ID: 908167020

View in Genome Browser
Species Human (GRCh38)
Location 1:61468706-61468728
Sequence GATGACTGGTGCCAGTCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908167020_908167025 20 Left 908167020 1:61468706-61468728 CCAAGAGACTGGCACCAGTCATC No data
Right 908167025 1:61468749-61468771 GCCTCTTTGGTAAAAGAACATGG No data
908167020_908167023 7 Left 908167020 1:61468706-61468728 CCAAGAGACTGGCACCAGTCATC No data
Right 908167023 1:61468736-61468758 CCATCCACGTTCTGCCTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908167020 Original CRISPR GATGACTGGTGCCAGTCTCT TGG (reversed) Intergenic
No off target data available for this crispr