ID: 908199645

View in Genome Browser
Species Human (GRCh38)
Location 1:61781085-61781107
Sequence CACCTAGCTGCTGTAACCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908199645_908199647 -8 Left 908199645 1:61781085-61781107 CCCTAGGTTACAGCAGCTAGGTG No data
Right 908199647 1:61781100-61781122 GCTAGGTGAGCCACAAAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908199645 Original CRISPR CACCTAGCTGCTGTAACCTA GGG (reversed) Intronic
No off target data available for this crispr