intergenic
1106569255 13:30912047-30912069 CTGAGTACCTACTGTGTGCTGGG - Intronic
1106785733 13:33106455-33106477 CTGAGTACCTACTATGTGTCAGG + Intronic
1106884196 13:34165753-34165775 CTGAGAACCTACCATGTGCTAGG + Intergenic
1107137832 13:36963917-36963939 CTGGGTACCTACTATGTGCTGGG + Intronic
1107657767 13:42609586-42609608 TTGAGTACCATCTATGTGCTAGG + Intergenic
1107827291 13:44339844-44339866 CCGAGTACGTACTCTGTGCTGGG - Intergenic
1107899286 13:44996010-44996032 CTGAGTACCCACTTTGTGCTGGG - Intronic
1107957549 13:45531299-45531321 CTGAGTACCCAGTATGTATTAGG + Intronic
1108285526 13:48904372-48904394 CTGGGCACCTACTATGTGCTAGG - Intergenic
1108697497 13:52915463-52915485 CAGAGAAACAGCTATGTGCTGGG + Intergenic
1110170731 13:72497362-72497384 CTGAGCACCTACTATGTGCCAGG + Intergenic
1110617131 13:77553751-77553773 CTGAGCACCTACTGTGTGCTGGG + Intronic
1110795344 13:79630598-79630620 CTGAGTACCCACTGTGTGTCCGG - Intergenic
1111871438 13:93838119-93838141 CTGAGCACCTACTATGTGCCAGG + Intronic
1111897244 13:94156986-94157008 CTGATTACCCACTATGCGCGAGG + Intronic
1112038318 13:95518208-95518230 CTGAGTGCTAACTATGTGCTAGG - Intronic
1112133124 13:96545964-96545986 TTGAGTGCCCACTATGTGCCAGG - Intronic
1112158651 13:96845908-96845930 GAGAGTACCTACTACGTGCCAGG - Intergenic
1112644180 13:101310719-101310741 TTGAGGACCCACTATGTGCTAGG - Intronic
1113490732 13:110689727-110689749 TGGAGTACCAGCTATGTGCTAGG - Intronic
1113982176 13:114285369-114285391 ATGAGTATCCACTGTGTGCTAGG + Intronic
1114126005 14:19726603-19726625 CAGAGAAGCCACCATGTCCTGGG + Intronic
1114649808 14:24277389-24277411 CAGAGCACCCATTCTCTGCTGGG - Intergenic
1114878631 14:26755603-26755625 TAGAGTACCTACTGTGTTCTAGG - Intergenic
1114955817 14:27818052-27818074 TAGAGTACCCACAGTGTGCAAGG + Intergenic
1115104899 14:29748697-29748719 CTGAATACCTATTATGTGCTTGG - Intronic
1115126749 14:30004181-30004203 CTGAGTACCCACTAAGTGCCAGG + Intronic
1115147538 14:30242546-30242568 TGGAGTACCCATAATGTGCTAGG - Intergenic
1115242332 14:31261913-31261935 CTGGGCACCCACTGTGTGCTGGG - Intergenic
1115357878 14:32468203-32468225 CAGAGTACCTACTGTGTTCAAGG - Intronic
1115417184 14:33149634-33149656 CAAGGTACCCACTATATGTTAGG - Intronic
1115795657 14:36932510-36932532 TTGAGTGCCTACTATGTGCTGGG + Intronic
1115900592 14:38143102-38143124 CTGAGCACCCATTATATGCTGGG + Intergenic
1115993550 14:39173412-39173434 CTGAGGGCCCACTATGTGCCAGG - Intergenic
1116065424 14:39975838-39975860 CAGAGTACCTATTGTGTACTGGG - Intergenic
1116431583 14:44852089-44852111 CTGAGAACCCACTGTGTTCTAGG + Intergenic
1116999162 14:51354758-51354780 CTGAGTGCTCACTATGTGCCAGG + Intergenic
1117045275 14:51807108-51807130 TGGAGTACCAAGTATGTGCTAGG - Intergenic
1117284679 14:54275666-54275688 TTGAGTGCCTACTATGTGCTGGG + Intergenic
1117625555 14:57634117-57634139 CTGAGCACCCACCATGTGCTAGG + Intronic
1117832542 14:59766928-59766950 CTGAGCACCTACTATGTGGTAGG + Intronic
1117961985 14:61172365-61172387 CTGAGTGCCCACTATGTACCAGG + Intergenic
1118136786 14:63037384-63037406 TTGAGTACCTACTATGTGCTAGG - Intronic
1118287903 14:64493740-64493762 CAGAGTAACTGCCATGTGCTAGG + Intronic
1118302377 14:64627061-64627083 CTGAGTGCCTACTATATGCTGGG + Intergenic
1118360481 14:65052634-65052656 CAGAATACCCAGTTTTTGCTAGG + Intronic
1118784717 14:69036824-69036846 CCGAGTGCCCACTGTGTGCCTGG + Intergenic
1118975874 14:70676209-70676231 CTGAGTACCTACAATGTGCCAGG - Intergenic
1119078350 14:71667469-71667491 CTGAGTACCTACTATGTGCTAGG - Intronic
1119570665 14:75668445-75668467 CTGAGTCCCTACTATGTGCCAGG - Intronic
1119666530 14:76488989-76489011 CAGAGCACCTACTAAGTGCCAGG - Intronic
1119709308 14:76809814-76809836 CAAAGTATTCACTATGTGCCAGG + Intronic
1119827090 14:77666173-77666195 CTGAGTAACTACTATGTGCCAGG + Intergenic
1120851416 14:89175536-89175558 CAGAATGCTGACTATGTGCTGGG + Intronic
1120931503 14:89853381-89853403 TTGAGTACCTACTATGTGCCAGG + Intronic
1121116774 14:91349174-91349196 CCAAGTACCTACTATGTGCTGGG + Intronic
1121309081 14:92925206-92925228 CTGAGGACCTATTATGTGCTAGG - Intronic
1121383224 14:93492896-93492918 CTGAGTATCCACCATGTACTGGG + Intronic
1121490206 14:94352984-94353006 TTGAGCACCTACTATGTGCTTGG + Intergenic
1121721347 14:96110894-96110916 CTGAGTGCCTACTACGTGCTGGG + Intergenic
1121955946 14:98213122-98213144 CATTGTACCCAGTAAGTGCTCGG + Intergenic
1122005912 14:98703437-98703459 CTGAGTACCTACTGTATGCTTGG - Intergenic
1122071447 14:99208011-99208033 CAAAGCACCCGCTCTGTGCTGGG - Intronic
1122156580 14:99753699-99753721 CTGAGCACCTACTATGTGCCAGG - Intronic
1122239858 14:100355968-100355990 CTGAGAACTCACTGTGTGCTCGG + Intronic
1122256958 14:100485423-100485445 CACAGTGCCAACTATGTGCCAGG - Intronic
1122750911 14:103932277-103932299 CCAAGTATCCACTATGTGCCAGG - Intronic
1122848842 14:104515778-104515800 CTGAATGCCCACTATGTGCCAGG + Intronic
1123189145 14:106551283-106551305 CAGAGTACCCACTGGGCACTAGG + Intergenic
1123569242 15:21585902-21585924 CAGAGAAGCCACCATGTCCTGGG + Intergenic
1123605352 15:22021223-22021245 CAGAGAAGCCACCATGTCCTGGG + Intergenic
1123805072 15:23862242-23862264 CAGAGGAACCAGAATGTGCTGGG - Intergenic
1123999357 15:25741812-25741834 TTGAGTACCCACTATGTGTCAGG - Intronic
1124491017 15:30155576-30155598 CTGAGTGCCCACTGTGTGCTTGG - Intergenic
1124752520 15:32382755-32382777 CTGAGTGCCCACTGTGTGCTTGG + Intergenic
1124851645 15:33345244-33345266 TTGAGTAGCCACTATGTGCCAGG + Intronic
1124997227 15:34735607-34735629 CAGTGTACCTACTGTGTGCCAGG - Intergenic
1125115810 15:36090242-36090264 TAGAGGGCCTACTATGTGCTAGG - Intergenic
1125350452 15:38761709-38761731 CTGAGCACCCACTATGTGTCAGG + Intergenic
1125790513 15:42362010-42362032 CTGAGTACCCACTATGGGACTGG - Intronic
1125889405 15:43254368-43254390 CAGAGTTCCTGCAATGTGCTGGG - Intronic
1125956792 15:43796018-43796040 TTGAGTACCCACAATGTGCTAGG - Intronic
1126324821 15:47465104-47465126 TCGAGTACCTACTATGTTCTAGG - Intronic
1126366080 15:47895969-47895991 CAGAGAACTCACTCTTTGCTGGG - Intergenic
1126830249 15:52595330-52595352 TTGAGTACTTACTATGTGCTAGG - Intronic
1127051518 15:55088975-55088997 TTGAGTGCCTACTATGTGCTAGG - Intergenic
1127141692 15:55984454-55984476 CTGAATACCCACTCTGTGCCAGG - Intronic
1127201406 15:56656711-56656733 CTGAGTGCCTACTATGTGCCAGG + Intronic
1127635003 15:60860776-60860798 CTGGGCACCCACTGTGTGCTAGG + Intronic
1127673466 15:61217674-61217696 CTGAGTACTTTCTATGTGCTAGG - Intronic
1127934802 15:63626844-63626866 CTGAGTACCTTCTATGTGCCTGG + Intronic
1127938936 15:63673529-63673551 TTGAGTACCTACTATGTGTTGGG - Intronic
1128060898 15:64735344-64735366 GGGAGTACCTACTATGTGTTAGG + Intergenic
1128173057 15:65530159-65530181 CTGAGTACCTACTGTGTGCCTGG - Intergenic
1128206768 15:65859479-65859501 TTGAGTACCTACTATGTGCTGGG - Intronic
1128317511 15:66670381-66670403 CCGAGTCCCTACTATGTGCCAGG + Intronic
1128427697 15:67558908-67558930 AAAAGTACCCACTATGTGGTGGG - Intronic
1128453081 15:67818400-67818422 CTGAGTACCTACTAAGTGCCAGG + Intergenic
1128652649 15:69430376-69430398 TTGAGTACCTACTATGTGCCAGG + Intronic
1128674960 15:69601898-69601920 CTGAGTACTTACTATGTGCCAGG - Intergenic
1128689318 15:69711270-69711292 CTGAGCACCTACTATGTGCTAGG - Intergenic
1128702529 15:69814595-69814617 TAGAGCACCTACTGTGTGCTGGG - Intergenic
1128810901 15:70571943-70571965 TTGAGTATCTACTATGTGCTAGG - Intergenic
1128897429 15:71388291-71388313 TGGAGTACCCACTAGGTGCCAGG + Intronic
1128971553 15:72111554-72111576 CTGAGTACCTACTATATGCTTGG + Intronic
1129128813 15:73471459-73471481 CAAAGTACCTACCCTGTGCTAGG - Intronic
1129545736 15:76393010-76393032 ATGAGTGCTCACTATGTGCTAGG - Intronic
1129640492 15:77371953-77371975 TAAAGTACCCATTATGTGCTAGG - Intronic
1129698790 15:77755710-77755732 CTGGGCACCTACTATGTGCTGGG + Intronic
1129709462 15:77813115-77813137 CTGTGTACCCACTATATGCAAGG - Intronic
1129888550 15:79055890-79055912 CTGAGTACCTACTGTGTGCCAGG + Intronic
1129932580 15:79424641-79424663 CTGAGCACCTATTATGTGCTGGG + Intronic
1129941127 15:79497325-79497347 TAAAGCACCGACTATGTGCTAGG + Intergenic
1130041573 15:80409550-80409572 CTGAGTAACTACTATGTGCCGGG + Intronic
1130042635 15:80418027-80418049 CAGAGCACCTACTGTGTGCCAGG - Intronic
1130127639 15:81107214-81107236 CCGAGTACTCACTGTGTCCTAGG + Intronic
1130151310 15:81313701-81313723 CAGAGAACTCACTTTGTGCCAGG + Intronic
1130179615 15:81611874-81611896 CTGAGCACCTACTATGTGCAAGG - Intergenic
1131546622 15:93321157-93321179 CAGAGGACGCACTAGGTGCCTGG + Intergenic
1131641229 15:94296064-94296086 CAGAGGACCCACAATGTGACAGG - Intronic
1131737951 15:95354270-95354292 TTGATTACCTACTATGTGCTAGG - Intergenic
1131808610 15:96148950-96148972 TTGAGTACCCACTACTTGCTAGG + Intergenic
1132425867 15:101716564-101716586 CAGAGGAACCAATATTTGCTAGG + Intronic
1132439947 15:101851271-101851293 CAGAGTACATACTATATGTTAGG + Intergenic
1202977595 15_KI270727v1_random:312995-313017 CAGAGAAGCCACCATGTCCTGGG + Intergenic
1132917786 16:2362777-2362799 TTGAGCACCTACTATGTGCTAGG - Intergenic
1133385876 16:5370045-5370067 TTGAGCACCTACTATGTGCTGGG + Intergenic
1133686883 16:8173781-8173803 CTGAGTACCAATTATGTGCCTGG + Intergenic
1133826065 16:9279298-9279320 CTGAGTATCTACTATGTGCCGGG - Intergenic
1133842547 16:9423104-9423126 TTGAGTGCCTACTATGTGCTAGG - Intergenic
1133924227 16:10181051-10181073 CAGAGTACACCCCAAGTGCTTGG + Intronic
1134080983 16:11324848-11324870 CTGAGCCCCTACTATGTGCTTGG + Intronic
1134094458 16:11410562-11410584 CAGAGCATGCGCTATGTGCTGGG - Intronic
1134095174 16:11414255-11414277 CAGAGGACCCGCTGTGTGCAGGG - Intronic
1134122849 16:11596871-11596893 CTGAGTACCCACTGGGTGCCAGG + Intronic
1134298214 16:12965806-12965828 CTGAGCACTGACTATGTGCTGGG - Intronic
1134309675 16:13064262-13064284 TTGAGCACCTACTATGTGCTAGG + Intronic
1134667889 16:16032751-16032773 CTGAGCACCTACTATGTGCTAGG - Intronic
1134687886 16:16171493-16171515 CACAATACCCACTATGTGCCAGG - Intronic
1134756306 16:16670524-16670546 TTGAGCACCTACTATGTGCTGGG - Intergenic
1134845392 16:17435663-17435685 CAAAGTTCCTACTATGTGCCAGG + Intronic
1134877186 16:17711519-17711541 CTGAGTATCAACTATGTGCTTGG + Intergenic
