ID: 908198993

View in Genome Browser
Species Human (GRCh38)
Location 1:61774534-61774556
Sequence GTGAAGAATCTAATGGTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 128}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908198993_908198996 6 Left 908198993 1:61774534-61774556 CCTACCACCATTAGATTCTTCAC 0: 1
1: 0
2: 1
3: 7
4: 128
Right 908198996 1:61774563-61774585 ATTTTCTTAAACCACTACTTTGG 0: 1
1: 0
2: 3
3: 23
4: 308

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908198993 Original CRISPR GTGAAGAATCTAATGGTGGT AGG (reversed) Intronic
901105725 1:6754893-6754915 GTCATGAAGCAAATGGTGGTGGG + Intergenic
902079606 1:13812134-13812156 GTGGAGAATGGATTGGTGGTGGG + Intronic
905887762 1:41500849-41500871 GTGAAGAATCTAATTGTCAGAGG + Intergenic
908198993 1:61774534-61774556 GTGAAGAATCTAATGGTGGTAGG - Intronic
908557934 1:65276176-65276198 GTAAAGAATCTAATAGAGGCTGG - Intronic
909259520 1:73469216-73469238 GTGCAGAAATTAATGGTAGTTGG + Intergenic
909671347 1:78192084-78192106 GTCAAGGATCAAATGGTTGTAGG + Intergenic
910164827 1:84315268-84315290 GCAAAGAATAGAATGGTGGTTGG - Intronic
911124250 1:94325595-94325617 GTGCAGTGTCTAATGTTGGTGGG - Intergenic
911233271 1:95382735-95382757 GTGAGGAATCAAATTGTGGATGG + Intergenic
917809040 1:178639858-178639880 GTTAAAAATCAAATGGTTGTTGG - Intergenic
920691999 1:208154217-208154239 GTGAAGACTCTGCTGGTGCTGGG + Intronic
1064754072 10:18559037-18559059 GTGAAGAATGGAATGGAGGATGG + Intronic
1065452907 10:25877431-25877453 GTGAACAATCAAATTGTGGAAGG + Intergenic
1069740771 10:70685800-70685822 GTGATTGGTCTAATGGTGGTGGG + Intronic
1070750208 10:78959642-78959664 GAGAAGGCTCTGATGGTGGTGGG + Intergenic
1070798662 10:79232024-79232046 TTGGAGAATCTAGTGGAGGTTGG + Intronic
1071755700 10:88536415-88536437 GTGGAGAATAGATTGGTGGTGGG - Intronic
1076899849 10:133333212-133333234 GAGGAGAATCTAAGGGTGGAAGG + Intronic
1077606584 11:3616580-3616602 AGGAAGAATATAATGGTGGCTGG + Intergenic
1080032904 11:27680813-27680835 CAGAAGTATGTAATGGTGGTAGG - Intronic
1080050384 11:27852916-27852938 GTGCAAAATCTAATAGTGGAAGG - Intergenic
1080554985 11:33407704-33407726 GAGAAGACTCTAATGAGGGTTGG + Intergenic
1080815481 11:35752353-35752375 GTGAAGAATGGAATGGCAGTGGG - Intronic
1083222008 11:61258754-61258776 GTGGAGAGTCTAGAGGTGGTGGG + Exonic
1088181663 11:107120309-107120331 TTGCTGAATCTAATGGTGGTTGG - Intergenic
1095372375 12:41484521-41484543 GTGAAAAACCTCATTGTGGTGGG - Intronic
1098062130 12:66574099-66574121 GTGCAGAAACAAATGGTTGTAGG + Intronic
1099583357 12:84482506-84482528 TTGAAGATTGGAATGGTGGTGGG + Intergenic
1101525608 12:105526294-105526316 GTGAAGAAACTGATATTGGTAGG + Intergenic
1111836547 13:93395537-93395559 GTGAAGAATATATTTGTTGTTGG - Intronic
1112784561 13:102937912-102937934 AAGAAGATTCTAATGGGGGTGGG + Intergenic
1114158606 14:20136269-20136291 GAGAATAAACTAATTGTGGTAGG + Intergenic
1114604153 14:23982654-23982676 GTCAAAAATCTGATGGTTGTAGG - Intronic
1114609176 14:24025453-24025475 GTCAAAAATCTGATGGTTGTAGG - Intergenic
1115019740 14:28661586-28661608 GTTAGGAATGAAATGGTGGTTGG - Intergenic
1116504406 14:45661032-45661054 GTGAAGAATGTCATTGTCGTTGG + Intergenic
1116596144 14:46848100-46848122 GTGAAGAGTCTAATAAAGGTGGG + Intronic
1118417012 14:65550479-65550501 GTGAAGAACAAAATGGTTGTAGG + Intronic
1123058607 14:105584245-105584267 GTGAGGAAGGTGATGGTGGTGGG + Intergenic
