ID: 908178494

View in Genome Browser
Species Human (GRCh38)
Location 1:61579979-61580001
Sequence GGATTTTAACAGTTGGACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908178494_908178500 3 Left 908178494 1:61579979-61580001 CCCTGGTCCAACTGTTAAAATCC No data
Right 908178500 1:61580005-61580027 AGTTCCCAAACTCTCTCAACAGG No data
908178494_908178503 16 Left 908178494 1:61579979-61580001 CCCTGGTCCAACTGTTAAAATCC No data
Right 908178503 1:61580018-61580040 TCTCAACAGGAAACAAGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908178494 Original CRISPR GGATTTTAACAGTTGGACCA GGG (reversed) Intergenic
No off target data available for this crispr