ID: 908167024

View in Genome Browser
Species Human (GRCh38)
Location 1:61468740-61468762
Sequence TTTACCAAAGAGGCAGAACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908167024_908167030 22 Left 908167024 1:61468740-61468762 CCACGTTCTGCCTCTTTGGTAAA No data
Right 908167030 1:61468785-61468807 ATCCCACTGGCGGAGAAGCAGGG No data
908167024_908167029 21 Left 908167024 1:61468740-61468762 CCACGTTCTGCCTCTTTGGTAAA No data
Right 908167029 1:61468784-61468806 GATCCCACTGGCGGAGAAGCAGG No data
908167024_908167028 12 Left 908167024 1:61468740-61468762 CCACGTTCTGCCTCTTTGGTAAA No data
Right 908167028 1:61468775-61468797 AATAGTAAAGATCCCACTGGCGG No data
908167024_908167027 9 Left 908167024 1:61468740-61468762 CCACGTTCTGCCTCTTTGGTAAA No data
Right 908167027 1:61468772-61468794 CTAAATAGTAAAGATCCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908167024 Original CRISPR TTTACCAAAGAGGCAGAACG TGG (reversed) Intergenic
No off target data available for this crispr