ID: 908205603

View in Genome Browser
Species Human (GRCh38)
Location 1:61845077-61845099
Sequence CTGTGGTTTCAGGTATCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 990
Summary {0: 2, 1: 7, 2: 39, 3: 219, 4: 723}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908205603 Original CRISPR CTGTGGTTTCAGGTATCTGC TGG Intronic
900087024 1:903681-903703 CTGTGGATTTTGGTATCTGTGGG - Intergenic
900350759 1:2233446-2233468 CTGGGAATTCAGGCATCTGCAGG - Intronic
901100742 1:6716706-6716728 CTGAGGCTTCAGGCATCCGCTGG + Intergenic
901929666 1:12588967-12588989 CTGTGGTTTGGGGTCTCTGGCGG - Intronic
902253657 1:15172950-15172972 CTGTTGTTTCAGGCATCCACTGG + Intronic
902307140 1:15550007-15550029 ATGTGGTTTCAGGCACCTACTGG + Intronic
902890057 1:19436622-19436644 CTGTGGTTTCAGGCATCCAATGG + Intronic
903057119 1:20643855-20643877 CTGTGGCTTCAGGCATCCACTGG - Intronic
903078868 1:20792889-20792911 CCGTGGTTTCAGGCATCTACTGG - Intergenic
903561156 1:24229011-24229033 CTGTGGATTTTGGTATCTTCAGG + Intergenic
903841000 1:26240352-26240374 CTGTGGATTTTGCTATCTGCAGG - Intronic
903965552 1:27086983-27087005 CTGTGGTGTGAGGTATGTGTGGG - Intergenic
904060000 1:27701480-27701502 GTGTGGTTTCATTAATCTGCTGG - Intergenic
904692768 1:32306781-32306803 CCATGGTTTCAGGAATCTACTGG - Intronic
905115582 1:35636807-35636829 CTATGGATTTGGGTATCTGCAGG + Intronic
905486721 1:38302784-38302806 TTGTGGTTTCAGGCATCCACTGG + Intergenic
906084809 1:43122408-43122430 CTGTGGTTTCAGGCATCCACTGG - Intergenic
906623246 1:47302726-47302748 CTGTGGTTTCAGACATCCACTGG - Intronic
906684840 1:47756616-47756638 CTGTGTTTTCAGGTCTCCCCGGG + Intergenic
906855971 1:49305345-49305367 ATGTGGATTTTGGTATCTGCAGG - Intronic
906871869 1:49491850-49491872 CTGTGGTTTCAGGCATCCACTGG - Intronic
906975238 1:50563112-50563134 CTGTGGATTTTGGTATCTGCAGG + Intronic
907250469 1:53134754-53134776 CTGTGGTTTCAGGCATCCACTGG - Intronic
907279084 1:53333451-53333473 CTGAGGATTTTGGTATCTGCAGG - Intergenic
907573997 1:55509478-55509500 CTGTGGATTTTGGTATCTGTGGG + Intergenic
908205603 1:61845077-61845099 CTGTGGTTTCAGGTATCTGCTGG + Intronic
908352721 1:63301983-63302005 CTGTGGTTTCAGGCATCCACTGG - Intergenic
908670494 1:66542049-66542071 CTGTAGTTTCAGGCATCCGCTGG - Intronic
908875084 1:68664121-68664143 CTGTGGTTTCAGGCATCCACTGG - Intergenic
909001608 1:70224199-70224221 CTGTGGATTTTGTTATCTGCAGG + Intronic
909366321 1:74827171-74827193 GTGAAGTTTCAGGCATCTGCTGG - Intergenic
909580156 1:77224273-77224295 CTGTGATTTCAGGTATCCACTGG - Intergenic
910076646 1:83288186-83288208 CTGTGGTTTTAGGCATCCACTGG - Intergenic
910186172 1:84542892-84542914 CTGTGTTTTCAGGCATCCACAGG - Intergenic
910415884 1:86997676-86997698 CTGTGGTTTCAGGCATCTACTGG - Intronic
910737077 1:90471194-90471216 CTGTGGTTTCAGGCATCCACTGG - Intergenic
911243335 1:95489334-95489356 CTGTGGCTTCAGGAAGCTCCAGG + Intergenic
911356162 1:96823314-96823336 CTGTGCTTTCAGGTCTCCCCAGG + Intronic
911557630 1:99364206-99364228 CTGTGGTTTCAGGCATCCATTGG - Intergenic
911905633 1:103565110-103565132 CTGTGGTTTCAGGCACCTGCTGG - Intronic
912375827 1:109209325-109209347 CCGTGGTTTCAGGCATCCACTGG + Intergenic
912783456 1:112575297-112575319 TTGTGGTTTCAGATATCCACTGG - Intronic
915941588 1:160121611-160121633 CTGTGGTTACAGTGATTTGCTGG + Intronic
916894615 1:169149483-169149505 ATGTGGTTTCAGGTATCCGCTGG - Intronic
916933125 1:169600432-169600454 CTGGGGATTCTGGTATCTGCAGG + Intronic
916968561 1:169981628-169981650 CTGTAGTTTCAGGCATCTGCTGG + Intronic
917147681 1:171910464-171910486 CTGTGGTTTCAGGCATCCACTGG + Intronic
917421891 1:174872661-174872683 CTGTAGTCTCAGCTATTTGCGGG - Intronic
917831509 1:178894686-178894708 CTGTGGTTTCAGTTACCCACAGG - Intronic
917960503 1:180140631-180140653 CTGTGGATTTGGGTATCTTCAGG - Intergenic
918346063 1:183608364-183608386 CTGAGGTTTCAGGGATCCACTGG - Intergenic
918445510 1:184613300-184613322 CTGAGGTTTCAGGCATCCACTGG + Intronic
918870310 1:189964064-189964086 CTGTGGTTTCAGACATCCACTGG + Intergenic
918875720 1:190040231-190040253 CTGTGGTTTCAGGTATGCAGTGG - Intergenic
919110351 1:193211165-193211187 CCCTGGTTTCAGGTATCCGCTGG - Intronic
919326420 1:196112744-196112766 CTGTGGTTTCAGGCAACTACTGG - Intergenic
919390709 1:196981694-196981716 CTGTGGATTTTGGTATCTGCTGG - Intronic
919707582 1:200692950-200692972 CTGTGGTTCCAGGAATCCACTGG + Intergenic
919719926 1:200822695-200822717 CTGAGGTTTCAGGTATGCACTGG - Intronic
919955232 1:202408085-202408107 CAGTGGATTTTGGTATCTGCAGG + Intronic
920280331 1:204838674-204838696 CTGTGGTGTCAGATGTTTGCAGG + Intronic
920541041 1:206778160-206778182 CTGTGGTTTGCAGTGTCTGCCGG - Intergenic
921097205 1:211896941-211896963 CTGTGGATTTTGGTCTCTGCTGG + Intergenic
921561569 1:216665287-216665309 CTGTGGTTTCAGGTATCCTCTGG + Intronic
921695980 1:218210642-218210664 TTGTGGTTTCAGGTATCCACTGG + Intergenic
921771178 1:219041738-219041760 CTGCGGTTTCAAGCATCTACTGG + Intergenic
921960186 1:221026168-221026190 CCTTGGTTTCAGGTACCTACTGG + Intergenic
922660161 1:227423001-227423023 CTGTGGCTTCAGGCATCCACTGG - Intergenic
922737914 1:227999306-227999328 CTGTGGTCTCAGGGATCAGCTGG + Intergenic
922770180 1:228177403-228177425 CAGTGTCTTCAGGTCTCTGCAGG + Exonic
923080335 1:230647267-230647289 CTGTGGTTTCAGGCATTGACTGG + Intronic
923120923 1:230990676-230990698 CTGTGGTTCCAGCTACCTGGGGG - Intronic
923157917 1:231294640-231294662 CTGTGGGTTCAGGCATCATCCGG - Intergenic
923541718 1:234893027-234893049 CGCTGGTTTCAGGCATCTCCTGG - Intergenic
923556875 1:235008011-235008033 CTGTGGCTTCTGGTAGCTGCAGG + Intergenic
923854560 1:237832159-237832181 CTGTAGTTTCAGGTACTTGTGGG - Intronic
924558727 1:245139884-245139906 CTCTGGTTACAGGTATATGGAGG - Intergenic
924746419 1:246838002-246838024 CTGTGGTTTCAGGAATTCACTGG + Intergenic
1063597461 10:7449688-7449710 CTGTGGTTTCAGGCATCCACTGG + Intergenic
1064065890 10:12181318-12181340 CTGTGGATTTTGGTATCTGCAGG + Intronic
1064186322 10:13165088-13165110 CCTGGGTTTCAGGCATCTGCTGG - Intronic
1064265877 10:13825032-13825054 CCATGGTTTCAGGTATCTACTGG - Intronic
1064490704 10:15853034-15853056 CTATGGATTTTGGTATCTGCAGG + Intronic
1064769514 10:18709767-18709789 CTGTGGTTTCAGGTATCCACTGG - Intergenic
1065455832 10:25905818-25905840 CTGTGGTTTCAGGCATTCACTGG + Intergenic
1065473548 10:26109567-26109589 CTGTGATTTCAGGAATCCACTGG + Intronic
1065794648 10:29294780-29294802 CTGCAGTTTCAGGCATCAGCTGG - Intronic
1065954258 10:30678497-30678519 CTGTGGATTTTGGTATCTGTAGG + Intergenic
1066478274 10:35769711-35769733 CTGTGGGTTTTAGTATCTGCAGG + Intergenic
1066480208 10:35788214-35788236 CTGTAGGTTTTGGTATCTGCTGG - Intergenic
1066676352 10:37891548-37891570 CTGTGGATTTTGGTATCTGAGGG + Intergenic
1066690711 10:38025131-38025153 CTGAGGTTTCAGGCTTCCGCTGG + Intronic
1067274895 10:44825299-44825321 CCAAGGTTTCAGGCATCTGCTGG - Intergenic
1067363768 10:45606140-45606162 CTGTGGATTTTGGTATCTGTAGG - Intergenic
1067469095 10:46523362-46523384 CTGGGGTCTCGGGCATCTGCAGG + Intergenic
1068098315 10:52520092-52520114 CTGTGGTTTCAGGCATCCCCTGG - Intergenic
1068628298 10:59272839-59272861 CTGTGGTTTCAGGTGTCCACTGG - Intronic
1069932100 10:71889762-71889784 CTGTAGTTCCAGCTACCTGCAGG + Intergenic
1070256424 10:74816691-74816713 CTGTGGTTTCAGGCATCCACTGG + Intergenic
1070267668 10:74920030-74920052 CTGTAGTTTCTTGTTTCTGCTGG + Intronic
1070468372 10:76749439-76749461 CTGTGGCCTCAGGTATCTGATGG - Intergenic
1070507108 10:77123645-77123667 CTGAGGTTTCAGGCATCCACTGG - Intronic
1070507154 10:77124055-77124077 CTGAGGTTTCAGTTATCCCCAGG - Intronic
1070572167 10:77648481-77648503 CTGTGGCTTCAGGCATCCACAGG - Intergenic
1070723200 10:78770859-78770881 CTGTGGGTTTAGGCATCTCCTGG + Intergenic
1071235996 10:83649306-83649328 CTGTGATTTCAGGCATCAACTGG + Intergenic
1072019668 10:91385624-91385646 CTGTGGTTTCAGGCATCCACTGG - Intergenic
1072280081 10:93858002-93858024 CCTTGGGTTCAGGCATCTGCTGG + Intergenic
1072344682 10:94492234-94492256 CTGAGGTTTCAGGCATCCACTGG + Intronic
1072588989 10:96809555-96809577 CTGTTGTTTCAGGCATCCCCTGG - Intergenic
1072717668 10:97762404-97762426 CAGTGGTTTCTGGGATCTTCAGG + Intergenic
1072879236 10:99207844-99207866 GTGTGGTTTCAGGCATCTACTGG - Intronic
1073253548 10:102136706-102136728 CTGTGGTTTCAGGCATCTACTGG + Intronic
1073644151 10:105282469-105282491 ATGTAGTTTGAGGTATCTGTGGG - Intergenic
1073714983 10:106094598-106094620 CAGTGGTTTCAGGCACCTACTGG + Intergenic
1073767672 10:106701002-106701024 CTGTGGATTTTGGTATCTGAGGG - Intronic
1073983310 10:109179223-109179245 CTGGGGTTTCAGGGAAATGCTGG - Intergenic
1074273799 10:111981793-111981815 CTGGGGTTTCAGGCATCCACTGG - Intergenic
1074677486 10:115868516-115868538 CTGTGATATCAGGTGTGTGCTGG - Intronic
1074934699 10:118166496-118166518 ATGTGGATTTTGGTATCTGCAGG + Intergenic