1134989764 16:18688640-18688662 TTGAGCACCTACTATGTGCTGGG + Intergenic
1135054743 16:19221635-19221657 TTGAGTATCTACTATGTGCTAGG + Intronic
1135185755 16:20314455-20314477 CTGAGTGCCCACTGTGTGCCAGG - Intronic
1135205708 16:20482202-20482224 TATAGTACTTACTATGTGCTAGG - Intronic
1135213206 16:20541607-20541629 TATAGTACTTACTATGTGCTAGG + Intronic
1135543415 16:23349647-23349669 CGGAGCACCTACTATGTGCCAGG + Intronic
1136048154 16:27631756-27631778 TTGAGTACCCACTATGTGCCAGG + Intronic
1136090395 16:27915545-27915567 CTGAGCACCTACTATGTGCTGGG + Intronic
1136427855 16:30181178-30181200 TTGAGTGCCTACTATGTGCTGGG - Intergenic
1136686456 16:31997418-31997440 CTGAGTATCCACTGTGTGCCAGG - Intergenic
1136721787 16:32325541-32325563 TTGAGTATCCACTAAGTGCTAGG + Intergenic
1136787067 16:32940947-32940969 CTGAGTATCCACTGTGTGCCAGG - Intergenic
1136840169 16:33531820-33531842 TTGAGTATCCACTAAGTGCTAGG + Intergenic
1136882707 16:33912842-33912864 CAGAGTATCCACTGTGTGCCAGG + Intergenic
1137234351 16:46601902-46601924 TTGAGTACCTACTATGTGCAGGG - Intronic
1137251056 16:46741225-46741247 TTGAGCACCCACTATGTGCTGGG - Intronic
1137404007 16:48176011-48176033 CTGAGCACCTACTATGTGCCTGG - Intronic
1137587909 16:49675224-49675246 CAGAGGACCCACTATATGCCAGG + Intronic
1137684019 16:50373493-50373515 CTGTGTGCCTACTATGTGCTGGG + Intergenic
1137730381 16:50685281-50685303 CTGAGCACCCACTATGTGGCAGG - Intergenic
1137737769 16:50737641-50737663 TTGAGCACCTACTATGTGCTAGG - Intergenic
1137905605 16:52318992-52319014 CTGAGTGCCTACTATGTGTTGGG + Intergenic
1138158729 16:54732123-54732145 CTGAGTAACTACTATGTGCCAGG - Intergenic
1138266662 16:55664609-55664631 CGGAGCACCCACTAAGTGCCTGG + Intronic
1138416436 16:56874175-56874197 CAGAGCACCTAGTATGTGCCAGG - Intronic
1138422965 16:56911868-56911890 CAGAGCACTCACTGTGTGCCAGG + Intronic
1138617891 16:58185921-58185943 CTGAGTGCTTACTATGTGCTGGG - Intronic
1138652954 16:58472204-58472226 CAGAGTATTCACTCTGTGCTTGG + Intronic
1138867424 16:60839842-60839864 TTGAATACCTACTATGTGCTAGG + Intergenic
1139255557 16:65538537-65538559 CTGAGTGCCTACTATGTGCCAGG + Intergenic
1139274062 16:65711060-65711082 CAGAGTGCTTACTATGTGCCAGG + Intergenic
1139318872 16:66096812-66096834 TAGAGTACCTACAGTGTGCTGGG - Intergenic
1139984356 16:70885357-70885379 CAGAATACCTACTATGTGCTAGG + Intronic
1139999039 16:71008426-71008448 TTGAGTACCCACCATGTGCCAGG - Intronic
1140028052 16:71309964-71309986 CAGAGTGCTCACTATGTGCCAGG + Intergenic
1140039139 16:71394035-71394057 CTGAGCACCTACTGTGTGCTTGG - Intergenic
1140248248 16:73270809-73270831 CATGGTACCCACTGCGTGCTGGG + Intergenic
1140774985 16:78241233-78241255 CGGAGCACTTACTATGTGCTGGG - Intronic
1140808862 16:78558021-78558043 CTGAGGGCCGACTATGTGCTTGG - Intronic
1140871524 16:79110994-79111016 CTGAGAACCTACTATGTGCAAGG - Intronic
1141194083 16:81846486-81846508 CAGAGCACCTACTCTGTGTTAGG - Intronic
1141232703 16:82184562-82184584 TAGAGTACTCACTATGTACCAGG - Intergenic
1141431747 16:83973723-83973745 CCGAGGACCTACTGTGTGCTGGG - Intronic
1141470908 16:84237682-84237704 TTGAGCACCTACTATGTGCTTGG + Intronic
1141597036 16:85103750-85103772 CTGAATACCCACTAGGTGCCAGG + Intronic
1141641770 16:85345804-85345826 CTGAGTACCAACTATGTGCTAGG - Intergenic
1141642634 16:85350137-85350159 CCGAGTACCTACTATGTGCCAGG - Intergenic
1141643329 16:85354401-85354423 CTGAGCACCTACTATGTGCCAGG - Intergenic
1141787362 16:86210697-86210719 CAGAGTGCCCGCTATGTTCCCGG - Intergenic
1142289393 16:89185832-89185854 CAGAGCACCTACTCTGTGCTGGG - Intronic
1142289396 16:89185865-89185887 CAGAGCACCTACTGTGCGCTGGG - Intronic
1142289404 16:89185959-89185981 CAGAGCACCTACTCTGCGCTGGG - Intronic
1142289408 16:89185992-89186014 CAGAGCACCTACTCTGCGCTGGG - Intronic
1142289411 16:89186025-89186047 CAGAGCACCTACTGTGCGCTGGG - Intronic
1142289417 16:89186086-89186108 CAGAGCACCTACTGTGCGCTGGG - Intronic
1142289421 16:89186119-89186141 CAGAGCACCTACTGTGCGCTGGG - Intronic
1142289424 16:89186152-89186174 CAGAGCACCTACTGTGTGCTGGG - Intronic
1142289427 16:89186185-89186207 CAGAGCACCTACTGTGCGCTGGG - Intronic
1142289430 16:89186214-89186236 CAGAGCACCTACTGTGCGCTGGG - Intronic
1142289436 16:89186280-89186302 CAGAGCACCTACTGTGCGCTGGG - Intronic
1142289439 16:89186313-89186335 CAGAGCACCTACTGTGCGCTGGG - Intronic
1142289447 16:89186379-89186401 CAGAGCACCTACTGTGCGCTGGG - Intronic
1142289450 16:89186412-89186434 CAGAGCACCTACTGTGCGCTGGG - Intronic
1142289460 16:89186478-89186500 CAGAGCACCTACTGTGCGCTGGG - Intronic
1142289463 16:89186511-89186533 CAGAGCACCTACTGTGCGCTGGG - Intronic
1142289466 16:89186544-89186566 CAGAGCACCTACTGTGCGCTGGG - Intronic
1142289469 16:89186573-89186595 CAGAGCACCTACTGTGCGCTGGG - Intronic
1142289472 16:89186606-89186628 CAGAGCACCTACTGTGCGCTGGG - Intronic
1142289475 16:89186639-89186661 CAGAGCACCTACTGTGCGCTGGG - Intronic
1142289478 16:89186672-89186694 CAGAGCACCTACTGTGCGCTGGG - Intronic
1142289481 16:89186701-89186723 CAGAGCACCTACTGTGCGCTGGG - Intronic
1142289496 16:89186866-89186888 CAGAGCACCTACTGTGCGCTGGG - Intronic
1142289499 16:89186895-89186917 CAGAGCACCTACTGTGTGCTGGG - Intronic
1142289502 16:89186928-89186950 CAGAGCACCTACTGTGTGCTGGG - Intronic
1142289505 16:89186961-89186983 CAGAGCACCTACTGTGTGCTGGG - Intronic
1142289508 16:89186994-89187016 CAGAGCACCTACTGTGCGCTGGG - Intronic
1142289520 16:89187093-89187115 CAGAGCACCTATTCTGTGCTGGG - Intronic
1142289526 16:89187159-89187181 CAGAGCACCTACTGTGCGCTGGG - Intronic
1142418227 16:89954616-89954638 CTGAGCACCTACTATGTGCTGGG - Intronic
1142455306 16:90217836-90217858 CAGAGCACCTACTATGTGCCAGG + Intergenic
1203004645 16_KI270728v1_random:192229-192251 TTGAGTATCCACTAAGTGCTAGG - Intergenic
1203089304 16_KI270728v1_random:1202617-1202639 CTGAGTATCCACTGTGTGCCAGG - Intergenic
1203136196 16_KI270728v1_random:1728348-1728370 TTGAGTATCCACTAAGTGCTAGG - Intergenic
1203150336 16_KI270728v1_random:1832110-1832132 TTGAGTATCCACTAAGTGCTAGG + Intergenic
1142782562 17:2192487-2192509 CAGAGAACCAACTATCTGCCTGG + Intronic
1142965814 17:3580352-3580374 CTGAGGTCCCACTATGTGCCAGG + Intronic
1143156679 17:4841804-4841826 CAGGGTGCCCAGTATATGCTGGG + Intronic
1143349928 17:6280434-6280456 TTGAGTACCTACTATGTGTTAGG - Intergenic
1143551944 17:7635698-7635720 CTGAGCACCCGCTATGTACTAGG + Intergenic
1144089063 17:11837291-11837313 ATGAGTACCTACTATGTGCCAGG + Intronic
1144181174 17:12753883-12753905 CTGAGCACCTACTATGTGCCAGG + Intronic
1144630543 17:16869956-16869978 CTGAGCGCCTACTATGTGCTAGG - Intergenic
1144773762 17:17773673-17773695 CTGGGTACCCTCTGTGTGCTGGG - Intronic
1145017231 17:19407292-19407314 CTGAGCACCTACTAAGTGCTGGG - Intergenic
1145250150 17:21293063-21293085 GTGAATACCTACTATGTGCTGGG - Intronic
1145795432 17:27652825-27652847 TTGAGCACCTACTATGTGCTAGG - Intergenic
1145809867 17:27758156-27758178 TTGAGCACCTACTATGTGCTAGG - Intronic
1145813555 17:27779909-27779931 CTGAGCACCTACTATGTGCCAGG + Intronic
1145857043 17:28169799-28169821 CAGAGTGCTTACTATGTGCCAGG - Intronic
1146043145 17:29476548-29476570 CAGAGCACCTCCTATGTGCCAGG - Intronic
1146380941 17:32326972-32326994 CTGTGTACCTACTATGTGCTAGG + Intronic
1146568466 17:33933393-33933415 CTGAGTATCCAGTATGTGCCAGG - Intronic
1146623746 17:34420346-34420368 CTAAGCACCTACTATGTGCTGGG - Intergenic
1147357859 17:39911647-39911669 CTCAGTACCTACTGTGTGCTTGG + Intronic
1147854383 17:43467810-43467832 CTGAGCACCCAGTATGTGCGAGG - Intergenic
1147900785 17:43782546-43782568 CTGAGCAACTACTATGTGCTAGG + Intronic
1148107472 17:45127115-45127137 CTGAGCACCCACTATGGGCCAGG - Intronic
1148336953 17:46848370-46848392 CTGAGTACCTACTATGTGCTGGG + Intronic
1148578315 17:48726608-48726630 CTGGGTACCCAGTATGTGCAGGG - Exonic
1148707864 17:49651685-49651707 TAGAGTACCCATTTTGTGATAGG + Intronic
1148777427 17:50103477-50103499 GAGAGTGCTCACTATGTGCTAGG + Intronic
1148825057 17:50386824-50386846 CAGAGCACCTACTATGTGCCAGG + Intronic
1148869184 17:50645923-50645945 CTGAGCACCTACTATGTGCTAGG + Intronic
1148921638 17:51040566-51040588 CTGAGTACCTATAATGTGCTAGG + Intronic
1149237187 17:54606191-54606213 CTGAGTGTCCACTAAGTGCTAGG - Intergenic
1149288918 17:55196695-55196717 CTGAGTACTTCCTATGTGCTAGG - Intergenic
1149402508 17:56312701-56312723 TAGGGCACCCACTATGTGCTAGG + Intronic
1149835982 17:59912999-59913021 CTGAGTACCTATTATGTGCCAGG - Intronic
1150279681 17:63922133-63922155 CTGCGTGTCCACTATGTGCTTGG + Intergenic
1150494836 17:65599362-65599384 CTGAACACCTACTATGTGCTGGG + Intronic
1150840558 17:68601729-68601751 CTGAGCACCTACTATGTGCCAGG - Intergenic
1151200133 17:72461849-72461871 CTGAGTGCCTACTAAGTGCTGGG - Intergenic
1151697591 17:75725765-75725787 CTGAGGACCCACTGTGTGCCAGG + Intronic
1151773457 17:76180502-76180524 CTGAGTATCTACTATGTGCCAGG + Intronic
1153794828 18:8611803-8611825 CAGAGTAGGGAGTATGTGCTCGG - Intronic
1154279993 18:12994073-12994095 CTGAGTACCTGCTGTGTGCTAGG + Intronic
1154307425 18:13240772-13240794 CTGAAGACCTACTATGTGCTAGG - Intronic
1154477387 18:14776218-14776240 CTGAGTACCAACTGTGTGCTAGG + Intronic
1154482009 18:14839103-14839125 TTGAGTACCAACTGTGTGCTAGG + Intronic
1154941246 18:21114613-21114635 CTGAGTGCTCACCATGTGCTAGG + Intergenic
1154951546 18:21215027-21215049 CAAAGTGCTTACTATGTGCTAGG - Intergenic
1155096127 18:22558275-22558297 TTGAGTACTTACTATGTGCTAGG + Intergenic
1155149956 18:23115322-23115344 CTGAGTACCCCCAATGTGCCAGG + Intergenic
1155150331 18:23117883-23117905 CTGAGTACCTACTATGTGCCAGG + Intergenic
1155528808 18:26744928-26744950 TTGAGCACCTACTATGTGCTGGG - Intergenic
1155608611 18:27636660-27636682 CAGAGTACCCTCAATTTGTTTGG + Intergenic
1155818900 18:30350476-30350498 TGAAGTACCTACTATGTGCTGGG + Intergenic
1156013852 18:32525950-32525972 CTGAGTATCTACCATGTGCTAGG - Intergenic
1156108353 18:33692703-33692725 CTGAGCACCTACTATGTGCTAGG - Intronic
1156834258 18:41533605-41533627 CTGAGTACTGACTATGTGCTGGG + Intergenic
1156869083 18:41923797-41923819 TTGAGTACCTACTATGTGCTAGG - Intergenic
