ID: 908169630

View in Genome Browser
Species Human (GRCh38)
Location 1:61491915-61491937
Sequence TCATTCCCACACATATTCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908169628_908169630 1 Left 908169628 1:61491891-61491913 CCCTTGGTCAAGAACGTACAGAA No data
Right 908169630 1:61491915-61491937 TCATTCCCACACATATTCCTCGG No data
908169629_908169630 0 Left 908169629 1:61491892-61491914 CCTTGGTCAAGAACGTACAGAAT No data
Right 908169630 1:61491915-61491937 TCATTCCCACACATATTCCTCGG No data
908169627_908169630 2 Left 908169627 1:61491890-61491912 CCCCTTGGTCAAGAACGTACAGA No data
Right 908169630 1:61491915-61491937 TCATTCCCACACATATTCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908169630 Original CRISPR TCATTCCCACACATATTCCT CGG Intergenic
No off target data available for this crispr