ID: 908167025

View in Genome Browser
Species Human (GRCh38)
Location 1:61468749-61468771
Sequence GCCTCTTTGGTAAAAGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908167022_908167025 -10 Left 908167022 1:61468736-61468758 CCATCCACGTTCTGCCTCTTTGG No data
Right 908167025 1:61468749-61468771 GCCTCTTTGGTAAAAGAACATGG No data
908167020_908167025 20 Left 908167020 1:61468706-61468728 CCAAGAGACTGGCACCAGTCATC No data
Right 908167025 1:61468749-61468771 GCCTCTTTGGTAAAAGAACATGG No data
908167021_908167025 6 Left 908167021 1:61468720-61468742 CCAGTCATCATTTTAACCATCCA No data
Right 908167025 1:61468749-61468771 GCCTCTTTGGTAAAAGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908167025 Original CRISPR GCCTCTTTGGTAAAAGAACA TGG Intergenic
No off target data available for this crispr