1075269630 10:121037360-121037382 CTGTGATTTCAGGCATCCACCGG - Intergenic
1075604684 10:123796051-123796073 CTGTGGGCACAGGTATCTTCAGG - Intronic
1076668653 10:132107004-132107026 CTGTGGTCTCAGTTATTTGAGGG - Intronic
1077234782 11:1475380-1475402 CTGTGGCTTCAGGCATCCCCTGG - Intronic
1077465005 11:2729748-2729770 CTGTGGATTTGGGTACCTGCGGG + Intronic
1077952640 11:6977430-6977452 CCGAGGTTTCAGGTATCCACTGG + Intronic
1078554150 11:12305073-12305095 CCATGGTTTCAGGTATCCACTGG - Intronic
1079198595 11:18354929-18354951 CTGTGGTTTCAGCTACTTGGGGG - Intronic
1080413584 11:32049332-32049354 CTGTGGATTTGGGTATCTGTAGG + Intronic
1080569960 11:33546756-33546778 CTGCAGTTTCAGGCATCTACTGG - Intronic
1081311467 11:41579145-41579167 CTGTCATTTCAGGCATCTACTGG + Intergenic
1081387422 11:42488018-42488040 CCATGGTTTTAGGCATCTGCTGG - Intergenic
1081455591 11:43219370-43219392 CTATGGTTTCAGGCATCTACTGG - Intergenic
1081982521 11:47277159-47277181 CTGTGGTTTGAGGCATCCACTGG - Intronic
1082692764 11:56325797-56325819 CTGTGGTTTCAGGCATTTACTGG - Intergenic
1083086324 11:60150715-60150737 CTGTGGTTTCAAGCATCCACTGG + Intergenic
1083563689 11:63695131-63695153 CTGTGATTTCTGCTATATGCTGG + Intronic
1084347980 11:68569318-68569340 CTGTGGTTTCAGGCATCCAAAGG - Intronic
1084621881 11:70277444-70277466 TTGTTGTTTCATGTTTCTGCCGG + Intronic
1085204612 11:74723368-74723390 CTGTGGTTTCAGGCATCCACTGG - Intronic
1085340219 11:75726417-75726439 CAGTGGATTTTGGTATCTGCGGG - Intronic
1085440477 11:76557981-76558003 CTTTTGCTTCAGGCATCTGCAGG + Intergenic
1085701020 11:78746351-78746373 CAGTGGTTTCTGGGCTCTGCGGG - Intronic
1086044901 11:82521288-82521310 CTGATGTTTCAGGTATTTCCAGG - Intergenic
1086108076 11:83168895-83168917 CTGAGGTTTGAGGGATCTCCAGG + Exonic
1086606991 11:88707637-88707659 CTGTGGATTTTGGTATCTGTAGG + Intronic
1086839262 11:91665472-91665494 CTGTGGTTTCAGACATCCACTGG + Intergenic
1086963178 11:93001027-93001049 CCTTGGTTTCAGCTATCTCCTGG + Intergenic
1087073177 11:94102111-94102133 CTGTGGTTTCAAGCATCCCCTGG + Intronic
1087302578 11:96453192-96453214 TTGTGGTTTCAGGCATCCACTGG + Intronic
1087549593 11:99632062-99632084 CCATGGTTTCAGGTATCCCCTGG + Intronic
1087632164 11:100662562-100662584 CTGTGGTTTCAGGCATCCACTGG - Intergenic
1088356381 11:108948498-108948520 CTGTGGTTTCAGGCATCCACTGG + Intergenic
1088375796 11:109140582-109140604 TGCTGGTTTCAGGTATCAGCTGG - Intergenic
1088388238 11:109283378-109283400 CTGTGGCTTCAGGTATCCATGGG + Intergenic
1088573022 11:111241618-111241640 CTATGGTTTCAGGAATCCACTGG + Intergenic
1088573197 11:111243053-111243075 CTATGGTTTCAGGAATCCACTGG + Intergenic
1088685828 11:112283894-112283916 CTGTGGATTTTGGTATCTGCAGG - Intergenic
1088710473 11:112503795-112503817 CTGTGGCCTCAGTTATCTGATGG + Intergenic
1088771665 11:113042122-113042144 CTCTGGGCTCAGGGATCTGCTGG - Intronic
1088963718 11:114696848-114696870 CTGCGGTTTCAGGCATCCACTGG - Intronic
1090154110 11:124419525-124419547 CTGTGATTTCAGGTATCTACTGG - Intergenic
1090454941 11:126841139-126841161 CTGTGGTTTCAGGCATCCCCTGG + Intronic
1090780833 11:130004613-130004635 CTGTGGTTCCAGTTACCGGCAGG + Intergenic
1090844841 11:130522047-130522069 CTGTGGATTTTGGTATCTGGGGG + Intergenic
1090856865 11:130617462-130617484 CTGTGGTTTCAGGCATCTGCTGG + Intergenic
1091474896 12:763093-763115 CTGTAGCTTCAGGTATCCACGGG - Intronic
1091512240 12:1139549-1139571 CTGTGGTTTCAGGCATCCACTGG + Intronic
1091799584 12:3316434-3316456 CTGTGTGCACAGGTATCTGCAGG - Intergenic
1092393220 12:8100262-8100284 CTGTGGTTTCAGGCATCCAAGGG + Intergenic
1092507859 12:9123206-9123228 CTGTGGTTTCAGGTGTCCACTGG - Intergenic
1092866717 12:12768118-12768140 CTGTGGATTTTGGTATCTGTGGG + Intronic
1093337165 12:17920547-17920569 CTGTGGTTTCAGATGCCTGTGGG - Intergenic
1093609731 12:21138837-21138859 CTGTGGTTTCATGTGTCTGCAGG + Intronic
1093756591 12:22859786-22859808 CACTGGTTTCAGGTATCCACTGG + Intergenic
1094088707 12:26623586-26623608 CTGTGGTTTCAGGCATCCACTGG + Intronic
1094279635 12:28721561-28721583 CTGCAGTTTCAGGTTTCTCCAGG + Intergenic
1094625367 12:32118682-32118704 CTGTGGATTTTGGTATCTGCAGG + Intronic
1095392422 12:41724705-41724727 CTGTGGTTTCAGGCATCCACTGG + Intergenic
1095650981 12:44608848-44608870 CTGAGGTTTCAGGGATCCACTGG - Intronic
1095758102 12:45794086-45794108 CTGCAGTTTCAGGTATCTACTGG - Intronic
1096452861 12:51758900-51758922 CTGAGGTTTCAGGCATCCACTGG - Intronic
1096901800 12:54890978-54891000 CTGTGGTTTCAGGAATCCACTGG + Intergenic
1097018116 12:56001520-56001542 CTGTGGTTTCAAACATCTACTGG + Exonic
1097437463 12:59569002-59569024 CTGTTGTTTCAGTTGCCTGCTGG + Intergenic
1097768466 12:63552680-63552702 TTGTGGATTTTGGTATCTGCAGG + Intergenic
1097784830 12:63747744-63747766 CTGTGGATTTTGTTATCTGCAGG + Intergenic
1097820934 12:64128650-64128672 CTGTGGCTTCAGGCATCCACTGG - Intronic
1098151236 12:67548671-67548693 CTGTGGTTCCAGGTACTTGGGGG + Intergenic
1098417614 12:70253820-70253842 CTGTAGTTTCAGGCATCCACTGG - Intronic
1098569914 12:71976726-71976748 CTGGGATTTCTGGTACCTGCTGG - Intronic
1099052752 12:77801321-77801343 CAGTAGTTTTAGGTATGTGCTGG + Intergenic
1099080805 12:78177959-78177981 CTATGGTTTCAGGCATCCACTGG - Intronic
1100344424 12:93713443-93713465 CTGTGGATTTTGGTATGTGCAGG - Intronic
1101419745 12:104540681-104540703 CTGCGGTTTCACCCATCTGCAGG - Intronic
1101475729 12:105045896-105045918 CTTGGGTTTCTGTTATCTGCAGG - Intronic
1103171255 12:118821932-118821954 CTGTGGTTTCAGGAATCCACTGG - Intergenic
1103227396 12:119299813-119299835 CCATGGTTTCAGGCATCTACTGG - Intergenic
1103370071 12:120412579-120412601 CTGTGGATTTTGGTATCTGAGGG + Intergenic
1104098827 12:125587097-125587119 CTGTGGTTTCAGGCATCCACTGG + Intronic
1105363012 13:19738346-19738368 CAGTGGATTCTGGTATCTGGGGG - Intronic
1105466849 13:20651803-20651825 TTGTAGTTTCAGGTATCCACTGG + Intronic
1105539666 13:21304818-21304840 CTGTGGATTTGGGTATCTGTAGG + Intergenic
1105548638 13:21370829-21370851 CTGTGGATTTTGGTATCTGTGGG + Intergenic
1105798671 13:23883454-23883476 CTGTGGATTCGGGTATCTGTGGG - Intronic
1106059847 13:26279023-26279045 CTGTGCATTTTGGTATCTGCTGG + Intronic
1106454958 13:29919057-29919079 CTGTGGCTCCAGGTCTCTGACGG + Intergenic
1106654436 13:31727130-31727152 CTGTGGTTTTTGTTATCTACAGG + Intergenic
1106669571 13:31890133-31890155 CTGTGGATTTTGGTATCTGCAGG + Intergenic
1106829695 13:33566345-33566367 CTGCGGTTTCAGGCATCCACTGG + Intergenic
1107374541 13:39787892-39787914 CTGTGGATTTTGGTATCTGTGGG + Intronic
1108094357 13:46885006-46885028 CCTTGGTTTCAGGCATCTACTGG - Intronic
1108220195 13:48225716-48225738 CTGTGGATTTTGGTATCTGAGGG - Intergenic
1108349459 13:49578126-49578148 CTGTGGATTTTAGTATCTGCAGG - Intronic
1108548984 13:51524163-51524185 CTGTGGTTTCAGGCATCCACTGG - Intergenic
1109282990 13:60378782-60378804 CAGTGGTTTCTTGTATCTCCAGG + Intergenic
1109687883 13:65844448-65844470 CTGTGGTTCCTGGCATCTCCAGG + Intergenic
1109853321 13:68097776-68097798 TTGTGGTTTCAGGCATCTAGTGG - Intergenic
1110073846 13:71214006-71214028 CTGTCGTTTCAGGCATCCACTGG + Intergenic
1110243302 13:73292751-73292773 CTGTGGATTTTGATATCTGCAGG - Intergenic
1110348894 13:74483194-74483216 CTGTGATTTCAAGCATCTACTGG + Intergenic
1110676456 13:78252292-78252314 CTGTGGCTTCAGGCATCCACTGG + Intergenic
1110799785 13:79681469-79681491 CTGTGGTTTCAGACATCCCCTGG - Intergenic
1111289315 13:86143702-86143724 CTGAGGTTTTAGGCATCTACTGG + Intergenic
1111560190 13:89934585-89934607 CCATGGTTTCATGTATCTCCTGG + Intergenic
1111567723 13:90038227-90038249 CCGTGGTTTCAGGCATCCACTGG + Intergenic
1111597381 13:90428497-90428519 CTGTGGTTCCTGGCATCTCCAGG + Intergenic
1112244564 13:97719471-97719493 CTGTGGTTTCAGGCATCCACTGG - Intergenic
1112633438 13:101187319-101187341 CCATGGTTTCAGGTATCTACTGG + Intronic
1112843265 13:103606293-103606315 CTGTGGTTTGAGGTCTCTGGCGG - Intergenic
1113077205 13:106478697-106478719 CTGTGGTTTCAGGCATCCACGGG - Intergenic
1113151352 13:107267590-107267612 CTGTGGTTTCAGGCATCCACTGG - Intronic
1113250135 13:108443566-108443588 CTGAAGTTTCAGGCATCTGCTGG - Intergenic
1113266310 13:108622004-108622026 CTGTGGTTTCAGGCATCCACTGG + Intronic
1113575356 13:111391317-111391339 CTGTGGTTTCGGGCATCCTCTGG - Intergenic
1113597759 13:111546657-111546679 ATGTGATTTCAGGCATCTGCTGG - Intergenic
1114343874 14:21774872-21774894 CTATTGTTGCAGGTATCTCCAGG - Intergenic
1115748851 14:36467608-36467630 CTGTGGTTTCAAGCATCCACTGG + Intergenic
1115801831 14:37003063-37003085 CCGTGGTTTCAGGCATCCGCTGG - Intronic
1116019417 14:39442246-39442268 CTGTGGTTCCTGGCATCTCCGGG + Intergenic
1116035282 14:39619824-39619846 GTGTGGATTTTGGTATCTGCAGG + Intergenic
1116186278 14:41605101-41605123 CTGTGGCTTCAGTTTGCTGCAGG + Intergenic