1156976578 18:43228893-43228915 CAGAGTTTCCACTATGCTCTGGG + Intergenic
1157194220 18:45607449-45607471 CTGAGTACCAACTATGTGGTAGG - Intronic
1157293757 18:46427407-46427429 GAGAGTACCCACTCTGTCCAAGG - Intronic
1157539680 18:48491540-48491562 TTTAGTACCCACTATGTGCTAGG + Intergenic
1157743204 18:50111910-50111932 CTGAGTACCTACTATGTGCCAGG + Intronic
1157982445 18:52396943-52396965 TTGAGTACCCACTATATGCTTGG - Intronic
1158131015 18:54152740-54152762 GTGAGCACCCACTATGTGCCAGG + Exonic
1158432031 18:57397910-57397932 TAGAGCACCTACTATGTGCCAGG + Intergenic
1158483296 18:57841912-57841934 CAGAGCATCTATTATGTGCTGGG - Intergenic
1158667819 18:59448859-59448881 CAGAGTCACCACTGTGTGCCTGG + Intronic
1159531790 18:69664726-69664748 CTGACTACCCACAATGTGCCAGG + Intronic
1159737657 18:72121474-72121496 CAGTGTACCAACTATTTGCATGG - Intergenic
1160431021 18:78812586-78812608 CTGAGTGCCCACTATGTGTCAGG - Intergenic
1160564041 18:79775922-79775944 CTGAGTGCCCGCTCTGTGCTGGG - Intergenic
1160997262 19:1888539-1888561 CACAGCACCCACTATTTTCTGGG - Intergenic
1161286328 19:3470225-3470247 CGGAGCACCCACTCTGTGCCAGG + Intergenic
1161473188 19:4471506-4471528 CTGAGTACCTACTATATGCCAGG - Intergenic
1161625053 19:5321581-5321603 GTGAGTACCCACTGTGTGCCAGG + Intronic
1161881537 19:6957791-6957813 TTGAGTATCTACTATGTGCTAGG - Intergenic
1162306893 19:9880296-9880318 CTGAGCACCCACTATGTGCCAGG + Intronic
1162754501 19:12849190-12849212 TTGAGTACCTACTGTGTGCTGGG - Intronic
1163190150 19:15671407-15671429 AAGTGTACCTACTATGTGCTAGG - Intergenic
1163201613 19:15773843-15773865 CTGAGTATCTACTATGTGCTAGG + Intergenic
1163342745 19:16720176-16720198 CTGAGCACCTACTATGTGCCAGG + Exonic
1163601155 19:18249965-18249987 CTGAGCACCTACTATGTGCTGGG - Intronic
1163681088 19:18683169-18683191 CTGAGCACCTACTATGTGCCAGG - Intergenic
1164155394 19:22593311-22593333 TTGAGTACCTACTATGTGCAAGG + Intergenic
1164490305 19:28705514-28705536 TTGAGTACCTACTATGTGCAGGG - Intergenic
1164708279 19:30336318-30336340 CTGAGCACCTACTATGTGCCAGG - Intronic
1164729944 19:30496022-30496044 TAAAGTACCTACTATGTGCCAGG - Intronic
1164774947 19:30845540-30845562 CAGAGTACCTACTGGGTGTTAGG - Intergenic
1165065287 19:33225109-33225131 CTGAGTACCTACTGTGTGCAGGG - Intronic
1165315474 19:35052788-35052810 CTGAGAACCTACTATGTGCCAGG - Intronic
1165320880 19:35084471-35084493 CTGAACACCCACTAAGTGCTAGG + Intergenic
1165347260 19:35256661-35256683 CTGAGTACCACCTATGTTCTAGG - Intronic
1166351543 19:42201032-42201054 CAGAGTGCCGACTATCTGCCAGG + Intronic
1166374904 19:42322254-42322276 CTGAGAACCCATCATGTGCTGGG + Intronic
1166570780 19:43795612-43795634 CTGAGCACCTACTATGTGCAAGG - Intergenic
1166660766 19:44645883-44645905 TTGAGGACCTACTATGTGCTAGG + Intronic
1166889075 19:45979242-45979264 CTGAGCACCTACTATGTGTTGGG + Intergenic
1166942891 19:46377413-46377435 CAGAGCACTAACCATGTGCTAGG - Intronic
1166985217 19:46655753-46655775 CTGAGCACCCACTTTGTGCCAGG - Intronic
1167143498 19:47668203-47668225 CTGCGGGCCCACTATGTGCTGGG - Intronic
1167557412 19:50204959-50204981 AAGAGTACCTACTATGTGTCGGG - Intronic
1168144140 19:54410185-54410207 TTGAGAACCTACTATGTGCTAGG + Intergenic
1168473769 19:56661460-56661482 CTGAGGACCTACTGTGTGCTTGG + Intergenic
1168534405 19:57157062-57157084 CGGAGCATCTACTATGTGCTAGG - Intronic
1202713956 1_KI270714v1_random:32248-32270 CAGAGTGCTCACTACCTGCTGGG + Intergenic
925005027 2:436387-436409 CAGAGCTCCCACTGTGTGCGTGG + Intergenic
925005030 2:436411-436433 CAGAGCTCCCACTGTGTGCGAGG + Intergenic
925005075 2:436726-436748 TAGAGTTCCCACTGTGTGCGTGG + Intergenic
925005098 2:436972-436994 TAGAGTTCCCACTGTGTGCATGG + Intergenic
925005101 2:436996-437018 TAGAGTTCCCACTGTGTGCATGG + Intergenic
925005136 2:437348-437370 TAGAGTTCCCACTGTGTGCATGG + Intergenic
925076136 2:1017848-1017870 TAGAACACCCACTGTGTGCTCGG - Intronic
925153415 2:1632890-1632912 CTGAGTATCCACCATGTGCCAGG - Exonic
925444309 2:3914843-3914865 CAGAGTGCCTTCTGTGTGCTGGG - Intergenic
925811255 2:7702926-7702948 CAGAGTACCCAGTGGGTGCCAGG + Intergenic
925956183 2:8967734-8967756 CTGAATACCCATTATGTGTTTGG - Intronic
926038389 2:9653061-9653083 CAGAGCACCTACTATGTGCTGGG - Intergenic
926049446 2:9735109-9735131 CTGAGCACCCACTATGTACCAGG + Intergenic
926131195 2:10303932-10303954 CACAGTACCTACTGTGTGCGGGG - Intronic
926356492 2:12045494-12045516 TTGAGTACCCAGTATGTGCCAGG + Intergenic
926768551 2:16347278-16347300 CTGACTACCCACCATGTGCTAGG - Intergenic
927250669 2:20992608-20992630 CTGAGCACCTACTGTGTGCTGGG + Intergenic
927450820 2:23207805-23207827 CTGAGCACCTACTATGTGCCAGG - Intergenic
927859201 2:26549976-26549998 TAGAGTACCCATTCTGTGCCAGG + Intronic
928151636 2:28835571-28835593 TTGACTACCCACTATGTGCCAGG - Intronic
928425744 2:31176387-31176409 CTGAGCACCCACTTTGTGCCAGG - Intronic
928933614 2:36650616-36650638 CAGAGCACCTACTATGTGCCAGG + Intergenic
929239390 2:39638400-39638422 CTGAGTACTCATTATGTGCCAGG + Intergenic
929377243 2:41302851-41302873 GATATAACCCACTATGTGCTAGG - Intergenic
929569117 2:43008947-43008969 TTGAGTGCCTACTATGTGCTAGG + Intergenic
929743832 2:44634565-44634587 TTGAGTACCTACGATGTGCTAGG + Intronic
929755796 2:44763470-44763492 CTGAGTGCTTACTATGTGCTAGG + Intronic
929900039 2:45992895-45992917 TTGAGGACCTACTATGTGCTGGG - Intronic
930094903 2:47559664-47559686 CTGCATACCTACTATGTGCTGGG + Intronic
930339859 2:50098532-50098554 CAGACTACTCACTATGTGCCAGG + Intronic
930391813 2:50771006-50771028 GGGAGTATCCACTGTGTGCTAGG - Intronic
930914166 2:56667328-56667350 CAGAGAAGCCACTATCTGATGGG + Intergenic
931165433 2:59742077-59742099 CTGAGTTCCTACTATGTGCATGG + Intergenic
931186350 2:59955114-59955136 CTGAGTGCCCACTATGTTCCAGG - Intergenic
931320875 2:61174065-61174087 CTTGGTGCCCACTATGTGCTGGG + Intergenic
931859791 2:66342716-66342738 CTGAGTACCTACTATGTGCTAGG - Intergenic
931923785 2:67048776-67048798 TAGAGGACTCACTATGTGCCAGG - Intergenic
931961612 2:67489123-67489145 TTGAGCACCTACTATGTGCTAGG - Intergenic
932282384 2:70505047-70505069 TAGAGTACTCCCTATATGCTGGG - Intronic
932399472 2:71469955-71469977 CTGAGTACCTACTACGTGCCTGG + Intronic
932475530 2:72003538-72003560 TAGAGTGCCCACTATATGATGGG + Intergenic
932547454 2:72729036-72729058 TCGAGTACCTACTATGCGCTAGG - Intronic
932739603 2:74281619-74281641 CACAGTCCCCATTATGTGCATGG + Intronic
933575214 2:84059392-84059414 CAGAGTTCCTATTATGTGCCAGG - Intergenic
933856627 2:86420380-86420402 CCGAACACCTACTATGTGCTTGG - Intergenic
934919645 2:98332456-98332478 CTGAGCACCTATTATGTGCTTGG - Intronic
935093911 2:99925513-99925535 CTGAGTGCCGACTATGTGCCAGG - Intronic
935502947 2:103864335-103864357 CATAGTGCCCAATATGTGTTTGG + Intergenic
935626511 2:105176242-105176264 CTGAGTACCCACTCTGTGCCTGG + Intergenic
936227205 2:110666957-110666979 CAGAGGACTCATTTTGTGCTGGG - Intronic
936257838 2:110932728-110932750 CATAGGTCCCACTTTGTGCTGGG + Intronic
937000786 2:118465446-118465468 TTTAGTACCTACTATGTGCTAGG - Intergenic
937078161 2:119122082-119122104 CAGAGTGCCCACCTTGTGCAGGG + Intergenic
937259150 2:120574363-120574385 CCGAGTGCCCACTGTGTGCCAGG + Intergenic
937269390 2:120638502-120638524 CAGTGCACCTACTATGAGCTGGG + Intergenic
937565118 2:123276002-123276024 CAGAGTCCTCACTATGGGATTGG + Intergenic
937644936 2:124255859-124255881 TTGAGTACCTACTATGTGCCTGG - Intronic
937706967 2:124932106-124932128 CATAGTTCCCACTATGGGCCAGG + Intergenic
938188244 2:129252418-129252440 CAGAGCACCTACTATGTGCGAGG - Intergenic
938558246 2:132446251-132446273 GTGAGCACCCACTATGTGCCAGG + Intronic
939639848 2:144627318-144627340 CTGAGTACCAACTGGGTGCTGGG + Intergenic
940164932 2:150760602-150760624 CTGAGTATCCATTTTGTGCTAGG + Intergenic
940324181 2:152407868-152407890 CTGAGTACCTACTGTGTGCCAGG - Intronic
940522230 2:154765503-154765525 CTGAGTGCCAACTATGTGCAAGG - Intronic
940538092 2:154972174-154972196 CTGAGCACCCACTATGTGGCAGG + Intergenic
940749059 2:157603357-157603379 CTGACTGCCCACTATGTGCATGG + Intronic
940760150 2:157729799-157729821 TTGAGCACCTACTATGTGCTTGG - Intergenic
940971276 2:159899620-159899642 CAGAGGCCTCACTATGTACTTGG - Intronic
940994344 2:160131555-160131577 TGGAGTACCTACTATGTGCCTGG - Intronic
941137050 2:161731126-161731148 CAGAATACCTACCATGTGCCAGG - Intronic
941695207 2:168544043-168544065 CTGAGTACCCACAGTGTGCCAGG + Intronic
941921745 2:170857804-170857826 CTGAGTACCCACTGTGTGCCAGG + Intronic
942125149 2:172817113-172817135 CAGAGTATCTCCTATGTGTTAGG + Intronic
942255298 2:174091083-174091105 TTGAGCACCCACTATGTGCCAGG - Intronic
942399285 2:175584294-175584316 CAGAGCACCTACTATGTGCAGGG - Intergenic
942473678 2:176291394-176291416 CTGATTACCTGCTATGTGCTAGG + Intronic
942981405 2:182087590-182087612 CTGAGTACCTACTGTGTGCCAGG - Intronic
943046890 2:182870404-182870426 CATAGTCCCAACTAGGTGCTAGG - Intergenic
943078807 2:183231725-183231747 CAGAGCATCTACTATGTTCTAGG - Intergenic
944174110 2:196810791-196810813 CAAAGTGCCTACTATGTGCCAGG + Intergenic
944924997 2:204455419-204455441 CTGAGAGCCCACTATGTGCTGGG - Intergenic
945112225 2:206370873-206370895 CTGAGAACCTACCATGTGCTAGG + Intergenic
945786688 2:214248254-214248276 CTGAATACCTGCTATGTGCTGGG + Intronic
945871449 2:215231167-215231189 CTGAGGACCTACTGTGTGCTAGG - Intergenic
945916469 2:215709729-215709751 TTGAGAACTCACTATGTGCTGGG - Intergenic
946033501 2:216723767-216723789 CTGAGTACCTACTATGTGCCAGG + Intergenic
946132544 2:217618064-217618086 CTGAGTACCTACTATGTGCCAGG + Intronic
946252255 2:218420897-218420919 TTGAGCACCTACTATGTGCTAGG + Intronic
946270813 2:218591940-218591962 CAGAGTACCTACTATGTGCCCGG - Intronic
946835156 2:223765106-223765128 CTGAGTACTTACTCTGTGCTGGG - Intronic
946845819 2:223858138-223858160 TTAAGTACCTACTATGTGCTAGG + Intronic
947018656 2:225649443-225649465 CAGAGTATCCACTGTGTTCTGGG - Intronic
947333843 2:229059393-229059415 CTGAATACCTATTATGTGCTAGG + Intronic
947339079 2:229118081-229118103 TTGAGTACTTACTATGTGCTAGG - Intronic
947803627 2:232949259-232949281 CAGAGTGCCCACTATGATCCAGG - Intronic
947813479 2:233020548-233020570 CAGAGCACCCACTGTGTGCTGGG + Intergenic
