ID: 908185400

View in Genome Browser
Species Human (GRCh38)
Location 1:61648052-61648074
Sequence CTTCCACCCAATACAGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908185400_908185408 7 Left 908185400 1:61648052-61648074 CCAGGCTCTGTATTGGGTGGAAG No data
Right 908185408 1:61648082-61648104 CACGGAGGAGACTACACCAGGGG No data
908185400_908185403 -8 Left 908185400 1:61648052-61648074 CCAGGCTCTGTATTGGGTGGAAG No data
Right 908185403 1:61648067-61648089 GGTGGAAGACCCTGGCACGGAGG No data
908185400_908185409 19 Left 908185400 1:61648052-61648074 CCAGGCTCTGTATTGGGTGGAAG No data
Right 908185409 1:61648094-61648116 TACACCAGGGGACACAGATATGG No data
908185400_908185407 6 Left 908185400 1:61648052-61648074 CCAGGCTCTGTATTGGGTGGAAG No data
Right 908185407 1:61648081-61648103 GCACGGAGGAGACTACACCAGGG No data
908185400_908185410 20 Left 908185400 1:61648052-61648074 CCAGGCTCTGTATTGGGTGGAAG No data
Right 908185410 1:61648095-61648117 ACACCAGGGGACACAGATATGGG No data
908185400_908185406 5 Left 908185400 1:61648052-61648074 CCAGGCTCTGTATTGGGTGGAAG No data
Right 908185406 1:61648080-61648102 GGCACGGAGGAGACTACACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908185400 Original CRISPR CTTCCACCCAATACAGAGCC TGG (reversed) Intergenic
No off target data available for this crispr