1116279483 14:42884590-42884612 CTGTGGTTTCAGGCATCCACTGG - Intergenic
1116926699 14:50646107-50646129 CTGCAGTTTCAGGCATCTACGGG - Intronic
1116966107 14:51016653-51016675 CTGTGGATTTTGGTATCTGCAGG + Intronic
1117423121 14:55567392-55567414 CTGCGGATTTTGGTATCTGCAGG - Intronic
1117459414 14:55930088-55930110 CCGTGGTTTCAGGCATCCACTGG - Intergenic
1117467904 14:56012544-56012566 CTGTGGTTTCAGGCATCCCCTGG + Intergenic
1117785322 14:59277930-59277952 CTGTGGTTTCAGGCATCCACAGG - Intronic
1117787130 14:59297864-59297886 CTGAAGTTTCAGGCATCTACTGG + Intronic
1118130977 14:62963304-62963326 CTGTGGTTTCAGGCCTCCACTGG + Intronic
1118294519 14:64556960-64556982 CTGTAGTTTCAGCTCTTTGCTGG - Intronic
1118380160 14:65211637-65211659 CTTCGGTTTCAGGTATCCACTGG + Intergenic
1118391336 14:65298357-65298379 GAGTGGTTTCAAGTAACTGCTGG - Intergenic
1118411023 14:65478253-65478275 CCATGGTTTCAGGTATCCACTGG - Intronic
1118463168 14:66005051-66005073 CTGTGGATTTTGGTATCTGCAGG + Intergenic
1118894207 14:69932212-69932234 CTGTGGCTTCACACATCTGCAGG - Intronic
1119966861 14:78926168-78926190 CTGTGGTTTCAGGCTTCCACTGG - Intronic
1120135841 14:80866904-80866926 CCTCGGTTTCAGGCATCTGCTGG - Intronic
1120233970 14:81869476-81869498 CTATGGTTTCAGGCATCCACTGG - Intergenic
1120503117 14:85321717-85321739 CTGCAGTTGCAGGTATCTTCAGG - Intergenic
1120537236 14:85712113-85712135 CTGGGGTTGCAGTTATCTGAAGG + Intergenic
1120641767 14:87021660-87021682 CTGTGTTTTCAGGCATCCACTGG + Intergenic
1120642679 14:87033890-87033912 CCGAGGTTTCAGGTATCCACTGG - Intergenic
1120708861 14:87772808-87772830 CCGAGGTTTCAGGTATCCACTGG + Intergenic
1120836017 14:89039017-89039039 CTGTAGTTCCAGCTATCTGTAGG + Intergenic
1120897253 14:89544680-89544702 CTGGGGTTTCAGGGATCCACTGG - Intronic
1122095638 14:99369206-99369228 CTGTGGATTTTGGTATCTGTGGG - Intergenic
1122887556 14:104717185-104717207 CTGTGCTCTCAGGTGTCTGTGGG - Intronic
1202888325 14_KI270722v1_random:130140-130162 CTGTGGATTTTGGTATCTGGGGG + Intergenic
1124063244 15:26315147-26315169 CTGTGGTTTCAGCCATCTACTGG - Intergenic
1124093589 15:26628838-26628860 CTGCCGTTTCAGGCCTCTGCTGG - Intronic
1124168182 15:27347901-27347923 CTGTGGTTGCAGTTGTCTGATGG + Intronic
1124680806 15:31729193-31729215 CTGCAGTTTCAGGTATCCACTGG + Intronic
1125092654 15:35812537-35812559 TTGTAGTTTCAGGTGTCTGTAGG - Intergenic
1125178500 15:36853768-36853790 CTGAGGTTCCAGGTATCTATTGG + Intergenic
1125550188 15:40539160-40539182 CTGTGGTGTCAGGTTTGAGCGGG - Intronic
1125852276 15:42915542-42915564 CTGAGGTTTCAGGCATCCACTGG + Intronic
1125877297 15:43161111-43161133 CTGTGTTTTCAGGCATCCACTGG + Intronic
1126020308 15:44394026-44394048 CTGTGGATTTTGGTATCTGCTGG + Intronic
1126418598 15:48446471-48446493 CTGTGGTTTCAGGCATCTGCTGG + Intronic
1127164299 15:56228800-56228822 CTGTGGTTTCAGGCATCCACTGG - Intronic
1127306706 15:57713069-57713091 CTGTGGTTCCAGCTACCTGTGGG + Intronic
1127340813 15:58041768-58041790 CTGCGGTTTCAGGCATCCACTGG - Intronic
1127475722 15:59330890-59330912 CTGTGGTCCCAGCTACCTGCAGG - Intronic
1127503324 15:59574936-59574958 CTGCAGTTTCAGGCATCCGCTGG - Intergenic
1128193124 15:65723606-65723628 CTGTGATTTCAGGCATCCACTGG - Intronic
1128383353 15:67129591-67129613 CTCTGGTTTCAGGCATCCACTGG + Intronic
1128433296 15:67620491-67620513 CTGTGGTTTCATTTATCTATTGG - Intronic
1128548620 15:68583721-68583743 CTGGAGGTTCAGGTATCTCCTGG - Intronic
1128638551 15:69318682-69318704 CTGTGGTTTCAGGCATCCACTGG - Intronic
1128858203 15:71039458-71039480 CTGTGCATTTTGGTATCTGCAGG - Intronic
1128999070 15:72318449-72318471 CTGTGCTTTCAAGTTTTTGCTGG - Intronic
1129303627 15:74642064-74642086 CTGTGGCTTTAGGAATATGCAGG - Intronic
1129492806 15:75945835-75945857 CTGTGATTTCAGGCATCCACTGG - Intronic
1129580910 15:76808630-76808652 CTGCAGTTTCAGGTAGCAGCTGG - Intronic
1129677784 15:77641791-77641813 CTGTGGGTTCAGATAGCAGCTGG + Intronic
1131088874 15:89603708-89603730 CTGTGGTTTCAGGCATCCACTGG - Intronic
1131200681 15:90393229-90393251 CTGTGGATTCTGATATCTGCAGG - Intronic
1131338687 15:91574871-91574893 CTGTAGATTTTGGTATCTGCAGG + Intergenic
1131451120 15:92541023-92541045 CTGTGGATTTTGGTATCTGCAGG + Intergenic
1131467338 15:92666342-92666364 CTGGGGTTTCAGGAGTCTCCTGG + Intronic
1131880345 15:96855854-96855876 CTGTGGTTTCAGGTATTCACTGG + Intergenic
1131904800 15:97131490-97131512 CTGTGGCTTCAGGCATCCACTGG - Intergenic
1132026291 15:98406910-98406932 CTGTGCTTCCAGGTACCTGAAGG + Intergenic
1132076461 15:98825288-98825310 CTGTGGATTTTGGTATCTGTTGG - Intronic
1132082684 15:98880749-98880771 CTGTGGATTTTGGTATCTGTGGG - Intronic
1132244336 15:100282389-100282411 CTGTGGTTTCAGGGATCCACTGG - Intronic
1132392448 15:101449114-101449136 CTGTGGATTTTGGCATCTGCAGG - Intronic
1133221763 16:4321964-4321986 CTGTGGGTCCAGGTACCTGAGGG - Intronic
1133502052 16:6375910-6375932 CTGTGCTTTGAGGGATCAGCAGG + Intronic
1135104681 16:19638421-19638443 CTGCGGTTTCAGGCAACTCCTGG - Intronic
1135115049 16:19717221-19717243 CTGTGGTTTCAGGCATCCACTGG + Intronic
1135985462 16:27180676-27180698 CCGTGGTTTTAGGTATCCACTGG + Intergenic
1137667428 16:50259879-50259901 CTGTGGGCTCAGGGATGTGCAGG - Intronic
1138796319 16:59973876-59973898 CTGTGGCTTCAGGCATCCCCTGG - Intergenic
1138816462 16:60208958-60208980 GTGTGTTTACAGGTATGTGCAGG - Intergenic
1138932026 16:61670717-61670739 CCATGGTTTCATGTATCTCCTGG - Intronic
1139084581 16:63569263-63569285 CTGTGGTTTCAGAAATCCACTGG + Intergenic
1139136812 16:64214493-64214515 CTGTGATTTTAGGTTTCTACTGG + Intergenic
1139286588 16:65820509-65820531 CTGTGGTTTCAAGCATCTACTGG - Intergenic
1139365745 16:66432517-66432539 CAGGGGTTTCATGGATCTGCGGG - Intronic
1139975408 16:70806260-70806282 CTGTGGTTTCAGGCATCTACTGG + Intergenic
1140194126 16:72843126-72843148 CTGTGTTTTGAGGTATTTGGGGG + Intronic
1140435853 16:74946275-74946297 CTGTGGTTTCAGGCATCCAATGG + Intronic
1140906304 16:79412298-79412320 CCGTGGTACCAGGTATGTGCAGG + Intergenic
1140957180 16:79876498-79876520 CTGTGGTTTCAGCTATGTGGGGG - Intergenic
1141228963 16:82146513-82146535 CTGTGGATTTTGGTATCTGCAGG - Intergenic
1141266388 16:82501386-82501408 CTGTGAATTTTGGTATCTGCAGG + Intergenic
1141951003 16:87339348-87339370 CTGTGGATTCATGCATCAGCTGG - Intronic
1143077551 17:4357401-4357423 CAGTGGTTTCAGGCATCCCCTGG + Intronic
1143441052 17:6974524-6974546 CAGTGGTTTCTGGTATCTGGAGG - Intronic
1143573136 17:7773503-7773525 CTGAGGTGTCAGGCATCTACTGG - Intronic
1143695512 17:8612927-8612949 TTGTGGTTTCAGGCATCCACTGG + Intronic
1143808857 17:9454184-9454206 CTGAGGTTTCAGGCATCCACTGG - Intronic
1143856488 17:9854682-9854704 CCCTGGTTTCAGGCATCTACTGG - Intronic
1144149192 17:12427251-12427273 CTGTGGATTTTGGTATCTTCAGG + Intergenic
1144426445 17:15146881-15146903 TTGTTGTTTCAGGGACCTGCAGG - Intergenic
1144527998 17:16007236-16007258 AAGTCGTTTCAGGCATCTGCTGG - Intronic
1144539580 17:16127791-16127813 CTGTGGTTTCAAGCATCCACTGG + Intronic
1145074350 17:19839114-19839136 CTGTTGTTTTGAGTATCTGCAGG + Intronic
1145199495 17:20929887-20929909 CTGTGGTTTCAAGCATCCTCTGG - Intergenic
1145213589 17:21034945-21034967 CTGTGGTTTCAGACAACTACCGG + Intronic
1145824278 17:27865396-27865418 CTGTGGATTTTGGTATCTGTGGG + Intronic
1146200163 17:30850481-30850503 CTGTGGTTCCAGCTATTTGAGGG - Intronic
1146342820 17:32036591-32036613 CTGTGGACTTTGGTATCTGCAGG + Intronic
1146674979 17:34767206-34767228 CTGTGGTTTCAGGTATCTCTGGG - Intergenic
1146851372 17:36224663-36224685 CTGCAGTTTCAGTTACCTGCGGG - Intronic
1146867282 17:36348536-36348558 CTGCAGTTTCAGTTACCTGCGGG - Intronic
1147070159 17:37949147-37949169 CTGCAGTTTCAGTTACCTGCGGG - Intergenic
1147081680 17:38028673-38028695 CTGCAGTTTCAGTTACCTGCGGG - Intronic
1147097631 17:38152643-38152665 CTGCAGTTTCAGTTACCTGCGGG - Intergenic
1147898950 17:43771096-43771118 CTGTGGATTTGGGTATCGGCAGG - Intronic
1148300273 17:46541842-46541864 CTGTGGACTTTGGTATCTGCAGG + Intronic
1148393820 17:47292610-47292632 CAGTGGTTGCAGGTATATGAGGG - Intronic
1149177324 17:53888881-53888903 CTGTGGTTTCAGGCATCCACTGG - Intergenic
1149345239 17:55727881-55727903 CTGTGCTTTCAATTATCTGGAGG - Exonic
1149346609 17:55743499-55743521 CCGTGGTTTCAGGTACCCCCTGG + Intergenic
1149508301 17:57214523-57214545 CTGTGGTTTCAGGCATCCACTGG - Intergenic
1149710787 17:58740214-58740236 CTTTGGTTTCAGGTATCCACTGG - Intergenic
1149955656 17:61046434-61046456 CTGTGGATTTTGGTATCTGAGGG - Intronic
1150079331 17:62222763-62222785 CTGCAGTTTCAGTTACCTGCGGG - Intergenic
1150529377 17:65960500-65960522 CTGTGGATTTTGGTATCTGGAGG - Intronic
1150847891 17:68677808-68677830 CTGAGGTGTCAGGTATGTGAAGG - Intergenic
1150870022 17:68897033-68897055 CTGTGGTTTCAGGCATCTGCTGG + Intronic
1151330715 17:73405633-73405655 CTGTGGCTTTTGGTATCTGCGGG - Intronic
