ID: 908188484

View in Genome Browser
Species Human (GRCh38)
Location 1:61675864-61675886
Sequence TTGTATAGTGATTAGGAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908188481_908188484 6 Left 908188481 1:61675835-61675857 CCAGTTGAGGGCATAAAAGGGAA No data
Right 908188484 1:61675864-61675886 TTGTATAGTGATTAGGAGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908188484 Original CRISPR TTGTATAGTGATTAGGAGGA CGG Intergenic
No off target data available for this crispr