948417836 2:237828000-237828022 CTGAGCACCTACTATGTGCCAGG - Intronic
949086787 2:242162562-242162584 CAGAGCACCTACTATGTGCCAGG + Intergenic
1168796452 20:612912-612934 CTGAGCACCTGCTATGTGCTAGG + Intergenic
1168887222 20:1267966-1267988 CTGAGAACCTACTATGTGCCAGG - Intronic
1168978796 20:1987858-1987880 CAAAGCACCTACTATGTGCCAGG - Intronic
1168980689 20:2001265-2001287 CTGAGTACCTACTATGTTCTGGG + Intergenic
1168982617 20:2020841-2020863 CAGAGCACCTACTATATGTTGGG - Intergenic
1169033296 20:2430052-2430074 TTGAGCACCTACTATGTGCTAGG - Intronic
1169169973 20:3457190-3457212 CGGAGCACCTACTATGTGCCAGG + Intergenic
1169510267 20:6256257-6256279 CTGAGCACCTACTATGTGCCAGG - Intergenic
1169611953 20:7391312-7391334 CTGAGTATCCACAATGTCCTAGG + Intergenic
1170261779 20:14416694-14416716 TTGAGTACCCACTATGTGCCAGG + Intronic
1170587281 20:17744402-17744424 CTGAGCACCTACTATGTGCCTGG + Intergenic
1171057956 20:21926266-21926288 TTGAGTACCTACTATGTCCTAGG - Intergenic
1171782833 20:29436865-29436887 CACAGTACCCAAAATATGCTGGG + Intergenic
1171968463 20:31548568-31548590 CTGAGCACCCACTATGTGCCAGG + Intronic
1172115254 20:32569813-32569835 CAGAGCACCTACTCTTTGCTAGG - Intronic
1172178012 20:32984368-32984390 CAGAGAACTTACTATGTGCCGGG - Intronic
1172600682 20:36180499-36180521 CTGAGCACCTACTATGTGCTTGG - Intronic
1172750887 20:37250349-37250371 TAGAATACCCACTCTGTGCCAGG - Intergenic
1172801297 20:37578119-37578141 CTGAGCACCTACTATGTGCCAGG + Intergenic
1172830703 20:37831760-37831782 CTGAGTACCAACTATGTGCCAGG - Intronic
1172880564 20:38197043-38197065 CTGAGTACCTGCTATGTGCCAGG + Intergenic
1173056056 20:39613888-39613910 CTGAGTGCCTACTATGTGCCAGG - Intergenic
1173059446 20:39647625-39647647 CTGAGTATTTACTATGTGCTGGG - Intergenic
1173354206 20:42271564-42271586 CTGAGTACCTACTATGTGTCAGG - Intronic
1173446610 20:43124678-43124700 CTGAGTGCCTACTATGTGCCAGG + Intronic
1173447841 20:43136360-43136382 TTGAGCACCTACTATGTGCTGGG - Intronic
1173560437 20:44001382-44001404 CTGAGTACCTACTATGTGCCAGG - Intronic
1173577847 20:44124451-44124473 TGGAGTGCCTACTATGTGCTAGG + Intronic
1173579469 20:44137093-44137115 TGGGGTACCTACTATGTGCTGGG - Intronic
1173787485 20:45804994-45805016 CTGAGTACTCACAATATGCTAGG - Intronic
1173812125 20:45962365-45962387 GAGAGCACCCACTCTGTGCCAGG + Intronic
1173823501 20:46032924-46032946 CTGAGCACCTATTATGTGCTGGG + Intronic
1173837109 20:46133083-46133105 CTGAGTGCTCACTATGTGCTAGG + Intergenic
1173866502 20:46315920-46315942 TTGAGTACCTACTATGTGCCAGG - Intergenic
1173973625 20:47171336-47171358 TGGAGTACCTACTATATGCTAGG + Intronic
1174200609 20:48804184-48804206 CTAAGCACCCACTATGTGCCAGG + Intronic
1174393419 20:50232058-50232080 CTGAGCACCTACTGTGTGCTGGG - Intergenic
1174399289 20:50267372-50267394 CAGAGTGCCCAGCATGTGGTAGG - Intergenic
1174505015 20:51011762-51011784 CTGAATACCTACTATGTGCCAGG - Intronic
1174557402 20:51405716-51405738 CTGAGCACCTACTATGTGCTGGG - Intronic
1174558217 20:51411857-51411879 CAGAGTGCCTACTGTGTGCCAGG - Intronic
1174709396 20:52688884-52688906 CAGAGTACGTACTATGTGCTTGG + Intergenic
1174732649 20:52932917-52932939 TATAGCACTCACTATGTGCTGGG - Intergenic
1174830614 20:53808814-53808836 CTGAGCACCTACTATGTGCCAGG - Intergenic
1174830622 20:53808893-53808915 CTGAGTACCCACTCTGTGCCAGG - Intergenic
1174879700 20:54265794-54265816 TTGAGTACCTACTATTTGCTTGG + Intergenic
1175028315 20:55927021-55927043 TAGAGAACCCACTATGTGCAAGG + Intergenic
1175102267 20:56587819-56587841 CTGAGCACCTACTATGTGCCAGG + Intergenic
1175192503 20:57221057-57221079 CTGAGCACCTACTATGTGCCAGG + Intronic
1175209677 20:57344766-57344788 CATAGCACTTACTATGTGCTAGG + Intergenic
1175252096 20:57616001-57616023 CAGAGTACCTCCTGTGTGCAGGG + Intronic
1175373476 20:58508701-58508723 CTGAGTACCTACTATGTGCCAGG + Intronic
1175645965 20:60671929-60671951 CAATGTACTTACTATGTGCTTGG - Intergenic
1175734391 20:61375259-61375281 CATGGTACCTACTAAGTGCTTGG + Intronic
1176185192 20:63774588-63774610 CTGAGTGCCAGCTATGTGCTAGG + Intronic
1176725659 21:10430389-10430411 TTGAGTACCAGCTATGTGCTAGG - Intergenic
1176991401 21:15501557-15501579 TTGAGTACCTACTATGTGCCTGG + Intergenic
1177089349 21:16747732-16747754 TTGAGTACCCAATATGTACTAGG + Intergenic
1177186165 21:17799802-17799824 TTGAGTACCCACTATGTGCCCGG - Intronic
1177756801 21:25358259-25358281 CTGAGTACCTACTGTGTGCCAGG - Intergenic
1178343463 21:31805511-31805533 TTGAGCACCTACTATGTGCTAGG + Intergenic
1178412810 21:32379570-32379592 CAGAGCACTTACTATGTGCCAGG + Intronic
1178928952 21:36800300-36800322 CGGAGTACCCACTGTGTGCCAGG - Intronic
1181117417 22:20641406-20641428 CACAGTACACACTATGTGCCAGG + Intergenic
1181365249 22:22371516-22371538 CTGAATACCTACTATGTGCCAGG + Intergenic
1181463923 22:23100690-23100712 CAGAGCACCCACTGTGTGCCAGG - Intronic
1181524341 22:23471146-23471168 CAGCGTACCCACAAAGAGCTAGG + Intergenic
1181567460 22:23748064-23748086 CTGAGCACCTACTCTGTGCTAGG + Intronic
1181662734 22:24364878-24364900 TGTAGTACTCACTATGTGCTTGG + Intronic
1181765006 22:25085163-25085185 CTGAGCACCTACTCTGTGCTGGG + Intronic
1181765468 22:25088436-25088458 CTGAGTACCCACCAGGTGCCAGG + Intronic
1181857556 22:25792911-25792933 CAGAGCACACACCATGGGCTGGG - Intronic
1181863263 22:25835617-25835639 TTGAGCAGCCACTATGTGCTGGG + Intronic
1181888784 22:26042763-26042785 TTGAGTACCTATTATGTGCTAGG + Intergenic
1182001338 22:26922226-26922248 CTGAGTACCTACTATGTACCTGG + Intergenic
1182078233 22:27509899-27509921 CGGAGTGCTTACTATGTGCTAGG - Intergenic
1182113303 22:27739761-27739783 TAGAGCACCTACTAAGTGCTAGG + Intergenic
1182125779 22:27814962-27814984 TTGAGCACCTACTATGTGCTGGG + Intergenic
1182125963 22:27816027-27816049 CTGAGCACCTACTATGTGCCAGG + Intergenic
1182128832 22:27835889-27835911 CAGAGTAAGCATTCTGTGCTTGG + Intergenic
1182167192 22:28188011-28188033 TTGAGTGCCTACTATGTGCTAGG + Intronic
1182319494 22:29469472-29469494 TTGAGCACCCACTAAGTGCTGGG - Intergenic
1182575269 22:31268727-31268749 CTGAGTGCCCTCTATATGCTAGG + Intronic
1182837736 22:33357996-33358018 CAGAGCACCCACTCTGGGCCAGG - Intronic
1183099404 22:35574707-35574729 CTGAGTACCTACTATGTGCCAGG - Intergenic
1183152621 22:36049859-36049881 AGCAGTGCCCACTATGTGCTGGG + Intergenic
1183323952 22:37181252-37181274 CTGAGCACTCACTCTGTGCTGGG - Exonic
1183329824 22:37213380-37213402 CTGAGCACCTACTATGTGCCAGG + Intergenic
1183391294 22:37546828-37546850 CTGAGCACCTACTATGTGCCAGG - Intergenic
1183669513 22:39264266-39264288 CTGAGGGCCCACTGTGTGCTGGG + Intergenic
1183693211 22:39403121-39403143 CTGAGCACTCACTATGTGCTAGG + Intronic
1183729970 22:39612867-39612889 CAGAACACCTACTGTGTGCTAGG + Intronic
1184052391 22:42017622-42017644 TAGAGCACCCACTGTTTGCTAGG + Intronic
1184057473 22:42062116-42062138 TTGAGTACCTACCATGTGCTGGG - Intronic
1184089406 22:42284388-42284410 TAGAGCACCTACTGTGTGCTGGG + Intronic
1184180474 22:42820500-42820522 CTGAGCACCTACTATGTGCCAGG + Intronic
1184335061 22:43848114-43848136 CAGAGGGCTCACTATGTGCCAGG + Intronic
1184341794 22:43890180-43890202 CTGAGCACCTACTATGTGCCAGG - Intronic
1184372039 22:44088820-44088842 CTGAGCACCTACTATGTGCAGGG - Intronic
1184402327 22:44281241-44281263 CTGAGCAGCTACTATGTGCTGGG + Intronic
1184402893 22:44284259-44284281 CTGAGGACCTACTATGTGCCAGG + Intronic
1184450580 22:44580259-44580281 CTAAGTACCTACTCTGTGCTGGG + Intergenic
1184621150 22:45678629-45678651 CAGAGTACCCAAAATGGGCCAGG - Intronic
1185287460 22:50008909-50008931 CAGAGCACCCACTACGTGCCAGG + Intronic
949097480 3:102821-102843 CCAAGTACCCACTATGTGTGAGG + Intergenic
949293331 3:2491169-2491191 CTGAGTACGTACTATGTGCTGGG - Intronic
949316682 3:2764112-2764134 CTGAGTGCCTACTCTGTGCTGGG + Intronic
949471860 3:4404852-4404874 TTGAGTACCTAGTATGTGCTGGG - Intronic
949479767 3:4482459-4482481 TAAAGTATCCACTATGTGCCAGG + Intergenic
949482858 3:4510583-4510605 CTGAATACCTACTATGTGCTAGG + Intronic
949868385 3:8565887-8565909 CTGAGTACTTACTAAGTGCTAGG - Intronic
950055611 3:10021887-10021909 CTGAGTGCCCACTGTGTGCCTGG - Intergenic
950178373 3:10893024-10893046 ATGAGCACCTACTATGTGCTAGG - Intronic
950186568 3:10949143-10949165 CTGAGTACCTACTGTGTGCTGGG - Intergenic
950293801 3:11810226-11810248 TTGAGTACCTACTGTGTGCTGGG - Intronic
950317266 3:12014144-12014166 CAGAGAACCCACTATCTAGTGGG - Intronic
950380386 3:12608791-12608813 CAAAGTACCTACTATGTGTGTGG - Exonic
950500604 3:13361237-13361259 CTGAGCACCCGCTATGTGCCAGG - Intronic
950545148 3:13633832-13633854 ATGAGCACCTACTATGTGCTGGG - Intronic
950668824 3:14513171-14513193 CTGAGCACCTACTATGTGCCAGG + Intronic
950702148 3:14758057-14758079 ACAAGTACCCACTGTGTGCTGGG + Intronic
950711408 3:14815527-14815549 TTGAGTACCAACTATGTGCCAGG - Intergenic
951038630 3:17963357-17963379 CTGAATACCTACTATGTGCTAGG - Intronic
951409211 3:22341863-22341885 CTGAGCACCTACTATGTGCCTGG - Intronic
951605398 3:24428237-24428259 TTGAGTACCTACTATGTGCCTGG + Intronic
951689032 3:25376044-25376066 CAGAGTACTCCCTATGGGCCAGG - Intronic
951710705 3:25582928-25582950 CTAAGTACCTACTACGTGCTAGG - Intronic
951713703 3:25613760-25613782 TAGAGCATCCACCATGTGCTAGG + Intronic
951985034 3:28609873-28609895 CAGAGTTCCTACTCTGTGCCAGG + Intergenic
952176347 3:30867474-30867496 GAGAGTACTTACTATGTGCCAGG + Intronic
952300299 3:32098886-32098908 TTGAGTGCCCACTCTGTGCTAGG + Intergenic
952422328 3:33143502-33143524 TTGAGTACCTACTGTGTGCTAGG + Exonic
952495416 3:33911716-33911738 CTGAGCACCTACTGTGTGCTGGG - Intergenic
952539791 3:34355933-34355955 TAGAATACCCACTATGTGCCAGG - Intergenic
953097306 3:39791218-39791240 TAGAGTACACCCTATATGCTGGG + Intergenic
953140686 3:40226767-40226789 CTGAGTGCTCACTGTGTGCTAGG - Intronic
953188783 3:40663997-40664019 CTGTGTACCTACTATGTGCTGGG - Intergenic
953329022 3:42036320-42036342 CTGAGTACCTACTATGTACCAGG - Intronic
953368416 3:42366749-42366771 CCGAGTACCTACTATGTGCCAGG + Intergenic
953621607 3:44537594-44537616 AAGAATACTTACTATGTGCTGGG - Intergenic
953962933 3:47281090-47281112 CTGAATACCTACTCTGTGCTGGG - Intronic
954446567 3:50550075-50550097 CTGAGCACCCACTATGTGGCAGG + Intergenic
