ID: 908191729

View in Genome Browser
Species Human (GRCh38)
Location 1:61710825-61710847
Sequence GTACTATTCTTGCCTAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908191729_908191730 -7 Left 908191729 1:61710825-61710847 CCTCTTTTAGGCAAGAATAGTAC No data
Right 908191730 1:61710841-61710863 ATAGTACACTGAGAAAACGATGG 0: 1
1: 0
2: 2
3: 7
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908191729 Original CRISPR GTACTATTCTTGCCTAAAAG AGG (reversed) Intronic
No off target data available for this crispr