ID: 908185401

View in Genome Browser
Species Human (GRCh38)
Location 1:61648059-61648081
Sequence CTGTATTGGGTGGAAGACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908185395_908185401 -9 Left 908185395 1:61648045-61648067 CCCATTGCCAGGCTCTGTATTGG No data
Right 908185401 1:61648059-61648081 CTGTATTGGGTGGAAGACCCTGG No data
908185397_908185401 -10 Left 908185397 1:61648046-61648068 CCATTGCCAGGCTCTGTATTGGG No data
Right 908185401 1:61648059-61648081 CTGTATTGGGTGGAAGACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908185401 Original CRISPR CTGTATTGGGTGGAAGACCC TGG Intergenic
No off target data available for this crispr