1151692050 17:75692676-75692698 CTTTGCTCTCAGGTTTCTGCAGG + Intronic
1152573249 17:81129579-81129601 CTCTGGTTTCAGTTTTCTGGGGG - Intronic
1153013525 18:562567-562589 CTGTGGTTTCAGGCATCCACTGG - Intergenic
1153181017 18:2433483-2433505 CTGTGGTTTCATTACTCTGCCGG - Intergenic
1153372898 18:4340026-4340048 ATGTGGTTTCAGGCATCAGCTGG - Intronic
1153484917 18:5587516-5587538 CTGAGGTTTCAGGCATCCACTGG + Intronic
1153810746 18:8749674-8749696 CTGTGCTTACAGGTATTTACAGG - Intronic
1153939608 18:9967079-9967101 CTCTGGTTTCAGGCATCCACTGG + Intergenic
1153967662 18:10196288-10196310 CTGAGGTTTCAGGGATCCACTGG - Intergenic
1153967911 18:10198245-10198267 CTGAGGTTTCAGGCATCCACTGG - Intergenic
1155336720 18:24772510-24772532 CTGTGTTTTCAGTTGTATGCAGG - Intergenic
1155408753 18:25518654-25518676 CTGTGGTTTCAGGTATCCACTGG - Intergenic
1155442219 18:25874311-25874333 CTGTGGTTTCAGGCATCTACTGG + Intergenic
1155547298 18:26928749-26928771 CTGTGGTTAAAGGTTTCTGCAGG + Intronic
1156050028 18:32921359-32921381 CTGCACTTTCAGGCATCTGCTGG - Intergenic
1156229153 18:35137232-35137254 CTGTGATGTCATGCATCTGCAGG - Intronic
1156312145 18:35934580-35934602 CCATGGTTTCAGGTATCCACTGG + Intergenic
1156504118 18:37578104-37578126 CTGTGCTTGCAGGTATCCTCTGG + Intergenic
1157044212 18:44078461-44078483 CCCTGGTTTCAGGCATCTACTGG - Intergenic
1157146283 18:45165997-45166019 TTGTGGTTTCAGGAATTTGGAGG - Intergenic
1157344966 18:46820382-46820404 CTGTGGTTTCAGACATTTACTGG + Intronic
1157375765 18:47163046-47163068 CTATGGTTTCAGGCATCCCCTGG - Intronic
1157978119 18:52349522-52349544 CTCTGGTTTGAGGCATCTCCAGG + Intronic
1158252626 18:55506678-55506700 CTGAGGTTTCAGGCATCTGCTGG - Intronic
1158354994 18:56608050-56608072 CTGTGGTTCCAGGCATCCACCGG + Intronic
1158374197 18:56845044-56845066 CTGAGGTTTCAAGTATCCACTGG + Intronic
1158950933 18:62494130-62494152 CTATGGTTTCAGGCATCCACTGG + Intergenic
1159006593 18:63018947-63018969 CTGTAGATTTTGGTATCTGCAGG + Intergenic
1159378856 18:67630498-67630520 CAGTGTTTTCATGTATCTGTTGG + Intergenic
1159464427 18:68762883-68762905 CTGTGGTTTTAGGCATCCACTGG + Intronic
1159568949 18:70090246-70090268 CTGTGGTTTCAGGCATCTACTGG - Intronic
1159589715 18:70320745-70320767 ATGTGGTTTCAGGAATCCACAGG + Intronic
1159757544 18:72384425-72384447 CTTTGGTTTCAGGCATCCACTGG - Intergenic
1159861135 18:73650992-73651014 CTGTGGTTTCAGGCATCCTCTGG - Intergenic
1160755541 19:755147-755169 CTGTGGCTCCTGGCATCTGCAGG - Intronic
1161546679 19:4885186-4885208 CTGGGTTTTCCGGAATCTGCTGG + Intergenic
1161546774 19:4885751-4885773 CTGGGTTTTCCGGAATCTGCTGG + Intergenic
1161547093 19:4887973-4887995 CTGGGTTTTCCGGAATCTGCTGG + Intergenic
1161613919 19:5259410-5259432 ATGTGGTTTCAGATATCTTTGGG - Intronic
1162359200 19:10207383-10207405 CTGTGGTTCCACCCATCTGCAGG - Intronic
1162611329 19:11756335-11756357 CTGTGGATTCAGGTATCCTTGGG + Intergenic
1163352191 19:16784468-16784490 CTGTGGATTTTGGTATCCGCAGG + Intronic
1163602176 19:18255703-18255725 CTGTGGGTTCAGGGATCGGAGGG - Intergenic
1165660264 19:37572560-37572582 CTCTGGTTTCAGGCATCCACTGG + Intronic
1165731534 19:38148790-38148812 CTATGGTTTCAGATGTCTCCAGG - Intronic
1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG + Exonic
1166526757 19:43515528-43515550 CTGAGGTTTCAGATATCCACTGG - Intronic
1167758845 19:51430592-51430614 CTGTGGTTTCAGGCATCCACTGG - Intergenic
1168114493 19:54214209-54214231 CTGTGTTTTCAGTTACCTGGTGG + Intronic
1202663715 1_KI270708v1_random:96932-96954 CTGTGGATTTTGGTATCTGGGGG + Intergenic
925573678 2:5337930-5337952 CTAGGGCTTCAGGTACCTGCAGG - Intergenic
925601680 2:5614256-5614278 CTTGGGTTTGAGGTGTCTGCAGG + Intergenic
925746144 2:7045372-7045394 CTGAAGGTTCAGGTATCTGCAGG + Intronic
925813272 2:7722326-7722348 CTGTGGTTTCAGCCACCTACAGG - Intergenic
926759692 2:16267225-16267247 CTTTGGATTTGGGTATCTGCTGG + Intergenic
926846233 2:17143449-17143471 CTGCGGTTTCAGGCATCCCCTGG - Intergenic
926931720 2:18047883-18047905 ATGTGGTTTCAGATATCCACCGG + Intronic
927128124 2:20032223-20032245 CTGTGGATTTGGGTATCTGGAGG - Intergenic
927734007 2:25502059-25502081 CTGTGGTCTCAGCTATTTGTGGG + Intronic
927745055 2:25611467-25611489 CCGTGGATTTTGGTATCTGCAGG - Intronic
927751015 2:25671221-25671243 CTGTGGCTTCAGGCATCCACTGG + Intronic
927947040 2:27141407-27141429 CTGTGGTCCCAGCTATCTGGTGG - Intergenic
928202998 2:29263059-29263081 CTGTGGACTCAGCCATCTGCAGG + Intronic
929067606 2:37995264-37995286 ATATGGTTTCAGGCATCTGTTGG + Intronic
929166829 2:38891054-38891076 CTGTGGTCTCAGTTACCTGTGGG - Intronic
929178379 2:39005068-39005090 CTATAGTTTCAGGTATCCACTGG - Intronic
929181477 2:39044774-39044796 GTGTGGATTTGGGTATCTGCAGG + Intronic
929406052 2:41642463-41642485 CTGTGGTTTCAGGCATCCACTGG + Intergenic
929406187 2:41644506-41644528 CTGTGGTTTCAGGCATCCACTGG + Intergenic
929820022 2:45265770-45265792 CTGTGGATTTTGGTATCTGAAGG + Intergenic
929841166 2:45465088-45465110 CTATGGATTTGGGTATCTGCAGG - Intronic
930178706 2:48328303-48328325 CTGTGGATTTTGGTATCTTCAGG - Intronic
931347556 2:61460576-61460598 CTGTGGTTTGAGGTATCCACTGG + Intronic
931512081 2:63009769-63009791 CTGAGGTTTCAGGCATCCACTGG - Intronic
932146099 2:69318731-69318753 CTGTGGTTTCAGGTATCCACTGG + Intergenic
932243988 2:70180877-70180899 CTGTGGTCCTAGCTATCTGCGGG + Intronic
932431790 2:71679976-71679998 CTGTAGTTTCAGGCATCCCCTGG - Intronic
932849898 2:75174313-75174335 CCATGGTTTCAGGCATCTGCTGG - Intronic
934124011 2:88868674-88868696 CTGGGGTTTCAGTTACCTGTAGG + Intergenic
935942684 2:108257780-108257802 CTGTGGTTTCAGGCATCCGCTGG + Intronic
936965717 2:118125906-118125928 CTGTAGTAACAGGTATTTGCAGG - Intergenic
937315522 2:120929830-120929852 CTGTGGTCTCAGCCACCTGCAGG - Intronic
937430054 2:121830876-121830898 CAGTGGTTTCAGGCATCCACTGG - Intergenic
937571159 2:123363678-123363700 CTGTGGTTTTAGGCATCCACTGG + Intergenic
937588684 2:123587922-123587944 TTGTGGTTTCAGGCATCTGCTGG - Intergenic
937854897 2:126665426-126665448 CTCTGGTTTCAGGCATCCGCTGG + Intronic
938509220 2:131922844-131922866 CTGGGATTTTAGGTAACTGCTGG + Intergenic
938550822 2:132380734-132380756 TTGTGGTTTCAGGTATCCACTGG + Intergenic
938712275 2:133985468-133985490 CTGTGGTTTCAGGCATCTGCTGG - Intergenic
938870188 2:135467350-135467372 TTGTTGTTTCAGGTATATCCGGG + Intronic
939161024 2:138589072-138589094 CTATGGTTTCAAGCATCTACTGG - Intergenic
939191791 2:138924833-138924855 CTGTGGTTCCAGGCATCCACCGG - Intergenic
939243410 2:139592239-139592261 CTGTGGTTTTAGGCATCCACTGG + Intergenic
939458487 2:142468295-142468317 CTGTGATTTCAGGCATCCACTGG + Intergenic
939796918 2:146656504-146656526 CTGTGGTTTCAGGCATCCACTGG + Intergenic
939805235 2:146767494-146767516 CTGTGGTTTCAGGCATCCACTGG + Intergenic
939920899 2:148111788-148111810 CAGTGGTTTCAGGCATCCACTGG - Intronic
940295351 2:152116946-152116968 CTGCGGTTTCAGGCATCCACTGG + Exonic
940346142 2:152630966-152630988 CTGAGGTTTCAGGCATCCACTGG - Intronic
940439343 2:153695920-153695942 CTGTGGTTTCAGGCATCCACTGG - Intergenic
940669304 2:156648528-156648550 CTGTGGTTTCAGGCATCCACTGG + Intergenic
940736146 2:157454641-157454663 GTGTGGATTTTGGTATCTGCAGG - Intronic
940765828 2:157788690-157788712 CTGTGGTTTCAGGCATCCACCGG + Intronic
940813412 2:158271734-158271756 CTGTGGTTTTAGGCATCTACTGG + Intronic
941100794 2:161293079-161293101 CTGAGGTTTCAGATATCCACTGG + Intergenic
941142573 2:161803753-161803775 CTGAGGTTTCAGGCATCTTTTGG - Intronic
941511138 2:166411744-166411766 CTGCGGTTTCAGGCATCCACTGG + Intronic
941727275 2:168875198-168875220 CTACGGTTTCAGGCATCTGTTGG - Intronic
942242689 2:173977844-173977866 CTGAGGTTTCAGGCACCTACTGG - Intergenic
942408136 2:175677139-175677161 CGGTGGTTTCAGGCATCCACTGG - Intergenic
942889513 2:180971215-180971237 CTGTGGTTTCAGGCATCCCCAGG - Intronic
943475439 2:188348780-188348802 CTGTGGATTTTGGTATCTGTAGG + Intronic
943939063 2:193966422-193966444 CCGTGGTTTCAGGCATCCACTGG - Intergenic
945234083 2:207618304-207618326 CTGTGGTTTCAGGCATCCACTGG - Intronic
945542191 2:211102104-211102126 CTGTGGTTTCAAGTACCCACTGG + Intergenic
946845963 2:223859338-223859360 CTGTGGTTTCAGCTACTTGGGGG - Intronic
947464644 2:230331344-230331366 CTGCAGTTTCAGGCATCCGCTGG + Intronic
947497140 2:230646091-230646113 CTGTGTTTTCAAGGATCTGTGGG + Intergenic
947553765 2:231069004-231069026 TTGTGGTTTCAGGCATCTGCTGG + Intronic
947781026 2:232763367-232763389 CTGTGGTTTCAGGCATCCACTGG - Intronic
948141100 2:235671886-235671908 CTGTGTTTTGAGGTTTCTGGAGG - Intronic
948226247 2:236311343-236311365 CTGTGAGCTCAGGAATCTGCTGG + Intergenic
948872135 2:240806992-240807014 CTGTGGATTTTGGTATCTGTGGG - Intronic
1168768888 20:401282-401304 CTGTGGTTTCAGGCATCCACTGG - Intergenic
1168784884 20:529873-529895 CTGTGGTTTCAGGCATCCACTGG + Intronic