1123082938 14:105704479-105704501 GTGAGGAAGGTGATGGTGGTGGG + Intergenic
1126276579 15:46890604-46890626 GTGAGGAATCTAAAGGTCATTGG + Intergenic
1128580751 15:68808004-68808026 GTGAACAATCCCATGGTGGTGGG + Intronic
1134010312 16:10847149-10847171 ATGCAGAATCTTTTGGTGGTAGG + Intergenic
1140884203 16:79228764-79228786 AAGACGAATATAATGGTGGTGGG + Intergenic
1141660494 16:85438773-85438795 GTGAAGAAGCAAAGGGTGCTGGG + Intergenic
1143797349 17:9348026-9348048 GTGAAATAAATAATGGTGGTTGG + Intronic
1144070890 17:11670407-11670429 GTCGAGATTCTAATTGTGGTGGG - Intronic
1146072550 17:29697060-29697082 GTGAAGATTCAAATAATGGTTGG - Intronic
1146751558 17:35386192-35386214 GTGAAATATCTGATGGTTGTAGG + Intergenic
1150452319 17:65279204-65279226 TTAAAGAATCTGATGGTGGCTGG - Intergenic
1150965938 17:69968371-69968393 GTGTAAAATCTAATGGTGGTGGG + Intergenic
1153129246 18:1835425-1835447 GTGAAGAATGTATTGGTATTTGG - Intergenic
1158753377 18:60292614-60292636 TTTAAGAATCATATGGTGGTAGG - Intergenic
1158888893 18:61855030-61855052 TTAAATAAGCTAATGGTGGTGGG + Intronic
1159418763 18:68187575-68187597 GTGAAGATTCTAAGGGTCCTTGG + Intergenic
1160625133 18:80198928-80198950 GTGTAGAATTCAATGGTTGTTGG + Intronic
1162174080 19:8817335-8817357 GTGAAAAATAGAATGGTTGTAGG - Intronic
1163921136 19:20290003-20290025 GTCAAAAATCTGATGGTTGTAGG + Intergenic
1163926899 19:20354343-20354365 GTAAAAAATCTGATGGTTGTAGG - Intergenic
926172207 2:10559408-10559430 GTAAAGAATCTGATGGTGCCTGG + Intergenic
930266548 2:49206906-49206928 GTGAAGGATCTAAAGCTGGAAGG + Intergenic
931069813 2:58633174-58633196 GTGAAAAATTAAAAGGTGGTTGG + Intergenic
932195679 2:69781030-69781052 GAAAAGATTCTAATGTTGGTTGG + Intronic
932220892 2:69998192-69998214 GTTAAGAAGCTATTGGTGGGAGG - Intergenic
933611501 2:84440821-84440843 GTGAAGATTTTTTTGGTGGTGGG - Intronic
938051400 2:128175797-128175819 AGGAAGATTCTAATGGGGGTGGG - Intronic
939892055 2:147747945-147747967 ATGAATAATCTGATTGTGGTGGG - Intergenic
940031880 2:149272257-149272279 GTGAGGAATCCAACGGTGGTAGG + Intergenic
940674517 2:156712446-156712468 GTGAAGAATGTGTTGGTAGTTGG + Intergenic
943545159 2:189267067-189267089 GCCAAGAATCTTATGGTGGTGGG + Intergenic
943545222 2:189267846-189267868 GCCAAGAATCTTTTGGTGGTGGG - Intergenic
944027464 2:195188466-195188488 GTTAAAATTCTAATAGTGGTTGG + Intergenic
946939965 2:224760246-224760268 GACAAGAATCTAATGGAGCTTGG + Intergenic
948377780 2:237533173-237533195 GTGAAGAGTCTAACGTGGGTGGG - Intronic
1168763087 20:362926-362948 GTGAAGAATGGAATGGGGGAGGG + Intronic
1173295998 20:41757911-41757933 GTGAAAAATCAGATGGTTGTAGG + Intergenic
1173432060 20:42997171-42997193 GTGTAGAAGCAAATGGGGGTGGG - Intronic
1178186846 21:30231991-30232013 GTCAAAGATCAAATGGTGGTAGG - Intergenic
1178506098 21:33164513-33164535 GAGAAGAAGCTTCTGGTGGTTGG - Intergenic
1180033244 21:45226775-45226797 GTCAAGAATCTAACAGGGGTGGG - Intergenic
1182155217 22:28065242-28065264 TGGAAGAATCTCATGTTGGTGGG - Intronic
951921315 3:27857618-27857640 GTCAAGGATCAAATGGTTGTAGG - Intergenic
955033227 3:55241016-55241038 GTGAAGAATAAAGTGGCGGTAGG - Intergenic
955297909 3:57750118-57750140 GTGAAGAATCTACAGATGATTGG + Intergenic
955853265 3:63244293-63244315 GGGAAGACTCTAATGGAAGTGGG - Intronic
959392709 3:105796051-105796073 GTGAAGAATGTCATTGTGGAAGG - Intronic
961016540 3:123472715-123472737 GTTAAGAATCTACTGGGGTTAGG - Intergenic
962083862 3:132169957-132169979 ATGCAGAATCTAATGGGGGTGGG + Intronic
