ID: 908198507

View in Genome Browser
Species Human (GRCh38)
Location 1:61769923-61769945
Sequence GGGAGATAACATAGACTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908198507_908198511 6 Left 908198507 1:61769923-61769945 CCCTCAAGTCTATGTTATCTCCC No data
Right 908198511 1:61769952-61769974 GCATTTGCTTTTATTTTTTAAGG No data
908198507_908198512 7 Left 908198507 1:61769923-61769945 CCCTCAAGTCTATGTTATCTCCC No data
Right 908198512 1:61769953-61769975 CATTTGCTTTTATTTTTTAAGGG 0: 1
1: 1
2: 22
3: 247
4: 2113
908198507_908198513 8 Left 908198507 1:61769923-61769945 CCCTCAAGTCTATGTTATCTCCC No data
Right 908198513 1:61769954-61769976 ATTTGCTTTTATTTTTTAAGGGG 0: 1
1: 0
2: 26
3: 286
4: 2839

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908198507 Original CRISPR GGGAGATAACATAGACTTGA GGG (reversed) Intronic
No off target data available for this crispr