1169100395 20:2942854-2942876 CTGTGGTTTTAGGCATCCACTGG - Intronic
1169100419 20:2943168-2943190 CTGTGGTTTCAGGCATCTACTGG + Intronic
1169254746 20:4088459-4088481 CTGCGGTTTCAGGCATCCACTGG + Intergenic
1169732335 20:8799742-8799764 CTGTGGATTTGGGTATCTGAGGG - Intronic
1169948122 20:11011229-11011251 ATGTGGTTGCAGGTATATGTTGG - Intergenic
1170379104 20:15736819-15736841 CTGTGGATTTTGGTATCTGCAGG + Intronic
1170899302 20:20445176-20445198 CTGAGGTTTCAGGCATCCACTGG + Intronic
1170919446 20:20663343-20663365 CTGTGGTTTCAGGCATCCCTTGG - Intronic
1171023201 20:21605495-21605517 CTGTGGATTCAGGTATCCACTGG + Intergenic
1172147863 20:32769418-32769440 CTGTGGGTTCAGCCATGTGCTGG - Intronic
1172261273 20:33567954-33567976 CTGGGGTTTCAGGCATCCGCTGG + Intronic
1172725018 20:37033139-37033161 CTGTAGTCTCAGCTATTTGCGGG - Intronic
1172824474 20:37769142-37769164 CTGTAGTTTCAGGCATCCACTGG + Intronic
1173063459 20:39684123-39684145 TTGTGGTTTCAGTCATCTCCAGG - Intergenic
1173338195 20:42130345-42130367 CTGTGGCTTCAGGTTCCAGCAGG - Intronic
1174740486 20:53008798-53008820 CTGAGGTTTCAGGCATCTACTGG - Intronic
1175040277 20:56043014-56043036 CCATGGTTTCAGGTGTCTACTGG - Intergenic
1176784267 21:13235696-13235718 CTGGGATTTTAGGTAACTGCTGG - Intergenic
1177033638 21:16014620-16014642 CTGTGGTTTTAGGTATATACTGG + Intergenic
1177291895 21:19123405-19123427 CTGTGGTTTCAGGCATCCACTGG - Intergenic
1177726769 21:24979017-24979039 CTGTGGTTTCAGGCATCCAGTGG - Intergenic
1177982314 21:27929557-27929579 CTGGGATTTTAGGTAACTGCTGG - Intergenic
1178104942 21:29307691-29307713 CTGCAGTTTCAGGTATCCACTGG + Intronic
1178140793 21:29681187-29681209 CCGTGGTTTCAGGCATCCACTGG + Intronic
1178209696 21:30515569-30515591 CTGTGATTTCAGGCATCCACTGG - Intergenic
1178329928 21:31679383-31679405 CTGTTATTTCAGTTTTCTGCAGG - Intronic
1178455205 21:32742909-32742931 CTGTGGTTTCAGGTAGCCACTGG + Intronic
1178819390 21:35961644-35961666 CTGTTTTTCCAGGTACCTGCTGG + Intronic
1178973742 21:37204367-37204389 CTGTGGTTTCAGGCATCCACTGG + Intergenic
1179444367 21:41420852-41420874 CTGTGGTGTCAGGCACCTGAAGG + Intronic
1180157845 21:45986703-45986725 CTGTGGTTGGGGGCATCTGCCGG - Intronic
1180289562 22:10784391-10784413 CTGTGGTCTCTGGTCTCTGGAGG - Intergenic
1180305336 22:11068408-11068430 CTGTGGTCTCTGGTCTCTGGAGG + Intergenic
1180330447 22:11473816-11473838 CTGTGGATTTTGGTATCTGGGGG + Intergenic
1180914571 22:19476615-19476637 CTGTGGTTTCAGGCGTCCACTGG - Intronic
1181765541 22:25089188-25089210 CTGTGGATTTATGTATCTGTGGG + Intronic
1181831335 22:25563303-25563325 CTGTCATTTCAGCTTTCTGCTGG + Intergenic
1182387524 22:29958028-29958050 CTGTAGTTTCAGGGATCCACAGG + Intronic
1182744068 22:32592089-32592111 CAGTGGTTTCAGGAATCCACTGG + Intronic
1182884830 22:33764338-33764360 CTGTGGATTTTGGTATCTGTGGG - Intronic
1183075573 22:35424488-35424510 CGGTGTGTTCAGGTATCTGTGGG + Exonic
1183549338 22:38472118-38472140 CCGTGGTTTCAGGCATCCACTGG - Intronic
1184445522 22:44544789-44544811 CTGTGTGCTCAGGTATCAGCAGG - Intergenic
1184922608 22:47616166-47616188 CTGAGATTTCAGGCATCTGCTGG + Intergenic
1185013079 22:48327047-48327069 CTGTGGTCTCAGGCATCTACTGG - Intergenic
949554571 3:5142063-5142085 GTGTGTTTTCAGGTATCTTATGG + Intronic
949586041 3:5438513-5438535 CTGTGGTTTCAGGCATCCACTGG + Intergenic
949789734 3:7779885-7779907 CTGTGGGTTCAGGTGACAGCTGG + Intergenic
949872208 3:8598294-8598316 CTGTGGTTTCAGGCATCCACAGG + Intergenic
950936119 3:16841221-16841243 TTGAGGTTTCAGGCATCTGGTGG - Intronic
950944820 3:16934233-16934255 CTGTGGTTTTGGGTAAGTGCAGG + Intronic
950980477 3:17298913-17298935 TTGAGGTTTCAGGTATCCACTGG - Intronic
951431475 3:22612677-22612699 CTGTGGTTTCAGAAATCCACTGG - Intergenic
951502012 3:23398990-23399012 CTGAGGTTTCAGGCATCCACTGG - Intronic
951664542 3:25107582-25107604 TTGTGGTTTCAGGCATCCACTGG - Intergenic
951745457 3:25972990-25973012 CTGTGGTTTCAGGCATTCACTGG + Intergenic
951857872 3:27217833-27217855 CTTTGGTTTCAGGCATCCACTGG - Intronic
952077144 3:29711037-29711059 CTGTGATTTCAGGCATCCACTGG - Intronic
952252366 3:31666662-31666684 CTGTGGCTTTGGGCATCTGCTGG - Intronic
952369209 3:32703357-32703379 CTGTGGTTTCAAGTATCCACCGG - Intronic
952469000 3:33624541-33624563 CTGAGGTTTCAGGCATCCACTGG - Intronic
952475013 3:33699604-33699626 CTGTGGTTTCAGGTATCCACTGG - Intronic
952784412 3:37138584-37138606 CTGCAGTTTCAGGCATCTCCGGG - Intronic
952842981 3:37664152-37664174 CTCTGGGTTCAGCTATCAGCTGG + Intronic
953322679 3:41986325-41986347 CTGTGGTTTCAAGTATCCACTGG + Intergenic
953519111 3:43624204-43624226 CTGTGGTTTCAGGCATCCAGTGG - Intronic
953645330 3:44748463-44748485 CTGTGGTTTCAGGCATCCACTGG + Intronic
955133670 3:56194960-56194982 CTGTGGTTTTAGGTATCTATTGG - Intronic
955233698 3:57121757-57121779 CTGTGGTGTCTGCCATCTGCAGG - Intronic
955261978 3:57400483-57400505 CTGTTGTTTCAGGCATCCACTGG - Intronic
955308308 3:57857307-57857329 CTGTGATTTCAGGCATCTACTGG - Intronic
955390558 3:58519486-58519508 CTGTACTTTCAGGAAGCTGCAGG + Intronic
955741732 3:62098432-62098454 CTGTGGATTTGGGTATCTGTGGG + Intronic
957214573 3:77302678-77302700 CTGTAATTTCAGGTATCTATTGG + Intronic
957357946 3:79116155-79116177 CTATGGATTTTGGTATCTGCAGG - Intronic
957364621 3:79206543-79206565 CTGTAGTTTCAGGCATCTACTGG + Intronic
958259620 3:91365203-91365225 CTGTGGTTTCAGATACCTTGGGG - Intergenic
958477069 3:94598267-94598289 CTCTGGTTTCAGGGATGTGCTGG - Intergenic
958902644 3:99906068-99906090 CTGTGGTCCCAGCTACCTGCGGG + Intronic
958947613 3:100381115-100381137 CTTTGGTTTCAGCTCTCTACAGG + Intronic
959112357 3:102136842-102136864 CTGTGGCTTTGGGTATCTACTGG + Intronic
959138046 3:102449803-102449825 CTGTGGTTTCAGGCACCCACTGG + Intronic
959403221 3:105928914-105928936 CTGCTGTTTCAGGGATCTACTGG + Intergenic
959560689 3:107777224-107777246 CAGCGGTTTCAGGCATCTACTGG + Intronic
960799236 3:121521474-121521496 CTATGGTTTCAGATATCCACTGG + Intronic
960883752 3:122373392-122373414 CTGTGGTTGCAGCTATTTGAGGG - Intronic
961091504 3:124116627-124116649 CTGTGGTTTCAGGCATCCACTGG - Intronic
961149406 3:124624445-124624467 CTGTAGTTTCAGGCATCCACTGG + Intronic
961472747 3:127126501-127126523 TTGTGGTTTCAGGCATCCACTGG - Intergenic
961483700 3:127201123-127201145 CTGTGGCTTCAGGCATCCACTGG + Intergenic
962164352 3:133033670-133033692 CTGGGGTTTCAGGCATCCACTGG + Intergenic
962288785 3:134111859-134111881 CTTTGGTATCAGGTTACTGCTGG - Intronic
962760704 3:138510757-138510779 CTGAGGTCTCAGGTATCTACTGG - Intronic
963220717 3:142808776-142808798 CTGTGGTTTCAGGCATCCACTGG + Intergenic
963520635 3:146357031-146357053 TTGTGGTTTGAGGGATCAGCTGG - Intergenic
963854164 3:150237095-150237117 CTGTGGTTTCAGTTACCTGCAGG + Intergenic
963918888 3:150886945-150886967 CTGTAGTTTCAGGCATCCACTGG - Intronic
964753843 3:160076986-160077008 CTGTGGTTTCAGGCATGCTCCGG - Intergenic
965452038 3:168850005-168850027 CTGTGGTTTCAGGCATCCACTGG - Intergenic
965738227 3:171845087-171845109 TTGTGGTTTCAGGTAGGTGTTGG - Intronic
966005578 3:175007668-175007690 CTGAGGTTTCAGGCATCCACTGG - Intronic
966270397 3:178097807-178097829 CTGTGATTTCAGGCAGCTGGTGG + Intergenic
966623907 3:181996065-181996087 CTGTGGATTTTGGTATCTGCTGG - Intergenic
966715340 3:183008492-183008514 CTGTGGTTTCAGCTACTTGTGGG + Intergenic
966945806 3:184776496-184776518 CTGTGGTTTCAGAGATTTGGGGG - Intergenic
967005896 3:185382097-185382119 CTGCAGTTTCAGGTATCTACTGG - Intronic
967762353 3:193240681-193240703 GTGTGGTTGGAGGTCTCTGCTGG + Intergenic
967862156 3:194160375-194160397 CTGTGGTTTCAGTCCTCAGCGGG - Intergenic
968143783 3:196280272-196280294 CTAGGGGTTCAGGCATCTGCTGG - Intronic
968143799 3:196280358-196280380 CTGTGGATTTTGGCATCTGCAGG - Intronic
968150311 3:196332671-196332693 CTGTGGTTTCAGGTATCCGCTGG - Intronic
968773114 4:2521378-2521400 CTGAGGTTTCAGGCATCCACTGG - Intronic
968844967 4:3035945-3035967 CTGTGGTCTCAGCTACCTGGGGG - Intronic
969130591 4:4988174-4988196 CTGAGGTTTCAGGCATCTGCAGG - Intergenic
970579808 4:17464843-17464865 CTGTGGTTTCAGGCATCCACTGG + Intronic
970835154 4:20395347-20395369 CTGTTTTGTCAGGTACCTGCAGG + Intronic
971027760 4:22605474-22605496 CTGTGGTTGAAGGTTTCTGCAGG + Intergenic
971239607 4:24876168-24876190 CTGTGGTTTCAGGCATCCACTGG + Intronic
971862687 4:32128350-32128372 CTGTGGTCTCATGTATCTTTGGG + Intergenic
972240835 4:37189886-37189908 CTGTGGTTTTAGGCATCCACTGG - Intergenic
972375201 4:38463171-38463193 CTGTGGTTTCAGGCAACCACTGG - Intergenic
972402153 4:38715446-38715468 CTGAGGTTTCAGGTATCCATGGG + Intergenic
972405671 4:38744311-38744333 CTGTGGCTTCAGGCATCCACTGG - Intergenic
972462663 4:39319713-39319735 CTGTGGTTTCAGGCACCTACTGG - Intronic
972982446 4:44722743-44722765 CTGTGGATTTTGGTATCTGAAGG + Intronic