954894576 3:53964627-53964649 CATGGTACCCACTAGTTGCTAGG + Intergenic
954943253 3:54394031-54394053 CAGAGTTACCACTATGAGGTAGG + Intronic
955044012 3:55342929-55342951 TAAAGTACCTACTATGTGCTAGG - Intergenic
955065260 3:55528474-55528496 CTGAATACCTACTATGTGCTGGG + Intronic
955088943 3:55730491-55730513 CTGAGCACCTACTATGTGCCTGG + Intronic
955095713 3:55795874-55795896 CAGAGTACCTACTATTGGCCAGG + Intronic
955152669 3:56383535-56383557 TTGAGTATCCACTATGTGCCAGG - Intronic
955188319 3:56736191-56736213 TTGAGTACCCAGTATGTGCCAGG + Intronic
955365252 3:58305172-58305194 TAGAACACCTACTATGTGCTGGG + Intergenic
955397793 3:58569410-58569432 CTGAGTACCTACTATGTGCTGGG - Intronic
955405543 3:58623485-58623507 CTGAGCACCCACTGAGTGCTGGG + Intronic
955671954 3:61411604-61411626 GGGAGCACCCCCTATGTGCTAGG + Intergenic
955863459 3:63356715-63356737 CTGAGTACCTAGTATGTGCCAGG - Intronic
955961532 3:64345965-64345987 CTGAGAACCCACTATCTGCCAGG + Intronic
956190585 3:66604043-66604065 CTGAGCACCTACTATGTGCCAGG - Intergenic
956230662 3:67012440-67012462 TTGAGTGCCTACTATGTGCTAGG - Intergenic
956296269 3:67717011-67717033 CTGAGTACTTACTGTGTGCTAGG - Intergenic
956301036 3:67773071-67773093 CAGAGTGCCTTCTATGTGCTAGG + Intergenic
956724765 3:72147913-72147935 CTGAGTACCTACTATGTGCCAGG - Intergenic
956951246 3:74285608-74285630 CTGAAGACCTACTATGTGCTAGG + Intronic
956957401 3:74356606-74356628 TTGAGTACCTACTATATGCTAGG - Intronic
957349271 3:79001991-79002013 TGGAGCTCCCACTATGTGCTAGG + Intronic
957927501 3:86833257-86833279 CAGAGTGCCTACTATGTGGCAGG + Intergenic
958847861 3:99286986-99287008 TAGAGCACCTACTGTGTGCTAGG + Intergenic
958885257 3:99719355-99719377 CTGAGTGCCTACTATGGGCTAGG - Intronic
958888307 3:99753758-99753780 TATAGTACTTACTATGTGCTAGG + Intronic
958906870 3:99951399-99951421 CAGAGTACATACTATGCGCAAGG - Intronic
959159531 3:102706606-102706628 CTGAGTCCCCACTATGTTCCAGG + Intergenic
959367668 3:105483278-105483300 CAGAGTGCCTACTATGTGTTAGG + Intronic
959758149 3:109924628-109924650 GTGAGTACCTACTATGTGCCTGG + Intergenic
959946972 3:112135253-112135275 TCGAGTGCCTACTATGTGCTGGG + Intergenic
960068344 3:113399566-113399588 CAGAGTGCCGACAATGTGCCAGG - Intronic
960175858 3:114517040-114517062 CTGAGTGCCTACTATGTGCTAGG + Intronic
960218937 3:115079889-115079911 TAGAGTGCCTACAATGTGCTGGG + Intronic
960240531 3:115336309-115336331 TTGAGTACCTACTATGTTCTGGG + Intergenic
960639632 3:119813257-119813279 CTGAATGCCCACTCTGTGCTGGG - Intronic
960649175 3:119927078-119927100 CTGAGTACCTACTGTGTGCTAGG - Intronic
960671461 3:120158639-120158661 CTGAGGGCCCACTATGTGCCAGG - Intergenic
960691770 3:120353513-120353535 CAGAGTATTGACTTTGTGCTAGG - Intergenic
960697835 3:120413307-120413329 TGGAGTGCTCACTATGTGCTGGG + Intronic
960944301 3:122955884-122955906 CTGAACACCTACTATGTGCTGGG + Intronic
961042772 3:123689031-123689053 CTGAGTGCCCACTCTGTGCCAGG - Intronic
961361516 3:126371014-126371036 CTGAGTACCTACTATGTGCCTGG + Intergenic
961516402 3:127440150-127440172 CTGAGGACCTACTATGTGCCAGG - Intergenic
961584434 3:127910520-127910542 CTGAGTACCTACTTTGTGCCAGG + Intergenic
961607927 3:128111300-128111322 CTGAGCACCCACTATGTGCCAGG + Intronic
961870181 3:129981779-129981801 CAGATCACCCACTGTATGCTGGG - Intergenic
961929743 3:130520575-130520597 CTGAATACCTACTAAGTGCTAGG - Intergenic
962127814 3:132640795-132640817 GAGTGTACTCACTATATGCTAGG - Intronic
962309402 3:134314557-134314579 CAGAGCGCCTACTAGGTGCTAGG - Intergenic
962341946 3:134593301-134593323 CTGAGTACTTACTATGTGCCCGG + Intergenic
962379547 3:134886672-134886694 TTGAGTACTCACTATGTGCTGGG + Intronic
962601110 3:136991435-136991457 TTAAGTACCTACTATGTGCTAGG - Intronic
962607005 3:137040687-137040709 CTGACTACCTACTATGTGCCTGG - Intergenic
962696319 3:137950882-137950904 TTGAGTATCTACTATGTGCTGGG - Intergenic
962741195 3:138363606-138363628 CAGAGCACCTCCTGTGTGCTTGG - Intronic
962828464 3:139119730-139119752 TGGAGTGCCTACTATGTGCTTGG + Intronic
963061107 3:141227563-141227585 TACAGTACCTACTATGTGCCTGG + Intergenic
963631934 3:147744218-147744240 TTGAGTCCCTACTATGTGCTGGG + Intergenic
963704927 3:148674939-148674961 TTGAGTACCTACTATGTGCCAGG + Intergenic
963925004 3:150942542-150942564 CTGAGCACCTACTATGTGCCAGG + Intronic
964736920 3:159927212-159927234 CTGAGTACCTATTATGTGCCAGG + Intergenic
964747106 3:160022741-160022763 GTGAGTGCCCACTATGTGGTAGG + Intronic
964981578 3:162688395-162688417 CTGAGTACCCACTATATGCCAGG - Intergenic
965152363 3:164994804-164994826 CTGAGAACCCACAATGTGCATGG - Intronic
965370679 3:167858253-167858275 CAGAGCACCTACTATGTTCCAGG + Intergenic
965447894 3:168798673-168798695 CTGAATACCTACCATGTGCTAGG + Intergenic
965647697 3:170901337-170901359 CACTGTAACCACTAAGTGCTGGG + Intronic
965707124 3:171520409-171520431 TTGTCTACCCACTATGTGCTGGG - Intergenic
965778038 3:172254519-172254541 CTGAGTACCTACTATGTGTCAGG - Intronic
966437896 3:179908985-179909007 TTCAGTACCTACTATGTGCTGGG - Intronic
966471614 3:180295782-180295804 TTGAGTTCCTACTATGTGCTAGG + Intergenic
966564058 3:181356423-181356445 CTGAGTACTTACTATGTGCTGGG + Intergenic
966588660 3:181654824-181654846 CCAAGTACCTACTATGTGCAAGG + Intergenic
966784706 3:183612574-183612596 TTGAGCACCCACTATGTGCCAGG + Intergenic
966910077 3:184554665-184554687 CTGAAGACCTACTATGTGCTAGG + Intronic
966949834 3:184806294-184806316 CTGAGTACCTATTATGTGCCAGG - Intergenic
967108399 3:186272063-186272085 CCTGGTACCCACTATGTGCCAGG - Intronic
967868274 3:194208068-194208090 CTGAGCTCCCACTATGGGCTGGG + Intergenic
968000208 3:195200397-195200419 CAGTGAACCCACTGTGTGCTTGG - Intronic
968592996 4:1468916-1468938 CTGAGTGCCCACTAAGGGCTGGG + Intergenic
968855397 4:3116568-3116590 TTGAGCACCCACTGTGTGCTAGG + Intronic
969453768 4:7289447-7289469 CTGAGCACCCACTCAGTGCTAGG - Intronic
969688258 4:8689053-8689075 CTGAGGACCCGCTATGTGCTGGG + Intergenic
969697682 4:8744347-8744369 CAGAGCACCAACCATGTGCCAGG - Intergenic
969927210 4:10595868-10595890 CTGAGTGCTCACTATGTGCTAGG - Intronic
970139859 4:12969906-12969928 CAGAGTACCTACCATGTGTCAGG - Intergenic
970492351 4:16587245-16587267 TAGAGGACACACTATGTGCCAGG + Intronic
970523233 4:16906433-16906455 CTGAGTACCTGCAATGTGCTGGG + Intergenic
970738821 4:19208338-19208360 CTGAGCACCTATTATGTGCTTGG - Intergenic
970882859 4:20952009-20952031 CTGCGTACCCACTCTGTGCTAGG - Intronic
970927111 4:21465744-21465766 GAGAGTGCCCACTATGTGTCAGG - Intronic
971226809 4:24761647-24761669 CAGAGCACCTACTGTGTGCCAGG + Intergenic
971258413 4:25034081-25034103 CTGAGAACCTACTATGTGCTGGG + Intergenic
971457585 4:26859179-26859201 CTGAGTACCTAGTATGTGCCAGG - Intronic
971477757 4:27088338-27088360 TTGAGAACCCACTATGTGCCAGG - Intergenic
971711249 4:30115825-30115847 CATAGTGCCTAATATGTGCTAGG + Intergenic
972171355 4:36349476-36349498 TTGAGTGCCTACTATGTGCTGGG - Intergenic
972349946 4:38227209-38227231 ATGAGTACCTACTATGTGCTAGG - Intergenic
972566729 4:40276215-40276237 GTGAGTACCTACTATGTGCCAGG - Intergenic
972669092 4:41196355-41196377 TTGAGTACCCACTAGGTGCTAGG - Intronic
972793162 4:42392365-42392387 CTAAGCACCCACTATGTGCTAGG + Intergenic
972803409 4:42502112-42502134 TAGTGTACTTACTATGTGCTAGG + Intronic
972984153 4:44743439-44743461 CAGAGTGCCTACTATGTGCCAGG - Intergenic
973295258 4:48511992-48512014 TTGAGTACCCACTACTTGCTAGG - Intronic
973340393 4:48997473-48997495 TTGAGTGCCCACTATGTGCCAGG - Intronic
973662056 4:53118252-53118274 CTGAGCACCTACTATGTGCCAGG - Intronic
975342031 4:73253358-73253380 TGGAGTTCCTACTATGTGCTAGG - Intronic
975416821 4:74114183-74114205 CAGAGCACCTACTATGTTCCAGG + Intronic
975427768 4:74250522-74250544 CTGAATAGCTACTATGTGCTAGG - Intronic
975583890 4:75931104-75931126 CAGAACACCCACTATGTGGCAGG - Intronic
976097541 4:81525645-81525667 CTGAATGCCCACTATGTGCCAGG + Intronic
976525269 4:86080069-86080091 TTGAGTACCTACTATGTACTGGG - Intronic
976546081 4:86337142-86337164 TTGAGTATCTACTATGTGCTAGG - Intronic
977632041 4:99253733-99253755 CATAGGTCCCGCTATGTGCTAGG - Intergenic
977717506 4:100198136-100198158 TTGAGTACCTACTATGTGCAAGG + Intergenic
977843001 4:101732171-101732193 TAAAGTACCTACTATGTGCCAGG - Intronic
977914696 4:102578422-102578444 TTGAGTACCTACTATGTGCCAGG + Intronic
978085255 4:104644259-104644281 CTAAGTGCCCACTATGTGCAAGG - Intergenic
978405855 4:108377976-108377998 CTGAGTACCTACGATGTGCCTGG + Intergenic
978416974 4:108487016-108487038 CTGTGTCCTCACTATGTGCTAGG - Intergenic
978518028 4:109589789-109589811 CGGAGCACCCACTCTGTGCCAGG - Intronic
978757749 4:112322518-112322540 TTGAGCACCTACTATGTGCTAGG + Intronic
978961895 4:114690069-114690091 CTGAGCACCCACTCTGTGCTAGG + Intergenic
979428270 4:120594875-120594897 CAGAACACCTACTATGTGCCAGG + Intergenic
981040923 4:140220789-140220811 ATGAGCACCCACTATGTGCCAGG + Intergenic
981333565 4:143540948-143540970 CTGAGTACCCACCAGATGCTAGG + Intronic
981405508 4:144362896-144362918 CTGAGTATTCACTATGTGCAAGG - Intergenic
981450105 4:144886788-144886810 TTGAGTACTTACTATGTGCTGGG - Intergenic
981656578 4:147118625-147118647 CTAAGTGACCACTATGTGCTAGG + Intergenic
981995599 4:150970856-150970878 GTGAGCACCTACTATGTGCTGGG + Intronic
982290479 4:153776637-153776659 CTGAGTACTCAGTATGTGCAAGG - Intergenic
982655002 4:158136881-158136903 TTGAGTACCTACTATGTGGTAGG - Intronic
983121342 4:163889196-163889218 CAGAGTCCTCACTATGCGCCAGG + Intronic
983257512 4:165416864-165416886 CTGAGTCCCCACTGTGTGCCAGG - Intronic
983501245 4:168502107-168502129 TTGAGTGCCTACTATGTGCTAGG - Intronic
983526269 4:168763306-168763328 TAGAGTACCTACTATGTGCCGGG + Intronic
983568755 4:169182033-169182055 TTGAGTGCCTACTATGTGCTGGG - Intronic
983806232 4:171996761-171996783 AAGTCTACCCACTATGTGTTGGG + Intronic
983910746 4:173236011-173236033 CTGAGTACCTACTATGTACCAGG - Intronic
984643017 4:182190951-182190973 TTGAGTACCTACTGTGTGCTAGG + Intronic
984709739 4:182875246-182875268 CAGCGTGCCCACTCTGTCCTTGG + Intergenic
984884103 4:184434859-184434881 CAGAGCACCTACTATGTGCTGGG + Intronic
