ID: 908167030

View in Genome Browser
Species Human (GRCh38)
Location 1:61468785-61468807
Sequence ATCCCACTGGCGGAGAAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908167024_908167030 22 Left 908167024 1:61468740-61468762 CCACGTTCTGCCTCTTTGGTAAA No data
Right 908167030 1:61468785-61468807 ATCCCACTGGCGGAGAAGCAGGG No data
908167026_908167030 12 Left 908167026 1:61468750-61468772 CCTCTTTGGTAAAAGAACATGGC No data
Right 908167030 1:61468785-61468807 ATCCCACTGGCGGAGAAGCAGGG No data
908167022_908167030 26 Left 908167022 1:61468736-61468758 CCATCCACGTTCTGCCTCTTTGG No data
Right 908167030 1:61468785-61468807 ATCCCACTGGCGGAGAAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908167030 Original CRISPR ATCCCACTGGCGGAGAAGCA GGG Intergenic
No off target data available for this crispr