973082374 4:46010276-46010298 CTGTGGTTTCAGGTATTGACTGG - Intergenic
973214380 4:47653268-47653290 CTATGGTTTCAGGTATCCACTGG + Intronic
973325264 4:48854169-48854191 CTGAGGTTTCAGGCATCCACAGG - Intronic
974572464 4:63670551-63670573 ATGTTGTTTCAGGTATCCACTGG - Intergenic
974761721 4:66285303-66285325 CTGTGGTTGCTGGTGTCTCCAGG - Intergenic
974803724 4:66853276-66853298 CTGAGGTTTCAGGCATCCACGGG - Intergenic
974825626 4:67125901-67125923 CTGTGGTTTCAGGCATCCACCGG - Intergenic
974856568 4:67468019-67468041 CTGTGGTTTCAGGCATTCACTGG - Intergenic
975100844 4:70511430-70511452 CTGTGGTTTCAGGCATCCACTGG - Intergenic
975125350 4:70776130-70776152 CTGTGGTTTCAGATATCCTTTGG - Intronic
975322325 4:73022829-73022851 CTGTGGATTCAGTTATGTGCAGG - Intergenic
975548394 4:75584615-75584637 CTGAGGTTTCAGGCATCCGCTGG - Intronic
975676200 4:76830396-76830418 CTGTGGTTTCAGGCATCCACTGG + Intergenic
975869558 4:78764745-78764767 CCTTGGTTTCAGGTATCCTCTGG - Intergenic
976419505 4:84824420-84824442 CTGTGGTTTCAGGTATCCATTGG + Intronic
976419644 4:84826382-84826404 CTGTGGATTTTGGTATCGGCAGG + Intronic
976533731 4:86187157-86187179 CTGTGGTTTCAGGCATCCACTGG - Intronic
976567092 4:86563616-86563638 CCGTGGTTTCAGGCATCTACTGG - Intronic
976773533 4:88681552-88681574 ATGTGGATTTTGGTATCTGCAGG - Intronic
976808591 4:89075518-89075540 CTGCGGTTTCAGGCATCCACTGG + Intronic
976842337 4:89446117-89446139 CAGTGATTTAAGGTATCTGGTGG - Intergenic
976897989 4:90135452-90135474 TTGTGTTTTCTGGTGTCTGCTGG - Intronic
976904541 4:90220244-90220266 CTGTGGCTTCAGGCATCTGCTGG + Intronic
976912324 4:90323075-90323097 CAGTGGCTTCAGGAATATGCAGG + Intronic
976988946 4:91339745-91339767 CTATGCTTTCAGGCATCTACTGG - Intronic
977415176 4:96723426-96723448 CTGGGGTTTCAGGTATCTTAAGG + Intergenic
977850241 4:101818806-101818828 CTGTAGTTTCAGGGATCCGCTGG + Intronic
978254521 4:106678486-106678508 CTGTGGCTTCAGGCATCAACTGG - Intergenic
978709001 4:111754287-111754309 TTGTGGTTTCAGGCATCCACTGG - Intergenic
978820013 4:112956072-112956094 CTGAGGTTTCAGGCATCCCCTGG - Intronic
979097554 4:116570174-116570196 CTGCGGTTTCATGTATCCACTGG - Intergenic
979425302 4:120556992-120557014 CTGTGGTTTCAGGCATCAACTGG - Intergenic
979479594 4:121200787-121200809 CTGGGGTTCCAGAAATCTGCTGG - Intronic
979490289 4:121319040-121319062 CTGTGGTTTTAGGAATCCACTGG + Intergenic
979936170 4:126699027-126699049 CTGTGGTTTCAGGCATCCATTGG + Intergenic
979968532 4:127106334-127106356 CAGAGGTTTCAGGTATCCCCAGG + Intergenic
980334285 4:131450216-131450238 CTGTGGTTTCAGGCATCCACTGG + Intergenic
980435647 4:132769062-132769084 CTGTGGCTTCAGGCATCCACTGG + Intergenic
980517325 4:133879445-133879467 CTGTGGTTTCTGGTATCCACTGG - Intergenic
980661302 4:135862583-135862605 CTGTGGTTTAAGGCATCCTCTGG + Intergenic
980828363 4:138099325-138099347 CTGTGGATTTTGGGATCTGCAGG - Intergenic
981258419 4:142690855-142690877 CTGTGGTTTCTAGTTTCTGGAGG - Intronic
981762283 4:148207770-148207792 CTGTGGTTTCAGGCATCCACTGG - Intronic
981894467 4:149781681-149781703 CTGCAGTTTCAGACATCTGCTGG + Intergenic
982151223 4:152459645-152459667 CTGTGGTTTCAAGCATCCACTGG - Intronic
982169337 4:152645887-152645909 CTGAGGAGTCAGGCATCTGCAGG - Intronic
982705811 4:158708015-158708037 CTGAGGTTTCAGGCGTCTACTGG + Intronic
983057061 4:163110493-163110515 TTGTGATTTCAGGCATCCGCTGG + Intronic
983112829 4:163774075-163774097 CTGTGGATTTTAGTATCTGCTGG - Intronic
983273124 4:165586713-165586735 CTGTGTTTTCAGGCATCCACTGG - Intergenic
983500059 4:168488324-168488346 CTGTAGATTTTGGTATCTGCAGG - Intronic
983885322 4:172974924-172974946 CTGTGGTTCCTGGTGTCTCCAGG - Intronic
984050856 4:174863730-174863752 CTGTGTGTTCAGGTATCATCTGG + Intronic
984284084 4:177707483-177707505 CTGTGGTTTCAGATATACACTGG + Intergenic
984434741 4:179695202-179695224 CTGAGGTTTCAGGCATCCACTGG - Intergenic
984461264 4:180040168-180040190 CTGTGGATTTTGATATCTGCAGG + Intergenic
984725590 4:183017101-183017123 CTGCGGTTTCAGGCATCCACTGG - Intergenic
984860667 4:184235354-184235376 CTGTGGTTTTAGGCATCCACTGG - Intergenic
985196300 4:187433382-187433404 CTTTGGCATCAGGTATCTCCGGG + Intergenic
985757349 5:1726847-1726869 CTGTGTCTACAGGTATCCGCAGG - Intergenic
985854128 5:2411935-2411957 CTGTGGCAGCAGCTATCTGCAGG - Intergenic
986374929 5:7121240-7121262 CTGTGGATTTTGGTATCTGTGGG + Intergenic
986837706 5:11659315-11659337 CTGTGAATTTTGGTATCTGCAGG + Intronic
987552739 5:19405114-19405136 CTGTGGTTTCAGGCATCTACTGG + Intergenic
987669493 5:20988935-20988957 TTGTGGTATCAGGTTGCTGCTGG - Intergenic
987866384 5:23544964-23544986 CTGTGGTTACAGGTATTCCCAGG + Intergenic
988008957 5:25458363-25458385 CTGTGGTTTCAGGTATCCACTGG - Intergenic
988294941 5:29344782-29344804 CAGTGGTTTCAGGCATCCACTGG + Intergenic
988356022 5:30175918-30175940 CTGAGGTTTCAGGCATCTACTGG + Intergenic
989162303 5:38403224-38403246 CTGCAGTTTCAGGTATCCACTGG - Intronic
989491847 5:42065270-42065292 CTATGGTTTCAGGCATCTACTGG + Intergenic
989553193 5:42759935-42759957 CTGTGGTTTCAGGCATCCACTGG + Intronic
990073051 5:51808662-51808684 CTGTATTTTCAGGTATCTGGTGG + Intergenic
990250424 5:53908607-53908629 CTGTAGTTTCAGGCATCCACAGG + Intronic
990286524 5:54305540-54305562 CTGTGGTTTTAGGTATCCACTGG - Intronic
990454679 5:55973553-55973575 CTGTTGTTAATGGTATCTGCAGG - Intronic
990596120 5:57314194-57314216 TTGTGGTTTCAGGCATCCACTGG + Intergenic
990604764 5:57397655-57397677 CTGTGGTTTCAGGAATCCACTGG + Intergenic
991039580 5:62161995-62162017 CTGTGGTTCCTGGCATCTCCAGG - Intergenic
991228427 5:64300557-64300579 CTGTGGTTTCAGGCATCTACTGG + Intronic
991306616 5:65183527-65183549 CTGCAGTTTCAGGTATCGACTGG + Intronic
991616464 5:68501927-68501949 CTGTGGATTTTGGTATCTGCTGG + Intergenic
991914741 5:71594579-71594601 CTGTGGCATCAGGTGCCTGCTGG + Intronic
992240301 5:74762291-74762313 CTGAGGTTTCAGGAATCCACTGG - Intronic
993193711 5:84712289-84712311 CAGTGGTTTCAGGAATCCACTGG + Intergenic
993460284 5:88173598-88173620 CTGTGGTTTCAGGCATCCACTGG - Intergenic
995098311 5:108266884-108266906 CTGTGGTTTCAGACATCTACTGG + Intronic
995366710 5:111369694-111369716 CTGTGAATTTTGGTATCTGCAGG - Intronic
995370689 5:111415604-111415626 CCATGGTTTCAGGCATCTACTGG + Intronic
995525633 5:113048686-113048708 CTGTGGTTTCAGGCATCTATGGG + Intronic
995541008 5:113186264-113186286 CTGTGTTTTCAAGTTCCTGCTGG - Intronic
996024618 5:118630926-118630948 CTGCAGTTTCAGGCATCCGCTGG - Intergenic
996586201 5:125090488-125090510 TTGTGGTTTCAGGCATCCACTGG + Intergenic
996617099 5:125455100-125455122 CTGTCATTTCAGGTATCTACTGG + Intergenic
996848482 5:127927401-127927423 CTGTGGTTGCAGGCATCCACGGG + Intergenic
997247203 5:132359857-132359879 CTGAGGTTTCAGGAATCCCCTGG - Intergenic
997621650 5:135302735-135302757 CTGTGGTTTCAGGCATCCACTGG + Intronic
998448204 5:142214551-142214573 CCATGGTTTCAGGTATCCACTGG - Intergenic
998538873 5:142960568-142960590 CTGAGGTTTCAGGCATCTACTGG + Intronic
998734713 5:145123590-145123612 CTGTAGTTTCAGACATCTACTGG - Intergenic
998912876 5:146979640-146979662 CTGTGGTTTCAGGCATTTACTGG - Intronic
999101512 5:149029380-149029402 TTGGGGTTTGAGGTAGCTGCAGG + Intronic
999109420 5:149105326-149105348 CTGTGGATTTTGGTATCTGTAGG - Intergenic
999878577 5:155835996-155836018 CTGTGGTTTCAGGCATCCACTGG + Intergenic
999890112 5:155968653-155968675 CTATGGTTTCAGGCATCTACTGG + Intronic
999927150 5:156391690-156391712 CTGTGGATTTTGGTATCTGCAGG + Intronic
999934597 5:156473236-156473258 CTGTGGTTTCAGGCATCTACTGG - Intronic
1000074873 5:157775534-157775556 CTGTGGATTGTGGTATCTACTGG + Intergenic
1000419223 5:161019181-161019203 CTGTGGTTTCAGGCATCCACTGG + Intergenic
1000825201 5:166036191-166036213 CTGTAGTTTCAGGCATCCCCTGG - Intergenic
1000870388 5:166569918-166569940 CTGTAGCTTCTGGTATTTGCTGG + Intergenic
1002356462 5:178633388-178633410 CTGTGGTTTCAGGCACCCACTGG + Intergenic
1002790251 6:432237-432259 GTGTGGTTTGAGGTGGCTGCTGG - Intergenic
1002870786 6:1165816-1165838 CTGTGGTTTCAGACACCTGGAGG + Intergenic
1003522307 6:6868642-6868664 CTGTGTTTTCCCGCATCTGCTGG + Intergenic
1003548074 6:7077866-7077888 CTGTGGATTTTGATATCTGCGGG + Intergenic
1003897906 6:10624795-10624817 CTATGGTCTCAGCTATCTGTGGG + Intronic
1003898017 6:10625751-10625773 CTGTGGTTTCAGGCATCCACTGG - Intronic
1003916283 6:10789462-10789484 CTGTGGTTTCAGGCATCCTCTGG - Intronic
1004043171 6:12002641-12002663 CTGAGGTTTCAGGCATCCACTGG - Intergenic
1004627494 6:17390763-17390785 CTGTGGTTTCAGGAATCCATTGG + Intergenic
1004663534 6:17730574-17730596 TTGTGGTTTCAGGCATCCTCTGG + Intergenic
1005459335 6:26053472-26053494 CTGTGGTTTCAGGCATCCACTGG - Intergenic
1005516780 6:26562418-26562440 CTGTGTTTTCAGCTCTCAGCTGG - Intergenic
1005683634 6:28231050-28231072 CCTTGGTTTCAGGCATCTACTGG - Intronic
