ID: 908199733

View in Genome Browser
Species Human (GRCh38)
Location 1:61781890-61781912
Sequence CTGTCCTATATGACTCCATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 112}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908199733_908199736 -1 Left 908199733 1:61781890-61781912 CCCCATGGAGTCATATAGGACAG 0: 1
1: 0
2: 2
3: 14
4: 112
Right 908199736 1:61781912-61781934 GACACACTTAAGTCTTCCAGTGG 0: 1
1: 0
2: 0
3: 10
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908199733 Original CRISPR CTGTCCTATATGACTCCATG GGG (reversed) Intronic
900927123 1:5712714-5712736 CTGCCCTTTATGACTCCTTGAGG - Intergenic
902141773 1:14362801-14362823 CAGACCTATTTGACTCCAAGGGG + Intergenic
908199733 1:61781890-61781912 CTGTCCTATATGACTCCATGGGG - Intronic
910629996 1:89344484-89344506 CTCTCCTGTATGTCTCCTTGTGG - Intergenic
915018244 1:152756909-152756931 CTGTCCATTTTGACTCTATGTGG + Intronic
916691697 1:167195913-167195935 CTGTCCCTTATGATTCCCTGTGG + Intergenic
917300991 1:173574089-173574111 CTGTTCTGTATGGTTCCATGTGG + Intronic
922195079 1:223352818-223352840 CTGTCCTACCTGAGCCCATGGGG + Intronic
924025036 1:239823302-239823324 CTCTCCTCTATGATTCTATGAGG - Intronic
1066452478 10:35543343-35543365 GTGTCCTGTATGACTCCATTGGG - Intronic
1066552078 10:36569754-36569776 CTCTCATACATGACTACATGTGG - Intergenic
1069292908 10:66805137-66805159 ATGTCCTGTATGACTCCACTGGG + Intronic
1071828381 10:89348272-89348294 CTCTCCTTTATGCCTCCCTGGGG + Intronic
1074916192 10:117957854-117957876 CTCTCCTATTAGACTCCATGGGG - Intergenic
1075582650 10:123633969-123633991 CTGCCCTCTGTGACTCCATGAGG - Intergenic
1077555462 11:3223971-3223993 CTGCCCTATGTGGCCCCATGGGG - Intergenic
1080455836 11:32418265-32418287 CAGTTCTATAAGACTCTATGAGG + Intronic
1084673223 11:70619752-70619774 CTGTCCTGGCTGCCTCCATGAGG + Intronic
1086061151 11:82701105-82701127 TTGTCCTCTTTGACTCCATGAGG + Intergenic
1087582394 11:100074476-100074498 CAGTCTTCTTTGACTCCATGGGG + Intronic
1089986783 11:122822003-122822025 CTGACCTAACTGACTCCATCTGG + Intergenic
1090808283 11:130216511-130216533 CTGTCCTATTTGTCTTCATTGGG - Intergenic
1092973519 12:13721771-13721793 CTTTCCTAGATGACTTCATCTGG - Intronic
1095714454 12:45327002-45327024 TAGGCCTATATGATTCCATGTGG - Intronic
1101974453 12:109343826-109343848 CTGTCCTAGCTGACTCGCTGGGG + Intergenic
1104146202 12:126036161-126036183 GTGTCCTGTGTGACTCCATGGGG - Intergenic
1104291915 12:127477584-127477606 ATGTCCAATGTGACTACATGGGG + Intergenic
1104765294 12:131326209-131326231 CTGTCCTAGATGCCTTCCTGTGG - Intergenic
1109639023 13:65162699-65162721 CTGACGTATATAACCCCATGTGG - Intergenic
1110565370 13:76952412-76952434 CTGTTCTATAAGACACCTTGAGG - Intronic
1112237466 13:97649211-97649233 ATGTCCTCTCTGACTCCCTGTGG - Intergenic
1115776735 14:36723817-36723839 CTGTCCCATTTGAGTCCTTGTGG + Intronic
1115848580 14:37567253-37567275 ATGTCCTTTAAGACTCCATATGG + Intergenic
1118346099 14:64942266-64942288 TTCTACTATATTACTCCATGAGG - Intronic
1129579547 15:76792778-76792800 CTGTCATAGCTGACACCATGTGG + Intronic
1129891949 15:79077349-79077371 CTGTCCTAAACAACCCCATGAGG - Intronic
1131373716 15:91906108-91906130 CTCTCCACTATGATTCCATGAGG - Intronic