985897946 5:2760507-2760529 TTGAGCACCCACTGTGTGCTGGG - Intergenic
987035660 5:14015687-14015709 CTGAGCACCTACTGTGTGCTAGG - Intergenic
988994465 5:36701433-36701455 TTGAGTATCTACTATGTGCTAGG - Intergenic
989061310 5:37414651-37414673 TTGAGTACCTACTATGTGCTAGG - Intronic
989196574 5:38722521-38722543 CTGATTATCTACTATGTGCTAGG - Intergenic
989237099 5:39160744-39160766 CTGAATACCTACTGTGTGCTTGG - Intronic
989254795 5:39354613-39354635 CTGAGTACCTACTATGTTCCAGG + Intronic
989781746 5:45274534-45274556 ACGAGTACCCACAATGTGCCAGG - Intronic
989989109 5:50740093-50740115 TAATGTTCCCACTATGTGCTAGG + Intronic
990273457 5:54170858-54170880 TTGAGCACCTACTATGTGCTAGG - Intronic
990346290 5:54875066-54875088 TAGAGTGCCTACTATGTGCCAGG + Intergenic
990466112 5:56073302-56073324 CTGAGTGCTCACTATGTGCCAGG + Intergenic
990504318 5:56429728-56429750 CTGAGCACCTACTATGTGCCAGG + Intergenic
990670424 5:58123381-58123403 CTGAGTGCCTACTATGTGCCTGG + Intergenic
991588081 5:68220009-68220031 CATAGTACTTACTATGTGCCAGG - Intronic
992226605 5:74624980-74625002 CTGAGGACCTACTATGTGCCAGG + Intergenic
992304893 5:75426666-75426688 TTGAATACCTACTATGTGCTGGG + Intronic
992382171 5:76248598-76248620 CTGAGCACCTACTATGTGCAGGG - Intronic
992497956 5:77311626-77311648 TTGAGCACCTACTATGTGCTGGG - Intronic
993344335 5:86763773-86763795 TAGAGTACCTGCTATGTGCCAGG - Intergenic
993487509 5:88504460-88504482 CACAACACCCACTATGTCCTGGG + Intergenic
993550035 5:89261983-89262005 CTGAGCACTCACTATGTGCTAGG - Intergenic
993884214 5:93397488-93397510 CTGAATACCTGCTATGTGCTGGG + Intergenic
993932702 5:93960556-93960578 CTGAGTGCCTACAATGTGCTAGG - Intronic
994036485 5:95207709-95207731 TTGAGAACCTACTATGTGCTAGG - Intronic
994127704 5:96187706-96187728 CTGAGTGCCCACTTTGTGCAAGG - Intergenic
994680919 5:102886857-102886879 CTGAGTACCTTCTATGTGCAAGG - Intronic
995061195 5:107813462-107813484 TTGAGTGCCCACTATGTGCTAGG + Intergenic
995068564 5:107890899-107890921 TTGAGTACCCACTATGTGTCAGG + Intronic
995314354 5:110751141-110751163 CTGAGTACTTACTATGTGCCAGG + Intronic
995466653 5:112456760-112456782 CTGAGTACCTAGTATGTGTTAGG - Intergenic
995513689 5:112933341-112933363 CTGAGCACCTACTATCTGCTAGG + Intergenic
995713380 5:115057154-115057176 CCAAATACCTACTATGTGCTAGG + Intergenic
995866082 5:116692650-116692672 CCGAGTACCTATGATGTGCTAGG - Intergenic
996044945 5:118861644-118861666 TTGAGTACCAACTATGTGCCTGG + Intronic
996294615 5:121896839-121896861 TTGAATACCTACTATGTGCTAGG - Intergenic
996411075 5:123159916-123159938 CTGAGTACCTACTATGTGTCTGG + Intronic
996439099 5:123469575-123469597 CTGAGTGCCTACTATGTGCCAGG + Intergenic
996470653 5:123856245-123856267 CTGAGTACCCATTATATGCCTGG - Intergenic
996529881 5:124517431-124517453 TAGAGTACCCGCTATATGCAAGG - Intergenic
997018725 5:129970296-129970318 TTGAGTACCTACTATGTGCCAGG - Intronic
997019984 5:129988592-129988614 CTGAGTGCCTACTATGTGCTAGG - Intronic
997083378 5:130766954-130766976 CAGAGTACCTTCAATGTTCTAGG - Intergenic
997201994 5:132016096-132016118 CTGAGTCCCCACTATGTGCAAGG + Intergenic
997202740 5:132022376-132022398 TTGAGTACCTACTATGTACTAGG + Intergenic
997435378 5:133870329-133870351 CTGAGTACTCACTATGTGCCAGG + Intergenic
997741107 5:136255689-136255711 TTGAGCACCTACTATGTGCTAGG + Intronic
998011787 5:138701159-138701181 TTGAGCACCTACTATGTGCTAGG + Intronic
998069057 5:139182413-139182435 CTGAGTACCCATTGTGTGCCAGG - Intronic
998142632 5:139708919-139708941 CTGAGTGCCTACTACGTGCTAGG - Intergenic
998224913 5:140319473-140319495 CAGAGTTCCTACTATGTGCTAGG + Intergenic
998390143 5:141782110-141782132 CTGAGCACCTACTATGTGCGAGG + Intergenic
998392938 5:141799105-141799127 CAGAGCACCTACTATATGCCAGG - Intergenic
998399128 5:141838948-141838970 CAGAGTGCCTACTAAGTGCCAGG - Intergenic
998415339 5:141941864-141941886 TAAAGTACCTACTATGTGCTGGG - Exonic
998772342 5:145560370-145560392 TTGAGCACCTACTATGTGCTGGG - Intronic
998796911 5:145830147-145830169 CTGAGTACCTACTATGTTCCAGG + Intronic
998921374 5:147071842-147071864 CTGAGCACCTACTATGTGCTTGG - Intronic
999461951 5:151764935-151764957 CAGAGTAGCTATTATGTGCCAGG - Intronic
999513370 5:152276317-152276339 CAGAGTACCCACTTTCTCCTGGG + Intergenic
999530811 5:152461733-152461755 ATGAGTAGCTACTATGTGCTAGG + Intergenic
999687961 5:154119110-154119132 CTGAGCACCCACTATGTCCCAGG + Intronic
999693857 5:154171201-154171223 CTGAGCACCTACTATGTGCTGGG + Intronic
1000180918 5:158810280-158810302 CTGAGCACCTACTATGTGCTGGG - Intronic
1000295847 5:159912814-159912836 GAGAGTACCTACTATGTGCCAGG - Intergenic
1000369699 5:160522954-160522976 TTGAGTACCCCCTATGTGCCAGG + Intergenic
1000674250 5:164101384-164101406 CTGAGTACCTAATATGTGCTGGG + Intergenic
1001086114 5:168701176-168701198 CAGAATGCCTACTATGTGCTAGG - Intronic
1001136753 5:169108845-169108867 TAGAGTACCCACTCTGTGCTAGG - Intronic
1001143601 5:169165084-169165106 CTGAGCACCTACTATGTGCCAGG - Intronic
1001306481 5:170578084-170578106 TTGAGTGCCCACTATGTGGTAGG + Intronic
1001311011 5:170610899-170610921 CTGAGTACCTAGTATGTGCGGGG + Intronic
1001314217 5:170631323-170631345 CTGAGCACCTACTATGTGCCAGG - Intronic
1001321975 5:170690100-170690122 CTGAGGACCTACTATGTGCTGGG - Intronic
1001427071 5:171629647-171629669 CCCAGCACCCACTATGTGCCAGG - Intergenic
1001460319 5:171906597-171906619 CAGAGTACCCAATAGATGCCAGG + Intronic
1001662094 5:173401751-173401773 CTGAGCACCTACTATGTGCCAGG + Intergenic
1001741474 5:174056348-174056370 AAAGGTACCCACTATGTGCCTGG - Intronic
1001858414 5:175032595-175032617 TTGAGAACCTACTATGTGCTAGG - Intergenic
1002101941 5:176862136-176862158 CTGAGCACCTACTATGTGCAGGG + Intronic
1002125673 5:177042117-177042139 CTGAGTCCCTACTATGTGCCAGG - Intronic
1002517798 5:179772630-179772652 CTGAGTACCCACTCTGTGGCAGG - Intronic
1003332225 6:5139023-5139045 TTGAGTACCTACTATGTTCTAGG + Intronic
1003458514 6:6307150-6307172 CCTAGGACCCACTATGTGCCAGG - Intronic
1004095331 6:12548526-12548548 CTGAGTGCCTACTATGTGCCTGG - Intergenic
1004156650 6:13174902-13174924 CAGAGAACTTACTATGTGCCAGG - Intronic
1004454129 6:15775697-15775719 TTGAGTACCTACTATGTGTTTGG + Intergenic
1004477950 6:15991426-15991448 ATGAGCACCCACTATGTGCCAGG - Intergenic
1004553884 6:16676502-16676524 CTGAGTGCCTACTTTGTGCTAGG + Intronic
1004587158 6:17013574-17013596 CTGAGCACTCACAATGTGCTAGG - Intergenic
1004598716 6:17126938-17126960 CTGGGTCTCCACTATGTGCTGGG + Intronic
1004670806 6:17794782-17794804 CTGAGCACTTACTATGTGCTAGG + Intronic
1004946986 6:20626354-20626376 TTGAGTACCTACTATGTGCTGGG - Intronic
1004957384 6:20744386-20744408 CTGAGTGCCTACTGTGTGCTTGG + Intronic
1005054931 6:21720512-21720534 TAAAGTACCCACTGTGTGCCTGG - Intergenic
1005404370 6:25470361-25470383 CAGAGTTCTCACCATGTGCCAGG - Intronic
1005954170 6:30651932-30651954 TTGAGTACCTACCATGTGCTAGG - Intronic
1006027645 6:31157771-31157793 TAAAGTGCCCACTATGTGTTAGG - Exonic
1006130709 6:31867786-31867808 CAGAGGACCCACTATGTGCCAGG - Intronic
1006450438 6:34102977-34102999 CAGAGCACCTTCTATGTGCTGGG - Intronic
1006451332 6:34107351-34107373 CTGAGCACCCTCTATGTGCCTGG + Intronic
1006511219 6:34522348-34522370 CCGAGTGCCTACTGTGTGCTGGG - Intronic
1006646597 6:35519209-35519231 CCAAGCACCTACTATGTGCTTGG + Intergenic
1006662052 6:35655251-35655273 CTGAATACCTACTATGTGCCAGG + Intronic
1006704451 6:36006450-36006472 TTGAGTACCTACTATGTGCTAGG + Intronic
1006912194 6:37570676-37570698 TAGAGTACTCACAATGTGCTGGG - Intergenic
1007005697 6:38360309-38360331 TTGAGTACCTACTATATGCTAGG - Intronic
1007304153 6:40891359-40891381 GTGAGCACCTACTATGTGCTAGG + Intergenic
1007313510 6:40965454-40965476 CTGAGTGCCTACTATGTGCCTGG + Intergenic
1007329283 6:41091858-41091880 CTGAGCACCTACTATGTGCCAGG + Intronic
1007555054 6:42758811-42758833 TGGAGTACCCACTATGTTCTAGG + Intronic
1007698707 6:43750827-43750849 TCGAGCACCTACTATGTGCTAGG - Intergenic
1007946919 6:45835255-45835277 CTGAGAACCTACAATGTGCTGGG - Intergenic
1007966544 6:46008574-46008596 CAGAGCACCTACTCTGTGCCAGG - Intronic
1008014061 6:46498007-46498029 TTGAGTATCCACTATGTGTTAGG + Intergenic
1008071242 6:47101097-47101119 CTGAGTAGCAACTATGTGCCAGG - Intergenic
1008690670 6:53975172-53975194 CTGAGTAACTACTATGTGCCAGG + Intronic
1008974228 6:57405718-57405740 CTGAGTAGCCACTATGTGCCAGG + Intronic
1009163117 6:60307241-60307263 CTGAGTACCCACTATGTGCCAGG + Intergenic
1009450485 6:63794199-63794221 TTGAGTACCTACTATGTGCTAGG - Intronic
1009498251 6:64377051-64377073 GAGAGTATCCACTATGTGCCAGG - Intronic
1009938806 6:70265547-70265569 TAAAGTACCTGCTATGTGCTAGG - Intronic
1010712575 6:79192443-79192465 CAGAGTGCCTACTGTGTGCCAGG + Intergenic
1011068018 6:83350195-83350217 CTAAGTACCTACTATGTGCCAGG + Intronic
1011250872 6:85370809-85370831 CAGAGTACTCACTAGGTGTCTGG - Intergenic
1011367058 6:86594657-86594679 TTGAGTACCTACTATGTGCTAGG + Intergenic
1011719967 6:90145156-90145178 AAGAGGACCCACTATGTGTCAGG - Intronic
1011895969 6:92225794-92225816 CCGAGTACCTACTATGTACTAGG - Intergenic
1012560634 6:100576644-100576666 CTGAGAACCCACTACATGCTAGG - Intronic
1012945762 6:105463888-105463910 CTGAGTACCTATTATGTGCTAGG + Intergenic
1013030072 6:106324572-106324594 CTGAGTACCTCCTATGTGTTAGG - Intronic
1013054073 6:106566114-106566136 CGGGGTACACACTATGTGCCAGG + Intronic
1013191321 6:107806514-107806536 CAGAATCCCCACTATGCTCTGGG - Intronic
1013219345 6:108063535-108063557 TTGAATACCAACTATGTGCTAGG - Intronic
1013428750 6:110037554-110037576 CTGAGCACCTACTATGTGCTAGG + Intergenic
1013916526 6:115345211-115345233 CTGAGTAGCCATTATGTGCTAGG - Intergenic
1014333719 6:120103592-120103614 CAGAGAATCCACTATGAGATGGG - Intergenic
1015019568 6:128456222-128456244 TAAATTACCCACTATGTGCCAGG + Intronic
1015107201 6:129550914-129550936 CTGAGTCCCCACTATGTGGAAGG - Intergenic
1015254739 6:131165628-131165650 TAGAGTGCCTACTATGTGCCAGG - Intronic
1015454931 6:133415740-133415762 CAGAGCACCTACAATGTACTAGG - Intronic
1015570452 6:134616045-134616067 TAGAGTGCCCACTATGTGCCAGG + Intergenic
1015593166 6:134841895-134841917 TGGAGTACCAACTGTGTGCTAGG - Intergenic
