ID: 908185403

View in Genome Browser
Species Human (GRCh38)
Location 1:61648067-61648089
Sequence GGTGGAAGACCCTGGCACGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908185397_908185403 -2 Left 908185397 1:61648046-61648068 CCATTGCCAGGCTCTGTATTGGG No data
Right 908185403 1:61648067-61648089 GGTGGAAGACCCTGGCACGGAGG No data
908185400_908185403 -8 Left 908185400 1:61648052-61648074 CCAGGCTCTGTATTGGGTGGAAG No data
Right 908185403 1:61648067-61648089 GGTGGAAGACCCTGGCACGGAGG No data
908185395_908185403 -1 Left 908185395 1:61648045-61648067 CCCATTGCCAGGCTCTGTATTGG No data
Right 908185403 1:61648067-61648089 GGTGGAAGACCCTGGCACGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908185403 Original CRISPR GGTGGAAGACCCTGGCACGG AGG Intergenic
No off target data available for this crispr