1131627269 15:94134668-94134690 CTGTCCTATGTGGCTCCAAGTGG + Intergenic
1137795588 16:51215006-51215028 CTATCCTAAATGACTCCATGGGG - Intergenic
1140401580 16:74676212-74676234 CTGTGCTATCTGACTTTATGGGG + Intronic
1141294209 16:82751558-82751580 CTGTCCTATAATTCTGCATGTGG - Intronic
1143865191 17:9918200-9918222 CTGTCCCATCTGACTCTCTGGGG + Intronic
1144229972 17:13192172-13192194 ATGTTGTCTATGACTCCATGGGG + Intergenic
1146585261 17:34076744-34076766 CTGGTCTTTCTGACTCCATGAGG + Intronic
1155064177 18:22254556-22254578 CTGCCCCATAAGACTCCAGGGGG - Intergenic
1157624584 18:49040553-49040575 CTGACCTCTTTGACTCCAGGAGG + Intergenic
1164374262 19:27671843-27671865 CTGTATTATAAGACTGCATGAGG + Intergenic
1167537247 19:50062035-50062057 CTGGACTATAAGACTCCAAGTGG + Intergenic
930854403 2:55997297-55997319 CTGTGCTAGATGACTCCACATGG - Intergenic
931554344 2:63484003-63484025 CTGTCCAATATGATAACATGTGG + Intronic
932038549 2:68273977-68273999 GTGTCATATGTTACTCCATGGGG + Intergenic
933425984 2:82112732-82112754 CTGTCCTAGATGCTACCATGGGG + Intergenic
935586216 2:104802193-104802215 CTGACATAAATGACTCCAGGAGG + Intergenic
937931107 2:127205766-127205788 CTGTCTGATATCATTCCATGGGG + Exonic
940173735 2:150855845-150855867 CAGACCTATAAGACTCTATGAGG + Intergenic
941605106 2:167586889-167586911 CTCTCCTATATGAATCCATTTGG - Intergenic
943201508 2:184832293-184832315 CTGACTTATATGACTCCTTTAGG + Intronic
946291082 2:218746011-218746033 CTGTCCTACATGAGGCCCTGGGG - Intronic
947304495 2:228728790-228728812 CAGTCCAAGATGACTCCAGGTGG - Intergenic
948112114 2:235464423-235464445 CTGTCCTAGATGACTCCTTGGGG - Intergenic
1168947915 20:1777060-1777082 CTGTCCTTTTTGACTTCACGTGG + Intergenic
1170941653 20:20853284-20853306 CTGCCCTAGTAGACTCCATGAGG + Intergenic
1171208394 20:23298827-23298849 CTGGCCTTTATGACTCCAGTAGG - Intergenic
1172561298 20:35890947-35890969 CTCTCCTATATGTTTCCATGAGG - Intronic
1174283966 20:49459233-49459255 GTGGCCTATAAGACTCCATGAGG - Intronic
1176022460 20:62968874-62968896 CTGGGCTGTCTGACTCCATGGGG - Exonic
1176516387 21:7787115-7787137 CTGACCTGTATGAGTTCATGGGG + Intergenic
1178650415 21:34417127-34417149 CTGACCTGTATGAGTTCATGGGG + Intergenic
1184555417 22:45230092-45230114 TTGTCCCATATGTCCCCATGTGG - Intronic
1185118237 22:48950188-48950210 CTGTCCTATGTGCCCCCAGGAGG - Intergenic
949363728 3:3258502-3258524 CTTTCCTGTATGACTCCTTAGGG - Intergenic
950429471 3:12942645-12942667 CTGTACTGTATGCCTACATGGGG + Intronic
950534935 3:13573170-13573192 CTGCCCTATATGGCTCCCTCCGG + Intronic
952559193 3:34569776-34569798 CTTTCCTGTGTGACTCCATTAGG + Intergenic
954128448 3:48546918-48546940 GCGTCCTGTGTGACTCCATGAGG + Intronic
955210869 3:56939753-56939775 TTTTCCTGTCTGACTCCATGTGG - Intronic
957506059 3:81122515-81122537 CTGTCCTACCTGTTTCCATGTGG + Intergenic
960622866 3:119653424-119653446 GTGTCCCAGAGGACTCCATGGGG - Intronic
960940083 3:122927797-122927819 CTGCCCAATATAACTCCAAGTGG - Exonic
966948058 3:184791361-184791383 CTGTGCTTTATGTTTCCATGGGG - Intergenic
969568713 4:7995529-7995551 CTGTCCTCATTGAGTCCATGAGG - Intronic
970317853 4:14846496-14846518 CTGTGCTTTATAACTCCAAGTGG + Intergenic
970647531 4:18139398-18139420 GTGTCCTATTTAACTCCATTGGG + Intergenic