1015766097 6:136718534-136718556 TTGAGTATTCACTATGTGCTAGG - Intronic
1015911054 6:138168081-138168103 GTGAGTACCTACTATGTGCCAGG + Intronic
1016596004 6:145802027-145802049 CATAGTACCTACTATGTAGTAGG - Intronic
1016710695 6:147168264-147168286 CTGAGCACCTACTGTGTGCTAGG + Intergenic
1016788010 6:148034749-148034771 GAGAGTACCTACTATGTGATAGG + Intergenic
1016966964 6:149727925-149727947 CTGAGTACCTACTATGTGCCAGG + Intronic
1017111869 6:150940204-150940226 GTGAGTTCCTACTATGTGCTGGG - Intronic
1017323843 6:153124299-153124321 TTGAGCACCCACTATGTGCTAGG - Intronic
1017467096 6:154704585-154704607 TAGAGAACCCATTATGTTCTAGG - Intergenic
1017600525 6:156075818-156075840 TCGAGTGCCCACTATGTGCCAGG - Intergenic
1018615532 6:165683072-165683094 GTGAGTACGCACCATGTGCTAGG - Intronic
1018886710 6:167944335-167944357 CTGAGCACCTACTATGTGCCGGG - Intronic
1019665154 7:2248281-2248303 CTGAACACCCACTCTGTGCTGGG - Intronic
1020113451 7:5461217-5461239 TTGAGCACCTACTATGTGCTGGG + Intronic
1020522454 7:9209372-9209394 TAGAGAGCCTACTATGTGCTAGG - Intergenic
1020661880 7:10993484-10993506 TTGAGTACCTTCTATGTGCTTGG + Intronic
1020786788 7:12583670-12583692 CAGAGTTTCCACTATGGGCCAGG + Intronic
1020866071 7:13564305-13564327 TGGAGTACCTACTATATGCTAGG + Intergenic
1021210890 7:17851029-17851051 TTGAGTGCCTACTATGTGCTAGG + Intronic
1021437949 7:20642608-20642630 CTGAGTGCCCACTATGTGTGAGG - Intronic
1021731818 7:23602939-23602961 CAAAGTACCTACCATGTGCCAGG - Intronic
1021736314 7:23641678-23641700 CTGAGTACCTAATATATGCTAGG + Intronic
1021843510 7:24742424-24742446 CAGAGCACCTACTGTGTGCCAGG - Intronic
1021985618 7:26095637-26095659 CTGAGCACTTACTATGTGCTTGG - Intergenic
1022035877 7:26534291-26534313 TTGAGTACCCACTATCTCCTTGG - Exonic
1022057460 7:26753721-26753743 CCGAGCATCCACTATGTGCCAGG + Intronic
1022115710 7:27258715-27258737 CTGAGTACCCACCAGGTGCTAGG - Intergenic
1022245796 7:28557957-28557979 CAGAGAACCCAAGTTGTGCTAGG + Intronic
1022320381 7:29282305-29282327 CTGAGTGCCCACTATGTGCAGGG + Intronic
1022410059 7:30132654-30132676 CTGAGTTCTTACTATGTGCTAGG + Intergenic
1022436428 7:30390278-30390300 CTGAGTGCCAACTATGTGCCAGG - Intronic
1022481589 7:30746964-30746986 CAGAGTACCTACTGTGTGCTGGG + Intronic
1022556038 7:31297329-31297351 TTGAGCACCCACTGTGTGCTAGG - Intergenic
1022574668 7:31486143-31486165 CTGAGTACCTACTGTGTGCAGGG - Intergenic
1023094936 7:36650779-36650801 CAGAGCACCTACTATGTGCCAGG + Intronic
1023217974 7:37885738-37885760 AAGAGTTCCCCCTATGTGCCAGG - Intronic
1023660379 7:42465650-42465672 TTGAGTACCTACTAGGTGCTAGG + Intergenic
1023900222 7:44471025-44471047 CTGAGTACCAACTACGTGCCAGG + Intronic
1025109602 7:56203036-56203058 CTGAGCACCTACTATGTGCCAGG + Intergenic
1025244072 7:57302993-57303015 CTGAGCACCTACTATGTGCCAGG + Intergenic
1026141714 7:67712459-67712481 TTGAGTACCTATTATGTGCTTGG - Intergenic
1026234982 7:68519642-68519664 ATGAGTACCTACTATGTGCTTGG - Intergenic
1026282665 7:68935608-68935630 CTGAGTACAGACTTTGTGCTAGG - Intergenic
1026308304 7:69161582-69161604 CTGAGCACCTACTATGTGCCAGG - Intergenic
1026339489 7:69423187-69423209 TTGTGTACCTACTATGTGCTGGG + Intergenic
1026356183 7:69559427-69559449 TTGAGAACCTACTATGTGCTGGG - Intergenic
1026661762 7:72308946-72308968 TAGAGGGCTCACTATGTGCTAGG + Intronic
1026966959 7:74446205-74446227 CAAAGCACCCTCTCTGTGCTGGG - Intergenic
1027290338 7:76702404-76702426 TTGAGTACCTACTATGTGCAAGG + Intergenic
1027293229 7:76737682-76737704 CTGAGTGCCTACTATGTGCTGGG + Intergenic
1027296636 7:76780279-76780301 CTGAGTATTCACTATGTGCCCGG - Intergenic
1027375717 7:77547215-77547237 CTGAGTGCCCACTATGCCCTAGG + Intronic
1028168501 7:87567318-87567340 CTGAGTGCTTACTATGTGCTGGG - Intronic
1028240441 7:88413659-88413681 CAAAGTTCCTACTACGTGCTAGG + Intergenic
1028636059 7:92990512-92990534 TTGAGCACCTACTATGTGCTAGG + Intergenic
1028830851 7:95325071-95325093 TTGAGTACCTACTATGTGCCAGG + Intergenic
1028889181 7:95967753-95967775 ATGAGCACCTACTATGTGCTGGG - Intronic
1028890879 7:95987329-95987351 TTGAGTACCTACTATGTGCTAGG + Intronic
1029142645 7:98422485-98422507 CTGAGCACCTCCTATGTGCTAGG + Intergenic
1029190194 7:98766472-98766494 CTGAGCACCTACTATGTGCCAGG - Intergenic
1029976102 7:104835499-104835521 TTGAGCACCTACTATGTGCTAGG + Intronic
1030088828 7:105839755-105839777 CTGAGCACCTACTATGTGCCAGG + Intronic
1030089140 7:105841908-105841930 TAAAGTACCCACTATGTGCTAGG - Intronic
1030631948 7:111905915-111905937 TTGAGTACCTACTATGTGCTGGG + Intronic
1031494587 7:122431245-122431267 CTGAGTACCAAATATGTGCTGGG + Intronic
1031863811 7:127014622-127014644 TAGAGTTCTTACTATGTGCTAGG - Intronic
1031930695 7:127682828-127682850 CTGAGTGCCTACTATGTGCCAGG - Intronic
1032102206 7:128990474-128990496 TTGAGTGCCCACTATGTGCCAGG - Intronic
1032139550 7:129315041-129315063 CAGAGCACCAACTATGTGGTAGG - Intronic
1032238491 7:130143464-130143486 CTGAGCATCTACTATGTGCTAGG - Intergenic
1033244372 7:139705861-139705883 CTGAGTGCTCACTATGTGCCAGG + Intronic
1033287624 7:140056288-140056310 CAGAGTACCTACTGTGGGCCAGG + Intronic
1033736604 7:144228696-144228718 GTGAGTACTCACTCTGTGCTAGG + Intergenic
1033746452 7:144322254-144322276 GTGAGTACTCACTCTGTGCTAGG - Intergenic
1034480294 7:151314679-151314701 CTGAGCACCCACTATGGGCCAGG - Intergenic
1034733350 7:153407026-153407048 CAGAGTAGACTCTATGTGTTTGG + Intergenic
1035497922 8:68707-68729 CAGAGCACCTACTATGTGCCAGG - Intergenic
1035915920 8:3622083-3622105 CACAGTCTGCACTATGTGCTGGG + Intronic
1037402691 8:18508789-18508811 CTGAGCACTTACTATGTGCTAGG + Intergenic
1037894263 8:22641387-22641409 CTGAGTTCCCACTCTGTGCCAGG - Intronic
1038209251 8:25500177-25500199 TGGAGTAGCCACTGTGTGCTTGG + Intronic
1038275640 8:26118598-26118620 CGGAGTACCTAGTATGTGCCAGG - Intergenic
1038275664 8:26118825-26118847 TTGAGCACCTACTATGTGCTAGG - Intergenic
1038372503 8:27008109-27008131 CAGAGTACCAACCATCTGCCAGG - Intergenic
1038465684 8:27760571-27760593 CTGAATACCTACTATGTGCCAGG + Intronic
1038709997 8:29934412-29934434 CTGAGCCCCTACTATGTGCTAGG - Intergenic
1038967054 8:32586093-32586115 TTGAGTACCTACTATGTGCCAGG - Intronic
1039139872 8:34374794-34374816 TTGAGTACTCACTATGTGCCAGG + Intergenic
1039165365 8:34673455-34673477 TTGAGTGCCCACTATGTGCTAGG + Intergenic
1039247141 8:35621355-35621377 CAGAGTACCTAGCATGTACTAGG + Intronic
1039614618 8:38945305-38945327 CTGAGCACCTACTATGCGCTAGG - Intronic
1040060049 8:43096083-43096105 CCGAGTACCCGCTGTGTGCCAGG + Intronic
1040425890 8:47285875-47285897 CTGGGTGCCCACTGTGTGCTAGG - Intronic
1041096064 8:54351413-54351435 CAGCGTGCCCACTTTGAGCTTGG + Intergenic
1041215762 8:55598294-55598316 CAGAGCCCCCATTGTGTGCTAGG - Intergenic
1041489691 8:58419637-58419659 CTAAGTACCAACTCTGTGCTAGG - Intronic
1041545036 8:59033299-59033321 CTGAGTGCCTACTGTGTGCTAGG - Intronic
1041722293 8:60987014-60987036 TTGAGTAGCCACTGTGTGCTAGG + Intergenic
1041948862 8:63477449-63477471 CAGAGTTCCTACTACGTACTAGG - Intergenic
1042102180 8:65285211-65285233 CTGAGTTCCCACACTGTGCTGGG - Intergenic
1042119486 8:65469649-65469671 TGGAGCACCTACTATGTGCTGGG - Intergenic
1042602884 8:70516169-70516191 CTGAGGACCTACTATGTGCCAGG + Intergenic
1042615206 8:70641366-70641388 TGGAGTGCTCACTATGTGCTAGG + Intronic
1042648972 8:71018627-71018649 CTGAGTACGTACTATGTGCCAGG - Intergenic
1043038324 8:75226727-75226749 AAGAATACCCACTGTGGGCTGGG - Intergenic
1043379186 8:79684512-79684534 TTGAGTACCTACTATGTGCCAGG - Intergenic
1043667399 8:82833426-82833448 CTGAATACCTACTATGTGCCAGG - Intergenic
1043787214 8:84418361-84418383 CTGAGTACCTAATATGTGCCAGG - Intronic
1043820038 8:84851990-84852012 CAGAGTATCCACTATGTGTGAGG - Intronic
1044244052 8:89920261-89920283 CAGAGTACTTACTATGTACTAGG - Intronic
1044599801 8:93992169-93992191 TTGAGCACCTACTATGTGCTGGG - Intergenic
1044630062 8:94270009-94270031 CTGAGTTCCCTCTGTGTGCTAGG - Intergenic
1044701273 8:94967441-94967463 CTGAGTACCTACTGTGTGCCAGG + Intronic
1044782115 8:95753823-95753845 TTGAGCACCTACTATGTGCTGGG - Intergenic
1044954303 8:97463596-97463618 CTGAGTACCCACCATATGCCAGG + Intergenic
1045085548 8:98679641-98679663 TTGAGTACCTACCATGTGCTTGG - Intronic
1045374981 8:101563028-101563050 ATGGGTACTCACTATGTGCTGGG + Intronic
1045548883 8:103152608-103152630 CCGAGTGCCTACTCTGTGCTGGG - Intronic
1045593070 8:103620782-103620804 CTGAGTAACCACTATATGCCAGG - Intronic
1045658642 8:104412686-104412708 CAGAGAACCCACTGTCTGATTGG + Intronic
1045934846 8:107667222-107667244 CTGAGTACCTCCTATGTGCCAGG - Intergenic
1046089137 8:109478272-109478294 CTGAGTATCCACTATGTGCCAGG + Intronic
1046094568 8:109541576-109541598 TTGAGTACCTACTATGTGCCCGG + Intronic
1046096880 8:109573098-109573120 TAGACTTCCCACTATGTGCCAGG + Intergenic
1046112745 8:109745887-109745909 CTGAGCACCTACTATGTGCCTGG - Intergenic
1046527985 8:115405741-115405763 CTGAGTATTTACTATGTGCTGGG - Intergenic
1046711832 8:117519457-117519479 CTGAGCACCTATTATGTGCTGGG - Intergenic
1046818482 8:118611152-118611174 CTGAGTACCTACTATATGCTAGG - Intronic
1046871788 8:119211949-119211971 CTGAATACCTACTATGTGCAAGG + Intronic
1047660643 8:127031931-127031953 CTGAGTACTTACTATGTGCCAGG - Intergenic
1047691938 8:127364837-127364859 TACAGCACCTACTATGTGCTAGG + Intergenic
1047720962 8:127638686-127638708 TTGAGTACTCACTGTGTGCTAGG - Intergenic
1047824707 8:128560605-128560627 CGGAGTACCTACTATGTACCAGG - Intergenic
1048011366 8:130459119-130459141 CTGAGTACCAACTATGTGACAGG + Intergenic
1048228368 8:132612695-132612717 TAGAATACCTACTATGTGCCAGG - Intronic
1048296585 8:133219182-133219204 CTGAGCACCTACTATGTGCTAGG + Intronic
1048378375 8:133842999-133843021 CTGAGCACCTACTATGTGATGGG + Intergenic
1048378464 8:133843653-133843675 CTGAGCACCTACTGTGTGCTGGG + Intergenic
1048497910 8:134950451-134950473 CTGAGCACCTACTATGTGCTAGG + Intergenic
1048568414 8:135628308-135628330 CAGAGCACCCACTATATGCTGGG - Intronic
1048598221 8:135889513-135889535 CTGAACACCTACTATGTGCTGGG - Intergenic
1048708453 8:137181484-137181506 TTGAGTACCTACTATGTGCTGGG - Intergenic
1048867182 8:138769709-138769731 CTGGGTACCCGCTGTGTGCTGGG - Intronic
