ID: 908185408

View in Genome Browser
Species Human (GRCh38)
Location 1:61648082-61648104
Sequence CACGGAGGAGACTACACCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908185400_908185408 7 Left 908185400 1:61648052-61648074 CCAGGCTCTGTATTGGGTGGAAG No data
Right 908185408 1:61648082-61648104 CACGGAGGAGACTACACCAGGGG No data
908185395_908185408 14 Left 908185395 1:61648045-61648067 CCCATTGCCAGGCTCTGTATTGG No data
Right 908185408 1:61648082-61648104 CACGGAGGAGACTACACCAGGGG No data
908185397_908185408 13 Left 908185397 1:61648046-61648068 CCATTGCCAGGCTCTGTATTGGG No data
Right 908185408 1:61648082-61648104 CACGGAGGAGACTACACCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908185408 Original CRISPR CACGGAGGAGACTACACCAG GGG Intergenic
No off target data available for this crispr