ID: 908167021

View in Genome Browser
Species Human (GRCh38)
Location 1:61468720-61468742
Sequence TGGATGGTTAAAATGATGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908167021_908167027 29 Left 908167021 1:61468720-61468742 CCAGTCATCATTTTAACCATCCA No data
Right 908167027 1:61468772-61468794 CTAAATAGTAAAGATCCCACTGG No data
908167021_908167025 6 Left 908167021 1:61468720-61468742 CCAGTCATCATTTTAACCATCCA No data
Right 908167025 1:61468749-61468771 GCCTCTTTGGTAAAAGAACATGG No data
908167021_908167023 -7 Left 908167021 1:61468720-61468742 CCAGTCATCATTTTAACCATCCA No data
Right 908167023 1:61468736-61468758 CCATCCACGTTCTGCCTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908167021 Original CRISPR TGGATGGTTAAAATGATGAC TGG (reversed) Intergenic
No off target data available for this crispr