1050057916 9:1674950-1674972 CTGAGTACCGATTATATGCTTGG + Intergenic
1050272474 9:3960570-3960592 CTGTGGACCCACTATGTGCCAGG - Intronic
1050317861 9:4421762-4421784 AAGAGTACCAACTATGTCCTAGG + Intergenic
1050532728 9:6604937-6604959 CTGAGTGCCCACCATGTGCCAGG + Intronic
1050624655 9:7489896-7489918 CAGAGTACCTATTATGTGCCAGG - Intergenic
1050946539 9:11527866-11527888 CCGACTGCCTACTATGTGCTGGG - Intergenic
1051422096 9:16898905-16898927 TTGAGTACCAATTATGTGCTAGG - Intergenic
1051589404 9:18761037-18761059 TTGAGTACCCACTGAGTGCTAGG - Intronic
1051719930 9:20026381-20026403 TAGAGTGCTTACTATGTGCTAGG - Intergenic
1051722147 9:20048224-20048246 CTAAATACCTACTATGTGCTAGG - Intergenic
1051755591 9:20396333-20396355 CAGACTACCAACTATGTGCCAGG + Intronic
1051873485 9:21766426-21766448 TTGAGTTTCCACTATGTGCTAGG + Intergenic
1052020275 9:23517885-23517907 CTGAGTTCCTTCTATGTGCTAGG + Intergenic
1052514360 9:29460976-29460998 CAGAATACCTACTATTGGCTGGG - Intergenic
1052519150 9:29521859-29521881 TAAAGTACCCACAATGTGATGGG + Intergenic
1052773096 9:32707166-32707188 CAGAGTACCTACTATGTCCCAGG - Intergenic
1052779480 9:32765843-32765865 CTGAGTACCTACTGTGAGCTGGG - Intergenic
1052847364 9:33349155-33349177 ATGAGTACCTACTATGTGCTAGG + Intronic
1053279849 9:36812948-36812970 TAGAATATCTACTATGTGCTGGG - Intergenic
1053292367 9:36889705-36889727 CTGAGTACCTACTGTGTGCCAGG - Intronic
1053459690 9:38258636-38258658 CATAGCACCTACTATGTTCTAGG + Intergenic
1053540592 9:38969826-38969848 CTGAGTACCTGCTTTGTGCTAGG + Intergenic
1053676374 9:40434089-40434111 TAGAGTACCCACAGTGTGCAAGG + Intergenic
1053804935 9:41791982-41792004 CTGAGTACCTGCTTTGTGCTAGG + Intergenic
1053926149 9:43060205-43060227 TAGAGTACCCACAGTGTGCAAGG + Intergenic
1054287345 9:63190804-63190826 TAGAGTACCCACAGTGTGCAAGG - Intergenic
1054289442 9:63269614-63269636 TAGAGTACCCACAGTGTGCAAGG + Intergenic
1054387474 9:64574160-64574182 TAGAGTACCCACAGTGTGCAAGG + Intergenic
1054508248 9:65942205-65942227 TAGAGTACCCACAGTGTGCAAGG - Intergenic
1054625551 9:67394097-67394119 CTGAGTACCTGCTTTGTGCTAGG - Intergenic
1055074821 9:72203223-72203245 TAGAGCTCCCACCATGTGCTAGG - Intronic
1055123635 9:72692584-72692606 CAGAGTACCAAGTAGCTGCTTGG + Intronic
1055139403 9:72858676-72858698 CATAGAACTCCCTATGTGCTAGG + Intergenic
1055287533 9:74745318-74745340 TTGAGTACCTACTATGTGCCAGG + Intronic
1055351255 9:75390829-75390851 CTGAGTGCCCACAATGTGCCAGG - Intergenic
1055354295 9:75421515-75421537 TTGAGTGCCTACTATGTGCTAGG - Intergenic
1055389462 9:75803999-75804021 CTGAGCACTCACTAAGTGCTAGG + Intergenic
1055566063 9:77569451-77569473 CCGAGGACCTACTATGTGTTGGG + Intronic
1055582110 9:77716838-77716860 TTGAGCACCTACTATGTGCTAGG + Exonic
1056074572 9:83025269-83025291 CTGAGCACCCACCATGTGGTGGG + Intronic
1056537017 9:87537337-87537359 CTGCGTACACACTATGTGATGGG - Intronic
1056724144 9:89097657-89097679 TTGAGCACCTACTATGTGCTGGG + Intronic
1057504249 9:95619627-95619649 CTGAGTACCCACTGTGTACTGGG - Intergenic
1057789008 9:98110339-98110361 CTGAGCACCTATTATGTGCTGGG + Intronic
1057871542 9:98721884-98721906 CTGAGGACCTACTATGTGCCAGG - Intergenic
1057928568 9:99173650-99173672 CTGAGCACCCACTATGTGCTGGG + Intergenic
1057949918 9:99361552-99361574 CTAAGCACCCACTCTGTGCTAGG - Intergenic
1058022196 9:100101220-100101242 CTGAGTGACAACTATGTGCTAGG - Intronic
1058057950 9:100468245-100468267 CTGAGCACCCACTATGATCTAGG - Intronic
1058170543 9:101675501-101675523 CACAATACTCACTATGTGCCAGG + Intronic
1058504500 9:105654436-105654458 CAATATACCGACTATGTGCTAGG + Intergenic
1058582053 9:106468964-106468986 TAAATTACCTACTATGTGCTAGG - Intergenic
1059008807 9:110433959-110433981 TAAAGTACCTATTATGTGCTAGG - Intronic
1059290550 9:113220563-113220585 CTGAGCACTCACTATGTGCTAGG + Intronic
1059470172 9:114498897-114498919 ACGATTACCTACTATGTGCTGGG - Intronic
1059511331 9:114851047-114851069 CTGAGTACTTATTATGTGCTTGG + Intergenic
1059650077 9:116307931-116307953 CAGAGAAAACACTCTGTGCTGGG + Intronic
1059655676 9:116355223-116355245 CTGAGTACCTACTAGGTGCCTGG - Intronic
1059914390 9:119082926-119082948 ATGAGTACCTACTATGTGCTAGG - Intergenic
1059920305 9:119152923-119152945 GTGAGCACCTACTATGTGCTTGG - Intergenic
1059981036 9:119772315-119772337 CTGAGTACCAACTATGTACCAGG + Intergenic
1060208001 9:121693824-121693846 TTGAGCACCTACTATGTGCTAGG + Intronic
1060373681 9:123099041-123099063 TTAAGTACCTACTATGTGCTGGG - Intronic
1060428042 9:123522929-123522951 AAGAGGCCCCACTATGTGCTAGG + Intronic
1060433431 9:123570646-123570668 CTGAGCACCTACTATGTGCTAGG - Intronic
1060516566 9:124269743-124269765 CTGAGCACCTACTATGTGCCAGG - Intronic
1060518992 9:124283230-124283252 CTGAGCACCTACTATGTGCCAGG - Intronic
1060540907 9:124429451-124429473 CAGAGCATCCATTATGTGCCTGG - Intergenic
1060713153 9:125890429-125890451 TTGAGTACCTACTATGTCCTAGG + Intronic
1060725394 9:126002718-126002740 CTGAGCACCTACTATGTGCCAGG - Intergenic
1060765474 9:126292480-126292502 TTGTGTACCTACTATGTGCTGGG - Intergenic
1060807635 9:126587743-126587765 TGGAGTGCCTACTATGTGCTAGG - Intergenic
1060930667 9:127487611-127487633 CCGAGCACCTACTATGTGCCAGG - Intronic
1060931227 9:127490728-127490750 TTGAGCACCTACTATGTGCTAGG - Intronic
1061100189 9:128486269-128486291 CTGAGAACTCACTATGTGCCAGG + Intronic
1061129577 9:128701276-128701298 CAAAGAACCTACTATGTGCCAGG + Intergenic
1061185210 9:129049026-129049048 GAGAGTACCCATTCTGTGCCAGG - Intronic
1061369602 9:130191068-130191090 CAGGGCGCCCACCATGTGCTGGG + Intronic
1061602096 9:131677103-131677125 CAAAGTTTCTACTATGTGCTAGG + Intronic
1061809533 9:133154307-133154329 CAGGGTCCCCACTGTGTGCTGGG + Intronic
1061855648 9:133440646-133440668 CAGGGGACCCACTATGTGTTGGG + Intronic
1062067884 9:134538585-134538607 CAGAGGACCCACTCTGCACTCGG + Intergenic
1062451027 9:136615910-136615932 CTGAGCACCTACTGTGTGCTGGG - Intergenic
1062548013 9:137072378-137072400 CAGAGCACCCACTGTGGGCCAGG - Intergenic
1186196988 X:7118854-7118876 CTGGGTACCTACTTTGTGCTAGG + Intronic
1186277475 X:7955705-7955727 CTAAGTACCCACTATGTGGCAGG + Intergenic
1186579051 X:10797542-10797564 AGGAGCACCGACTATGTGCTGGG - Intronic
1186701195 X:12091994-12092016 CTGAGCACCCATTATGGGCTGGG + Intergenic
1186909378 X:14145719-14145741 TTGAGTACCGACTGTGTGCTAGG + Intergenic
1187092640 X:16113342-16113364 CTGAGTATTCACTATGTGCCAGG - Intergenic
1187204211 X:17166753-17166775 CAGAGTCCCTGCTGTGTGCTGGG + Intergenic
1187408707 X:19027708-19027730 CTGAGCACCTACTATGTGCCAGG - Intronic
1187600077 X:20819232-20819254 CTGAGTACCTACTGTGTGCTAGG - Intergenic
1187746506 X:22414929-22414951 CTGAGCACCTACTAGGTGCTGGG + Intergenic
1189084729 X:38010220-38010242 CAGAGCACTTACTATGAGCTAGG - Intronic
1189222107 X:39381396-39381418 TTGAGTACCCACTGTGTGCCAGG + Intergenic
1189594764 X:42552394-42552416 CTGAATACTTACTATGTGCTAGG + Intergenic
1189926040 X:45956615-45956637 TTGAGTACCCACCATGTGCCAGG + Intergenic
1189951078 X:46231433-46231455 CAGAGGATCTACTATGTGTTAGG + Intergenic
1190007693 X:46756201-46756223 TAAAGTATCCACTGTGTGCTGGG - Intronic
1190116886 X:47631031-47631053 CAGAGCACCTACTATATGCCAGG - Intergenic
1190454616 X:50615582-50615604 CTGAGCACCCACTGTGTGCCGGG - Intronic
1190465078 X:50718089-50718111 CTGAGTGTCCACTGTGTGCTGGG + Intronic
1190476686 X:50835051-50835073 CTGAGAACCTACTATGTGCCAGG - Intergenic
1190570944 X:51780650-51780672 CTGAGTGCCCACAATGTACTAGG - Intergenic
1190798151 X:53762976-53762998 TAGAGTACTCATTATGTGCAAGG + Intergenic
1190823983 X:54000107-54000129 CTGAGTACCTACTAAGTGCTAGG + Intronic
1190879860 X:54484406-54484428 TTGAGTGCCTACTATGTGCTAGG - Intronic
1190917104 X:54819177-54819199 AAGAGTACTCATTATGTGCAAGG - Intergenic
1191661960 X:63660743-63660765 CTAAGTACCTACTATGTGCCAGG + Intronic
1191737688 X:64404531-64404553 TTGAGTACCTACTATGTGTTAGG - Intergenic
1192273487 X:69606740-69606762 TTGAGTACCTACTATGTGCCAGG - Intergenic
1193233874 X:79082612-79082634 CAGAGTACCTAATTTGGGCTAGG - Intergenic
1193684741 X:84563571-84563593 CTGAGTAACTACTATGTGCAAGG - Intergenic
1194230402 X:91315839-91315861 TTGAGGACCTACTATGTGCTAGG + Intergenic
1194667233 X:96688695-96688717 CTGAGTACCTACTGTGTGCTAGG + Intronic
1194970301 X:100335750-100335772 TTGAGTGCCCACTATGTGCCTGG - Intronic
1195430792 X:104787082-104787104 TTGAGTACCCACTTTGTGCCAGG + Intronic
1195444034 X:104930447-104930469 CTGAGTGCTCACTATGTGATAGG + Intronic
1195451104 X:105013988-105014010 CTGAATACGCACTATGTGCCTGG - Intronic
1195604773 X:106792850-106792872 TTGAGTATCTACTATGTGCTGGG - Intronic
1195713944 X:107799568-107799590 CAGAGTGACTATTATGTGCTAGG + Intergenic
1195994872 X:110721783-110721805 CTGAGCACCTACTATGTGCCAGG + Intronic
1196130438 X:112149681-112149703 TCAAGTACCTACTATGTGCTAGG + Intergenic
1196143128 X:112287521-112287543 TTGAGTACCTACTCTGTGCTAGG + Intergenic
1196175507 X:112635239-112635261 TTGAGTACCGACTATATGCTAGG + Intronic
1196198769 X:112862283-112862305 CTGAGTACCTACTATGTGCTAGG + Intergenic
1196287996 X:113905002-113905024 TTGAGTACCTACTATGTGCCAGG + Intergenic
1196397619 X:115282392-115282414 CTGAGGACCTACTATGTGCTAGG + Intergenic
1198089551 X:133314061-133314083 CTGAGCACCTACTATGTGCCAGG + Intronic
1198122421 X:133607330-133607352 CTGAGCACCCACTATGTGTCAGG - Intronic
1198221806 X:134609420-134609442 CCGAGTACCTGCTATGTGCCAGG - Intronic
1198511473 X:137356154-137356176 CTGAGCACCCACTATGTGCCAGG - Intergenic
1198749749 X:139927233-139927255 CTGAGCACCTACTATGTGCTGGG - Intronic
1199213591 X:145242589-145242611 CAGTTTATCCACTATTTGCTGGG + Intergenic
1199366491 X:146991290-146991312 CTGAGTACCTACTATTTGCTAGG - Intergenic
1199497073 X:148464421-148464443 CAGAGAACTCACTAAGTGCTAGG + Intergenic
1199814466 X:151385774-151385796 CTGAGTGCCTACTATGTGCAAGG - Intergenic
1199969001 X:152844786-152844808 GTGAGTGCCCACTTTGTGCTGGG + Intronic
1199989749 X:152979888-152979910 CTGAGCACCTACTATGTGCAGGG - Intergenic
1200042271 X:153379178-153379200 CTGAGTCCCCACTGTGTGCCAGG - Intergenic
1200413854 Y:2888048-2888070 CAGAGTACTCAATCTGTGCTAGG + Intronic