ID: 908170429

View in Genome Browser
Species Human (GRCh38)
Location 1:61499014-61499036
Sequence CTGAGAATCAGGAGTGACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908170424_908170429 4 Left 908170424 1:61498987-61499009 CCCTGCTTTGGAGAGCGTTCAGG No data
Right 908170429 1:61499014-61499036 CTGAGAATCAGGAGTGACCAAGG No data
908170426_908170429 3 Left 908170426 1:61498988-61499010 CCTGCTTTGGAGAGCGTTCAGGT No data
Right 908170429 1:61499014-61499036 CTGAGAATCAGGAGTGACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908170429 Original CRISPR CTGAGAATCAGGAGTGACCA AGG Intergenic
No off target data available for this crispr