ID: 908167028

View in Genome Browser
Species Human (GRCh38)
Location 1:61468775-61468797
Sequence AATAGTAAAGATCCCACTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908167024_908167028 12 Left 908167024 1:61468740-61468762 CCACGTTCTGCCTCTTTGGTAAA No data
Right 908167028 1:61468775-61468797 AATAGTAAAGATCCCACTGGCGG No data
908167022_908167028 16 Left 908167022 1:61468736-61468758 CCATCCACGTTCTGCCTCTTTGG No data
Right 908167028 1:61468775-61468797 AATAGTAAAGATCCCACTGGCGG No data
908167026_908167028 2 Left 908167026 1:61468750-61468772 CCTCTTTGGTAAAAGAACATGGC No data
Right 908167028 1:61468775-61468797 AATAGTAAAGATCCCACTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908167028 Original CRISPR AATAGTAAAGATCCCACTGG CGG Intergenic
No off target data available for this crispr