ID: 908185407

View in Genome Browser
Species Human (GRCh38)
Location 1:61648081-61648103
Sequence GCACGGAGGAGACTACACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908185397_908185407 12 Left 908185397 1:61648046-61648068 CCATTGCCAGGCTCTGTATTGGG No data
Right 908185407 1:61648081-61648103 GCACGGAGGAGACTACACCAGGG No data
908185400_908185407 6 Left 908185400 1:61648052-61648074 CCAGGCTCTGTATTGGGTGGAAG No data
Right 908185407 1:61648081-61648103 GCACGGAGGAGACTACACCAGGG No data
908185395_908185407 13 Left 908185395 1:61648045-61648067 CCCATTGCCAGGCTCTGTATTGG No data
Right 908185407 1:61648081-61648103 GCACGGAGGAGACTACACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908185407 Original CRISPR GCACGGAGGAGACTACACCA GGG Intergenic
No off target data available for this crispr