962626757 3:137233123-137233145 GTGAAGCATAAAATGATGGTGGG - Intergenic
963908563 3:150795013-150795035 GACAGGAATCTGATGGTGGTGGG - Intergenic
970404295 4:15747506-15747528 GTAAAGAATGTGATGGTGATGGG - Intergenic
971550561 4:27950571-27950593 GTTAAAAATCAAATGGTTGTAGG - Intergenic
976334473 4:83869725-83869747 GTGAAGAATGGACTGGTGGGAGG - Intergenic
977165202 4:93686349-93686371 GTAAAGAAGCTAGTGGTGATGGG - Intronic
980665672 4:135930627-135930649 GTCAAAAATCAGATGGTGGTAGG - Intergenic
981398380 4:144281685-144281707 GAGAGAAAACTAATGGTGGTAGG + Intergenic
981721046 4:147801675-147801697 GTAAAGAATATAATGAAGGTTGG + Intronic
986528297 5:8704611-8704633 ATGAAGAATCTAATGTTTGCAGG + Intergenic
986819650 5:11451361-11451383 GTGAAGAATTATATTGTGGTTGG - Intronic
990564774 5:57018074-57018096 GTGATGAACCTAATGGTGGGTGG + Intergenic
993421620 5:87708862-87708884 GTGAAAAATGTAATGCTGATAGG + Intergenic
995327146 5:110903651-110903673 GTGAAAAATCTAATGAGGGAAGG + Intergenic
999233800 5:150078542-150078564 GTGAAGAATCTAGGTGTGGGGGG - Intronic
999539793 5:152558925-152558947 ATGAAGGATTTTATGGTGGTGGG - Intergenic
1000869525 5:166558493-166558515 TGAAAAAATCTAATGGTGGTGGG + Intergenic
1001418788 5:171571016-171571038 CTGAGGAATCTCGTGGTGGTGGG - Intergenic
1004049364 6:12060058-12060080 GTGAACAATATAAACGTGGTGGG - Intronic
1006786596 6:36671909-36671931 GTGAAGAATGGAGTGGAGGTGGG + Intergenic
1007151673 6:39699246-39699268 GTGAGGAATGCCATGGTGGTTGG + Intronic
1008917467 6:56804176-56804198 GGTAAAAATCTAATTGTGGTTGG - Intronic
1011946376 6:92909196-92909218 GTGAAGAAACTCATGATGGTAGG + Intergenic
1012460990 6:99459846-99459868 GTGGAGCACCAAATGGTGGTGGG + Intronic
1015720538 6:136236606-136236628 GAGAAGAATCTCATGGCTGTAGG - Intronic
1015814311 6:137192414-137192436 TTGATGAATCTATTGGTGCTTGG - Intergenic
1016794803 6:148106683-148106705 GTGAAAAATCTCATGGTATTAGG + Intergenic
1018876070 6:167824311-167824333 GTCAATAAACTAATGTTGGTTGG + Intergenic
1022060968 7:26794669-26794691 TTTTACAATCTAATGGTGGTGGG - Intronic
1022426280 7:30271839-30271861 TTAAAGAATCTGATGCTGGTTGG + Intergenic
1029922032 7:104275508-104275530 GTGAAGTATCCAGTGGTGATTGG - Intergenic
1035128033 7:156624681-156624703 GTAGAGAGTCGAATGGTGGTTGG + Intergenic
1039626406 8:39059148-39059170 GTGTAGAATATTATGATGGTGGG + Intronic
1042579294 8:70258676-70258698 GAGAAGAAGTTATTGGTGGTGGG - Intronic
1052420072 9:28232784-28232806 GCAAAGAGTATAATGGTGGTTGG - Intronic
1052708957 9:32029101-32029123 GTGAAGAAATGAATGGTTGTGGG - Intergenic
1054913618 9:70476347-70476369 GTGAAGAATCCAGGGGTGGAAGG - Intergenic
1058955413 9:109942372-109942394 GTGAAGAATTTCATGGAGGCTGG - Intronic
1060175718 9:121496300-121496322 GGAAAGAACCAAATGGTGGTTGG - Intergenic
1060678569 9:125540193-125540215 GTGAAAAATCAGAAGGTGGTAGG - Intronic
1187804218 X:23100570-23100592 GTGAAGAAAATGAGGGTGGTGGG - Intergenic
1188355302 X:29183367-29183389 TTGAACAATCAAATGGTGGGGGG - Intronic
1189134985 X:38539555-38539577 CTGAAGGATCTAGTGGTAGTTGG - Intronic
1193300259 X:79881060-79881082 GTGAAGAAACTGAGGGTGGATGG + Intergenic
1193385292 X:80863699-80863721 GTGAAGGATCAGATGGTTGTAGG + Intergenic
1195241213 X:102954036-102954058 GTTAAGGATCAGATGGTGGTAGG + Intergenic
1195654468 X:107321931-107321953 GTGAAGAAATTAAGTGTGGTGGG + Intergenic
1201143450 Y:11047446-11047468 GTGATGAGTCTAGTGGTGGATGG + Intergenic