ID: 908185409

View in Genome Browser
Species Human (GRCh38)
Location 1:61648094-61648116
Sequence TACACCAGGGGACACAGATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908185397_908185409 25 Left 908185397 1:61648046-61648068 CCATTGCCAGGCTCTGTATTGGG No data
Right 908185409 1:61648094-61648116 TACACCAGGGGACACAGATATGG No data
908185395_908185409 26 Left 908185395 1:61648045-61648067 CCCATTGCCAGGCTCTGTATTGG No data
Right 908185409 1:61648094-61648116 TACACCAGGGGACACAGATATGG No data
908185404_908185409 -5 Left 908185404 1:61648076-61648098 CCCTGGCACGGAGGAGACTACAC No data
Right 908185409 1:61648094-61648116 TACACCAGGGGACACAGATATGG No data
908185405_908185409 -6 Left 908185405 1:61648077-61648099 CCTGGCACGGAGGAGACTACACC No data
Right 908185409 1:61648094-61648116 TACACCAGGGGACACAGATATGG No data
908185400_908185409 19 Left 908185400 1:61648052-61648074 CCAGGCTCTGTATTGGGTGGAAG No data
Right 908185409 1:61648094-61648116 TACACCAGGGGACACAGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908185409 Original CRISPR TACACCAGGGGACACAGATA TGG Intergenic
No off target data available for this crispr