ID: 908185395

View in Genome Browser
Species Human (GRCh38)
Location 1:61648045-61648067
Sequence CCAATACAGAGCCTGGCAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908185395_908185401 -9 Left 908185395 1:61648045-61648067 CCCATTGCCAGGCTCTGTATTGG No data
Right 908185401 1:61648059-61648081 CTGTATTGGGTGGAAGACCCTGG No data
908185395_908185402 -4 Left 908185395 1:61648045-61648067 CCCATTGCCAGGCTCTGTATTGG No data
Right 908185402 1:61648064-61648086 TTGGGTGGAAGACCCTGGCACGG No data
908185395_908185410 27 Left 908185395 1:61648045-61648067 CCCATTGCCAGGCTCTGTATTGG No data
Right 908185410 1:61648095-61648117 ACACCAGGGGACACAGATATGGG No data
908185395_908185406 12 Left 908185395 1:61648045-61648067 CCCATTGCCAGGCTCTGTATTGG No data
Right 908185406 1:61648080-61648102 GGCACGGAGGAGACTACACCAGG No data
908185395_908185403 -1 Left 908185395 1:61648045-61648067 CCCATTGCCAGGCTCTGTATTGG No data
Right 908185403 1:61648067-61648089 GGTGGAAGACCCTGGCACGGAGG No data
908185395_908185407 13 Left 908185395 1:61648045-61648067 CCCATTGCCAGGCTCTGTATTGG No data
Right 908185407 1:61648081-61648103 GCACGGAGGAGACTACACCAGGG No data
908185395_908185409 26 Left 908185395 1:61648045-61648067 CCCATTGCCAGGCTCTGTATTGG No data
Right 908185409 1:61648094-61648116 TACACCAGGGGACACAGATATGG No data
908185395_908185408 14 Left 908185395 1:61648045-61648067 CCCATTGCCAGGCTCTGTATTGG No data
Right 908185408 1:61648082-61648104 CACGGAGGAGACTACACCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908185395 Original CRISPR CCAATACAGAGCCTGGCAAT GGG (reversed) Intergenic
No off target data available for this crispr