972504478 4:39707494-39707516 CTGGCCTGTATGACTGTATGAGG + Intronic
974995401 4:69151595-69151617 CTGTCATATATAACAACATGAGG + Intronic
976829962 4:89304709-89304731 TTGTCCTAGATGACTCCAAAAGG - Intronic
979205954 4:118038251-118038273 CTGCCCTATATGACTTAAGGGGG - Intronic
981732383 4:147913331-147913353 CTTTCCTATATGAAAACATGAGG + Intronic
984894810 4:184528903-184528925 CAGTCATACATGACCCCATGTGG + Intergenic
985172972 4:187172253-187172275 TTGTCTTAATTGACTCCATGTGG + Intergenic
985304830 4:188528171-188528193 TTTTCCTATATTGCTCCATGTGG - Intergenic
987650672 5:20736459-20736481 CTATCCTTTCTGACTCCAAGAGG - Intergenic
988744881 5:34125002-34125024 CTATCCTTTCTGACTCCAAGAGG + Intergenic
992084335 5:73264434-73264456 CTGTCTTACATGTCTCCATAAGG - Intergenic
995230585 5:109757016-109757038 ACATCCTGTATGACTCCATGGGG + Intronic
995555076 5:113319430-113319452 CCGTCCTATTTGATGCCATGTGG + Intronic
1000089097 5:157914653-157914675 CTGGACTTTATGTCTCCATGAGG + Intergenic
1002786999 6:409456-409478 GTGTGCAAGATGACTCCATGAGG - Exonic
1008866039 6:56210763-56210785 CTGTGTTATATGACACCAAGAGG + Intronic
1012034582 6:94116953-94116975 CTGCCATTTATGACTCAATGGGG - Intergenic
1012833919 6:104241340-104241362 ATGTCCTGTGTGACTCCATGGGG + Intergenic
1013385293 6:109623555-109623577 CTGTCCTAAATGCTTTCATGAGG - Intronic
1013700859 6:112767765-112767787 ATGTCCTGTCTGACTCCATTGGG + Intergenic
1014105742 6:117558660-117558682 ATGTCCTGTGTGACTCCATTGGG - Intronic
1014150755 6:118052048-118052070 CTGTACTTCATGACTCCAGGTGG + Intronic
1015194100 6:130506477-130506499 CTGGCCAATCTGATTCCATGAGG - Intergenic
1017630741 6:156394113-156394135 CTGTCCAATATTACTGCATGAGG + Intergenic
1019340753 7:507762-507784 CTGTCCTGTGTGCCTCCCTGGGG - Intronic
1019768535 7:2869161-2869183 CGTTCGTATGTGACTCCATGGGG - Intergenic
1023061506 7:36331832-36331854 CCTTAATATATGACTCCATGTGG - Intronic
1028488235 7:91383467-91383489 CTATCCCATATGACCACATGGGG - Intergenic
1034929308 7:155148930-155148952 CTGTCCCATCTGACTCCATTTGG - Intergenic
1035919426 8:3661145-3661167 CTTTCGTATATGACTCCTTGTGG + Intronic
1040962900 8:53053704-53053726 CTGGCCTCCATGACACCATGGGG + Intergenic
1042455000 8:68990563-68990585 CTGTCCTCAATGACCCCATCTGG + Intergenic
1043135351 8:76516472-76516494 CTGTCCTAGATGACAAGATGGGG + Intergenic
1044523364 8:93224794-93224816 AGGAACTATATGACTCCATGTGG + Intergenic
1047523378 8:125612802-125612824 CTGTGCTGCATGACTCCAAGAGG + Intergenic
1048170934 8:132105560-132105582 CTATCCTATAGTTCTCCATGTGG + Intronic
1049342584 8:142121114-142121136 CTGTCCTGTCTGTCTCCAGGTGG + Intergenic
1055582955 9:77727316-77727338 CTGCCCTATAAGAGTCTATGTGG - Intronic
1056547919 9:87628185-87628207 CTGTTCTATGAGAATCCATGCGG + Intronic
1057861776 9:98646395-98646417 GTGTCCTATGTGACTCCACCGGG + Intronic
1061078971 9:128358773-128358795 CCGTCCAATATGACCTCATGTGG - Intronic
1187937767 X:24352641-24352663 ATGTCCTATGTGACTCCACTGGG + Intergenic
1188785702 X:34343769-34343791 CTTTCCTCTATGACTAGATGAGG + Intergenic
1189776275 X:44472573-44472595 TTGGCCTATGGGACTCCATGAGG - Intergenic
1191976637 X:66878952-66878974 GTCTCCTATATGCCACCATGGGG + Intergenic
1194958430 X:100208116-100208138 CTGGCCTATCTGCCTCCAGGTGG - Intergenic