ID: 908167027

View in Genome Browser
Species Human (GRCh38)
Location 1:61468772-61468794
Sequence CTAAATAGTAAAGATCCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908167022_908167027 13 Left 908167022 1:61468736-61468758 CCATCCACGTTCTGCCTCTTTGG No data
Right 908167027 1:61468772-61468794 CTAAATAGTAAAGATCCCACTGG No data
908167024_908167027 9 Left 908167024 1:61468740-61468762 CCACGTTCTGCCTCTTTGGTAAA No data
Right 908167027 1:61468772-61468794 CTAAATAGTAAAGATCCCACTGG No data
908167026_908167027 -1 Left 908167026 1:61468750-61468772 CCTCTTTGGTAAAAGAACATGGC No data
Right 908167027 1:61468772-61468794 CTAAATAGTAAAGATCCCACTGG No data
908167021_908167027 29 Left 908167021 1:61468720-61468742 CCAGTCATCATTTTAACCATCCA No data
Right 908167027 1:61468772-61468794 CTAAATAGTAAAGATCCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908167027 Original CRISPR CTAAATAGTAAAGATCCCAC TGG Intergenic
No off target data available for this crispr