1006366525 6:33619465-33619487 CTGTGATGTCAGGCCTCTGCTGG - Intergenic
1006576087 6:35047495-35047517 CAGTGTTTTTAGGTAACTGCAGG + Intronic
1006687952 6:35853455-35853477 CTGTGGATTTTGGTATCTGCAGG + Intronic
1007115978 6:39343593-39343615 CTGTGGCTTCAGGAATATGCAGG + Intronic
1007275573 6:40671068-40671090 GTGTTCTTTCAGCTATCTGCCGG - Intergenic
1007436028 6:41811497-41811519 CTGTGGTTTCAGGCATCCACTGG + Intronic
1008185107 6:48379527-48379549 CTGTGGTCTCAGTTCTCTGATGG - Intergenic
1008458047 6:51734925-51734947 CTGTGGATTTTGGTATCTGTAGG + Intronic
1008459529 6:51752075-51752097 CTGTGGCTTCAGTTAACTGGGGG + Intronic
1008853345 6:56051698-56051720 CTGTGGTTTCAGGCACCCCCGGG + Intergenic
1009184140 6:60553937-60553959 CTGTGGTTTCAGATACCTTGGGG + Intergenic
1009396940 6:63211233-63211255 CTGTGGTTTCAGGCACCCACTGG + Intergenic
1009667094 6:66696819-66696841 CTGTGGTTTCAGGCATCCACTGG + Intergenic
1009708050 6:67280756-67280778 CAGTGGATTTTGGTATCTGCAGG + Intergenic
1009989438 6:70823573-70823595 TTGTGGATTATGGTATCTGCAGG - Intronic
1010661992 6:78582231-78582253 CTGTATTTTCAGGTCTCTCCTGG + Intergenic
1010688824 6:78883950-78883972 CTATGGTTTCAGGTATCTGCTGG + Intronic
1010711241 6:79177254-79177276 CCGTAGTTTCAGGGATATGCTGG + Intergenic
1010756607 6:79672651-79672673 CTGTCATTTCAGGTGTCTTCTGG + Intronic
1010800700 6:80171811-80171833 CTGTGCTGTCAGGTCTATGCTGG + Intronic
1010984551 6:82408758-82408780 CTGAGGTTTCAGGCATCCACTGG - Intergenic
1011375811 6:86685684-86685706 CTGTGGTTTTAGGCATCCACTGG + Intergenic
1012019217 6:93895093-93895115 CTGTGGTTACAGGCATCTACTGG + Intergenic
1012257342 6:97049098-97049120 CTGAGGTTTCAGGCATCCACTGG - Intronic
1012519568 6:100104611-100104633 CTATGGTTTCCAGCATCTGCTGG - Intergenic
1012624076 6:101385167-101385189 CTGTTGTATCAGGTATCATCTGG - Intergenic
1012812939 6:103983941-103983963 CTGAGGTTTCAGGGATCCACTGG - Intergenic
1012990531 6:105921348-105921370 CTGAGGTTTCAGGCATCCACTGG - Intergenic
1013194804 6:107835616-107835638 CTGTAGTTTCAGCTACTTGCTGG + Intergenic
1013291792 6:108726275-108726297 CTGTGGTTTCAGGCATCCGCTGG - Intergenic
1013334211 6:109138821-109138843 CTGTGGTTTCAGGCAACTAAAGG - Intronic
1013438758 6:110139747-110139769 TTGTGGTTTCAGGCATCCACTGG - Intronic
1014148799 6:118029574-118029596 CTGTGGTTTCAGGCATCCACTGG + Intronic
1014418661 6:121214609-121214631 CTGTGGTTCCTGGCATCTCCAGG - Intronic
1014607847 6:123499959-123499981 CTGTGGATTTTGGTACCTGCAGG + Intronic
1014890763 6:126842260-126842282 CTGTTGTTTCAGATATTTCCAGG - Intergenic
1015002512 6:128236091-128236113 GTGTGGTTTCAGGCATCCACTGG + Intronic
1015027097 6:128548061-128548083 CTGTGGATTTGGGTATCTGCAGG + Intergenic
1015076442 6:129164120-129164142 CTGTGATTTCAGGTATCAACTGG - Intronic
1015362935 6:132361272-132361294 CTGTGGTTACAGGAAACAGCTGG + Intronic
1015675282 6:135739399-135739421 CTGTGGTTTCAGGCATCCACAGG - Intergenic
1015820093 6:137251769-137251791 CTGTGAATTTTGGTATCTGCAGG - Intergenic
1015947147 6:138514421-138514443 CTGTGGTTTTAGGCATCCACTGG - Intronic
1015987466 6:138898820-138898842 CTGAGGTTTCAGCCATCTACTGG - Intronic
1016796906 6:148127772-148127794 CTGTGGTTTCAGGCATTCACTGG - Intergenic
1017273041 6:152531424-152531446 CTGTGGCTTCAGGCATCTACTGG + Intronic
1017291855 6:152746263-152746285 CAGTGGTTTCAGGCGTCTGCCGG - Intergenic
1017320814 6:153090869-153090891 CTGTGGTTTCAGGTGTCCACAGG + Intronic
1018490591 6:164288430-164288452 CTGTGGTCTCAGCTACCTGGGGG + Intergenic
1018599024 6:165518924-165518946 CAGTGGTTTCAGGCATCCACTGG + Intronic
1018797751 6:167200413-167200435 CTGTGGTTTCAGGCATCTACTGG + Intergenic
1018811718 6:167303067-167303089 CCGTGGTTTCAGGCATCCGCTGG + Intronic
1019261638 7:85006-85028 CCCCGGTTTCAGGCATCTGCTGG - Intergenic
1019264376 7:104876-104898 CTGTGGTCTCAGCCATCTACTGG - Intergenic
1019436873 7:1026894-1026916 CTGTGCTGTCAGGAAACTGCAGG + Intronic
1019468840 7:1206897-1206919 CTGTGGTTTCAGGCCTCCACTGG + Intergenic
1019891486 7:3950814-3950836 CTTTGGTTTTAGGTATCCCCGGG + Intronic
1019981012 7:4622311-4622333 CTGAGGTTTCAGGCATCCACTGG + Intergenic
1020349907 7:7208404-7208426 CTGCGGTTTCAGGCATCCACTGG + Intronic
1020359245 7:7309432-7309454 CAGTGGTATCAGGAAACTGCAGG + Intergenic
1020390657 7:7654471-7654493 CTGTGGATTTGGGTATCAGCAGG - Intronic
1020590083 7:10124473-10124495 CTATGGTTTCAGGCATCCACTGG - Intergenic
1021332322 7:19354235-19354257 CTTTGGTTTCAGGCATCCACTGG + Intergenic
1021538557 7:21732028-21732050 CTGTGGTTTCAGGCATTCCCTGG + Intronic
1021611796 7:22464911-22464933 CTGTGGTTTCGGGTATCCACTGG - Intronic
1022057995 7:26760444-26760466 CTGTAGTTTCAGGCATCCACTGG - Intronic
1022154562 7:27646456-27646478 CTGTGGTTTCAGGCATCCACTGG - Intronic
1023240785 7:38145175-38145197 CTGTGGTTTCAAGCATCCACTGG - Intergenic
1023244792 7:38190084-38190106 CTGTTGTTTCAGGCATCCCCTGG - Intronic
1023269652 7:38448378-38448400 TTGTGGTTTCAGGCATCCCCTGG - Intronic
1023608267 7:41949077-41949099 CTGTGGATTTTGGTATCTGTCGG - Intergenic
1023775331 7:43600262-43600284 CTGTGTTTTCAGTTGTATGCAGG - Intronic
1023949643 7:44832825-44832847 CTGTGGTCCCAGCTATTTGCAGG + Intronic
1024133633 7:46383971-46383993 CTGTGATCTCAGTTATCTGATGG + Intergenic
1024509608 7:50193070-50193092 CTGTGGTTTCAGGCATCCACTGG - Intergenic
1024711398 7:52019034-52019056 CTGTGGTTTCAGGGAATTCCAGG - Intergenic
1027125116 7:75551329-75551351 CTGGGATTACAGGTATGTGCTGG + Intronic
1027150199 7:75728272-75728294 CCGTGATTTAAGGTGTCTGCTGG - Intronic
1027431921 7:78123331-78123353 CTGTGATTTCAGGCATCCGCTGG - Intronic
1027464833 7:78502678-78502700 CTGAGGTTTCAGGCATCCACTGG + Intronic
1027547908 7:79553690-79553712 CTGTAGTTTCAGGCATCCACTGG - Intergenic
1027696273 7:81414791-81414813 CTGTGGTTCAAGTTTTCTGCTGG + Intergenic
1027776332 7:82470036-82470058 CTGTGGATTTTGGTGTCTGCGGG - Intergenic
1028133836 7:87206481-87206503 TTGTGGTTTCAGGCATCCACTGG - Intronic
1028544219 7:91979537-91979559 CTGTGGTTTCAGGTCTCCACTGG - Intronic
1028959306 7:96731320-96731342 CTGTGGTTTCAGGCATGTACCGG - Intergenic
1029004451 7:97193708-97193730 ATTTGGTTTCAGGTATTTGCTGG - Intergenic
1029938683 7:104456453-104456475 CTGAGGTTTCAGGCATCCACTGG - Intronic
1030001235 7:105065514-105065536 CTGCAGTTTCAGGCATCTACTGG - Intronic
1030513967 7:110518823-110518845 CTGTGGTTCCTGGCATCTCCAGG - Intergenic
1030551135 7:110961241-110961263 CTGTGGATTTTGGTATCTGTGGG - Intronic
1030610476 7:111683455-111683477 CTGAGGTTTCAGGCATCCACTGG + Intergenic
1031641473 7:124169904-124169926 TTGTGGTTTCAGGCATCCACTGG - Intergenic
1031921773 7:127607492-127607514 CTGTGGTTTCAGGTATCTGCTGG - Intergenic
1031926661 7:127645015-127645037 CTGCAGTTTCAGGCATCTGCTGG + Intergenic
1032023005 7:128420573-128420595 CTGAGGTTTCAGGCATCCACTGG + Intergenic
1032083219 7:128870184-128870206 CTGTGCTTTCAGGGACCCGCAGG + Intronic
1032514756 7:132498654-132498676 CTGTGGTTTCAGGCATCCACTGG + Intronic
1032794377 7:135265997-135266019 CCTTGATTTCAGGCATCTGCTGG - Intergenic
1032840288 7:135708028-135708050 CAGTGGTCTCAGGTCACTGCGGG - Intronic
1033321975 7:140347919-140347941 CTGTGGTTTCAGGTATCCACGGG - Intronic
1033471183 7:141650789-141650811 CTGTGGATTTTGGTATCTGAGGG - Intronic
1033735471 7:144217512-144217534 CTGGGGATTTTGGTATCTGCAGG - Intergenic
1033747583 7:144333457-144333479 CTGGGGATTTTGGTATCTGCAGG + Intergenic
1033840862 7:145371623-145371645 CTGTGGATTTTGGTATCTGCAGG + Intergenic
1034056233 7:148037960-148037982 CTGTGGTTTCAGGCATCTACTGG + Intronic
1034212834 7:149380278-149380300 CTGTGGTTTCAGGCATCCACTGG + Intergenic
1034223697 7:149465358-149465380 CTGTGACTGCAGGCATCTGCTGG - Intergenic
1034326831 7:150243586-150243608 TTGTGGATTTCGGTATCTGCAGG - Intergenic
1034416624 7:150968700-150968722 CTGTGGTTTCAATTATTTGGGGG + Intronic
1034595350 7:152184680-152184702 CTGTGGATTTTGGTATCTGCAGG - Intronic
1034608684 7:152344245-152344267 ATTTGGTTTCAGGCATCCGCTGG - Intronic
1034766375 7:153725676-153725698 TTGTGGATTTCGGTATCTGCAGG + Intergenic
1034867432 7:154654191-154654213 CTGTGGATTTTGGTATCTGCAGG + Intronic
1035257901 7:157643697-157643719 CTGTGGGTGCGGGTGTCTGCAGG - Intronic
1035366757 7:158353561-158353583 GTTTGCTTTCAGGTTTCTGCTGG - Intronic
1035533502 8:373920-373942 CTGTGGTTTCAGACATCTGCTGG - Intergenic
1035718830 8:1775309-1775331 CCGTGGCTTTGGGTATCTGCAGG + Intronic
1035788808 8:2284987-2285009 CTGTTGTTTCATGTAAATGCTGG - Intergenic
1035803997 8:2436718-2436740 CTGTTGTTTCATGTAAATGCTGG + Intergenic
1035930469 8:3774846-3774868 GTGTGGTTTCAGGCATCCACTGG - Intronic
1036037401 8:5034099-5034121 CTGTGTTTTCAGCCATGTGCAGG - Intergenic
1036172719 8:6504855-6504877 GTGTGATTTCAGGCATTTGCTGG + Intronic
1036533656 8:9622872-9622894 CTGTGGTTTCAGGTATCCACTGG - Intronic
1037242745 8:16795954-16795976 CCGTGGTTTCAGGTATCCACTGG - Intergenic
1037482463 8:19316955-19316977 CTGTGTTATCAGGAATATGCAGG + Intronic
1037854206 8:22358735-22358757 CTGAGGTTTCAGGCAACTGCTGG - Intergenic
1038280864 8:26163199-26163221 CTGTGATTTCAGGCATCCACTGG + Intergenic
1038419782 8:27426054-27426076 CTGTTGTTTTAGGGCTCTGCTGG - Intronic
1038453531 8:27656332-27656354 CTGAGGTTTCAGGCATCCACTGG + Intronic
1038466648 8:27770948-27770970 CCTCGGTTTCAGGCATCTGCTGG - Intronic
1038513419 8:28162067-28162089 CTGTGATATCAGGTAACTGGGGG + Exonic
1038561533 8:28585315-28585337 CTGTGGTTCCAGTTATCAGGAGG - Intergenic
1038602411 8:28959010-28959032 CTGCAGTTTCAGGCATCTACTGG - Intronic
1038966612 8:32580117-32580139 CTATGGATTTTGGTATCTGCAGG + Intronic
1039356617 8:36824516-36824538 CTGTGGTTTCAGGCATCCCCTGG + Intronic
1039533953 8:38290648-38290670 CTGGGGTTGCAGATCTCTGCTGG + Exonic
1039902026 8:41759685-41759707 CTGTGGATTTTGGTATCTACAGG + Intronic
1040817082 8:51520041-51520063 CTGCGGTTGTGGGTATCTGCCGG + Intronic
1040844271 8:51820692-51820714 CTGTGCTGTCAGGAATCTACAGG - Exonic
1041127869 8:54663571-54663593 CTGTGGTTTCTGGCATCCACTGG + Intergenic
1041188960 8:55333582-55333604 CTCTGGCCTCAGGTATCTGTGGG + Intronic
1041366963 8:57116721-57116743 CTCTGTTTTCATGTATATGCTGG + Intergenic
1041856004 8:62455890-62455912 CTGTGGTTTCATGTATCCACTGG - Intronic
1041965398 8:63669690-63669712 CTGTGGTTTCTGGCTTCTCCAGG - Intergenic
1042146582 8:65735997-65736019 CTGTGGTTTCAGGCATCCACTGG - Intronic
1042223717 8:66498543-66498565 CCATGGTTTCAGGCATCCGCTGG - Intronic
1042248778 8:66735157-66735179 CTGTGGTTTCAGGCATCCACTGG + Intronic
1042371561 8:67997301-67997323 CTGCAGTTTCAGAAATCTGCTGG - Intronic
1042481900 8:69313752-69313774 CTGTGGTTTCAGGCATCTCCTGG + Intergenic
1042511635 8:69618517-69618539 TTGTGGATTCGGGTATCTGCAGG + Intronic
1043038459 8:75228807-75228829 CTGTGGTTTCAGGCGTCCGCTGG + Intergenic
1043282674 8:78487826-78487848 CTGTGGTTTCAGGCATCCACTGG - Intergenic
1043620819 8:82190856-82190878 CTGAAGTTTCAGGCATCTACTGG + Intergenic
1044075055 8:87810916-87810938 CTGTGGTTTCAGGCATCCATTGG - Intergenic
1044951500 8:97439737-97439759 CTGTGGTTTCAGGCATCCATTGG - Intergenic
1044980522 8:97711659-97711681 CTGTGGTTTCAGTCATCCACTGG - Intronic
1045722100 8:105124596-105124618 CTGTGGTTTCAGGCATCTACTGG - Intronic
1045835557 8:106516954-106516976 CTGTGGTTTCAAGCATCCACTGG + Intronic
1046285725 8:112091436-112091458 CTGCAGTTTCAGGTATCTACTGG - Intergenic
1046439366 8:114238004-114238026 CCGTGGTTTCAGGAATCCACTGG + Intergenic
1046783649 8:118242612-118242634 CTGTGGTTTCAGGCCTCCACTGG + Intronic
1046801685 8:118435417-118435439 CTATGGTTTCAGGCATCCACTGG + Intronic
1047109785 8:121776834-121776856 CTGTGGTTTCAGGTATCTTCTGG + Intergenic
1047242627 8:123106567-123106589 CTGAGGTTTCAGGCATCCACTGG + Intronic
1047469835 8:125159636-125159658 CTGGGGTTTTAGGCATCTACTGG + Intronic
1048489197 8:134876487-134876509 ATGTGCTTGCAGGTTTCTGCTGG + Intergenic
1050416864 9:5427637-5427659 CCATGGTTTCAGGTATCCACTGG + Intronic
1050496409 9:6246927-6246949 CTTTAGTTTAAGGTAGCTGCAGG + Intronic
1050613814 9:7381161-7381183 CTGTGGTTTCAAGCATCCACTGG + Intergenic
1051077457 9:13256976-13256998 GTTTGGTTTCAGGCATCTACTGG + Intronic
1051115048 9:13685079-13685101 CCATGGTTTCAGGCATCTGCTGG + Intergenic
1051221063 9:14848856-14848878 CAGTGGATTCAGTTTTCTGCGGG + Intronic
1051286391 9:15501791-15501813 CTGTGAATTTTGGTATCTGCAGG - Intronic
1051426503 9:16937281-16937303 CCGTGGTTTCAGGCATCCACTGG - Intergenic
1052282336 9:26747542-26747564 CTGAGGTTTCAGGCATCCACTGG + Intergenic
1052595868 9:30557855-30557877 CTGTGGTTTCAGACATCCACTGG + Intergenic
1052631312 9:31043916-31043938 CTGTGATTTCAGATATTTGTAGG - Intergenic
1054734007 9:68732193-68732215 GTGTAGTTTCAGTTATTTGCAGG + Intronic
1055004663 9:71491918-71491940 CCGTGGTTTCAGGCATCCACTGG + Intergenic
1055184281 9:73431885-73431907 CTATGGTTTCAGGAATCTAATGG - Intergenic
1055548032 9:77401994-77402016 CTGTGGTTTCAGGCACCCACTGG + Intronic
1055592772 9:77835009-77835031 CTGTGGTTTCAGGCATCCACTGG - Intronic
1056033080 9:82573736-82573758 CTCTTGTTCCAGGTATCTGTAGG - Intergenic
1057108153 9:92440802-92440824 CTGTGGTTTCAGGCATCTACAGG + Intronic
1057475126 9:95393262-95393284 GTGTGGTTTCAGGCATCCTCTGG + Intergenic
1057663867 9:97028067-97028089 CTGTGGATTTTGGTATCTGCAGG + Intergenic
1057748401 9:97770754-97770776 CTCAGGTTTCAGGCATTTGCTGG - Intergenic
1057856245 9:98603002-98603024 CTGTGTTTTCCTGTGTCTGCCGG - Intronic
1058695322 9:107554137-107554159 CCGTGGTTTCAGGCATCCACTGG + Intergenic
1058858377 9:109089136-109089158 CTGTAGTCTCAGCTATCTGAGGG + Intronic
1059173500 9:112148550-112148572 CTGTGGTTACAGGAACCTGCAGG + Intronic
1059228947 9:112699636-112699658 CTGTGATTTCAGGCATCTACTGG + Intronic
1059493787 9:114692467-114692489 CTGTGGGTTAAGGAATCTGTGGG + Intergenic
1059579545 9:115529376-115529398 CTGTGTTTTCAGGCATCTACTGG - Intergenic
1060915243 9:127385028-127385050 CTGTGCTTTCCCGTATCTCCTGG + Exonic
1061128984 9:128696903-128696925 CTGTGGTTTCAGGCAGCCACTGG + Intergenic
1061546168 9:131305749-131305771 CTGTAGTTTCAGCTATCAGGAGG - Intronic
1061729631 9:132603814-132603836 CTGTGGTTCCCGCTGTCTGCAGG + Intronic
1061826883 9:133263612-133263634 CTGTGGTTTCAGACATCCACTGG + Intronic
1203486965 Un_GL000224v1:65159-65181 CAGTGGTTTTTGGTATCTGTGGG + Intergenic
1203499586 Un_KI270741v1:7059-7081 CAGTGGTTTTTGGTATCTGTGGG + Intergenic
1185772957 X:2779559-2779581 CTGTGGATTTTGGTGTCTGCGGG - Intronic
1185847774 X:3455304-3455326 CTGTGGATTTGGGTATCTACAGG - Intergenic
1185985243 X:4825438-4825460 CTGAGGTTTCAGGCATCCACTGG + Intergenic
1186043775 X:5510960-5510982 CTGTGGTCTCAGCCATCTGCTGG - Intergenic
1186747029 X:12580396-12580418 CTGTGGTTTCAGGCATCAACTGG - Intronic
1187097055 X:16160249-16160271 TTGTGGTTTCAGGCATCCACTGG + Intergenic
1187402794 X:18976715-18976737 CTGTGGTTTCAGGCACCCACAGG + Intronic
1187714254 X:22086372-22086394 CTGTGGGTTAAGGTATGGGCAGG + Intronic
1187843855 X:23515667-23515689 CTGTGGATTTTGGTATCTGTGGG - Intergenic
1187954245 X:24500372-24500394 CTGAGGATTTGGGTATCTGCGGG + Intronic
1188422820 X:30010239-30010261 ATGTGGTTTCAGTTATATGTTGG - Intergenic
1188527530 X:31102368-31102390 TTGTGGTTTCAGGCATCTATTGG + Intronic
1188638157 X:32462152-32462174 CTATGGTTTCAGGCATCTATTGG - Intronic
1189227353 X:39424001-39424023 CTTTGGTTTTATCTATCTGCAGG - Intergenic
1189378170 X:40481979-40482001 CTGTGGTTTCAGGCATCCACTGG - Intergenic
1189401025 X:40668673-40668695 CTGAGGTTTCAGGCATCCACTGG - Intronic
1189851461 X:45180727-45180749 CTGTGGCTTCAGGCATCCACTGG - Intronic
1189919520 X:45889552-45889574 CTGTAGTTTCAGGCATCCACTGG - Intergenic
1190489899 X:50971130-50971152 CTGCTGTTTCAGGCATCTACTGG - Intergenic
1191667417 X:63717570-63717592 CTGAGGTTTCAGATCTCTGATGG + Intronic
1191832915 X:65434199-65434221 CTGTGGTTTCTTTTCTCTGCAGG - Intronic
1191920283 X:66248820-66248842 CTGTGCTTTCAGGTTTCCACTGG + Intronic
1192013813 X:67305862-67305884 CTGTGGTTTCAGGCATCCACTGG - Intergenic
1192129734 X:68538038-68538060 CTGGGTTTTCAGCTTTCTGCTGG + Intergenic
1192624473 X:72713792-72713814 CTGTGCCATCAGGTAACTGCAGG - Exonic
1192772352 X:74206089-74206111 CTGTGGTTCCAGGTACCTGGAGG - Intergenic
1192988234 X:76423524-76423546 CTGTGACTTAAGATATCTGCAGG - Intergenic
1193743806 X:85250220-85250242 CTGTGGTTTCAGGTATGCCTTGG - Intronic
1195479417 X:105326172-105326194 CTGTAGTCCCAGCTATCTGCAGG - Intronic
1196334219 X:114511699-114511721 CAATGGATTCAGGTATCTGTGGG + Intergenic
1196384026 X:115128332-115128354 CTGTGGTTTCAGGCATTCACTGG - Intronic
1196595204 X:117537907-117537929 CTGTTGTTTTATGTATTTGCAGG - Intergenic
1196617727 X:117786460-117786482 CTGTGGATTTTGGTATCTGAGGG - Intergenic
1196674285 X:118402952-118402974 CTGTGATTTCAGGTATCCACTGG - Intronic
1196707627 X:118729232-118729254 CTGTTGTTTCAGGTGTGTGTGGG - Intronic
1198069934 X:133138356-133138378 ATGTGGCTTCAGTTAACTGCTGG - Intergenic
1198134889 X:133739133-133739155 CTGTGGTTTCAGGCATCCACTGG + Intronic
1198386142 X:136131325-136131347 CTGTGGTTTCAGGCATCCACTGG + Intergenic
1198484052 X:137068517-137068539 CTGTGGTTTCAGGCATCCACTGG - Intergenic
1198697639 X:139359670-139359692 CTGAGGTTTCAGGCATCCACTGG + Intergenic
1198946525 X:142021531-142021553 CTGTGGTTTCAGGCATCTCATGG - Intergenic
1199547989 X:149028262-149028284 ATGCGGTTTCAGGCATCTGTTGG - Intergenic
1199936312 X:152577028-152577050 CTGTGGATTTGGGTATCTGAGGG - Intergenic
1200313998 X:155111897-155111919 CTGTGGTTTCAGGCCTCCACTGG - Intronic
1201378960 Y:13351732-13351754 TTGTGGTTTCAGTTACCTGGGGG - Intronic
1201518503 Y:14845669-14845691 CTGTGGTTTCAGGTATCCACTGG + Intergenic
1201542738 Y:15125840-15125862 CTGTGGTCTCAGGCATCTGCTGG + Intergenic