ID: 908206428

View in Genome Browser
Species Human (GRCh38)
Location 1:61855057-61855079
Sequence CTGGATTTGTGTGGTTTTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 292}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908206424_908206428 -3 Left 908206424 1:61855037-61855059 CCATGGTTTCCATGTCTTTTCTG 0: 1
1: 1
2: 1
3: 37
4: 457
Right 908206428 1:61855057-61855079 CTGGATTTGTGTGGTTTTATAGG 0: 1
1: 0
2: 3
3: 37
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908206428 Original CRISPR CTGGATTTGTGTGGTTTTAT AGG Intronic
903858653 1:26352262-26352284 CTGGTTGTGTATGTTTTTATAGG - Intronic
907287307 1:53390123-53390145 CTGGATTTGAGTGGGTTTGGGGG + Intergenic
908048958 1:60206841-60206863 TTGGCTTTTTGTGTTTTTATTGG + Intergenic
908061296 1:60352550-60352572 CTGGTTTTGTGTGGACTTTTTGG - Intergenic
908206428 1:61855057-61855079 CTGGATTTGTGTGGTTTTATAGG + Intronic
909336286 1:74478750-74478772 GTGCATCTGTGTGTTTTTATTGG + Intronic
910063875 1:83128618-83128640 CTTGATTACTGTAGTTTTATAGG - Intergenic
910113052 1:83702296-83702318 AAGGATTTGTGTGATTTGATTGG + Intergenic
910113211 1:83703638-83703660 AAGGATTTGTGTGATTTGATTGG - Intergenic
910191519 1:84600790-84600812 CTCCATTTGTGTGCTATTATTGG - Intergenic
910353459 1:86327165-86327187 GTGTATTTGTGTGTGTTTATTGG - Intergenic
911809038 1:102250267-102250289 CTGGAGGTGTGTGGTTATCTTGG - Intergenic
912223726 1:107707396-107707418 CTTGATGAGTTTGGTTTTATTGG - Intronic
915886338 1:159725889-159725911 CTGGAGTTGTGTGTTTTTTTTGG - Intergenic
916094345 1:161335492-161335514 CTAGATTTGTTTGTTTTGATAGG + Intronic
916488074 1:165277138-165277160 ATGGATTTGTGTGGGTTTGTTGG + Intronic
917057665 1:171001537-171001559 ATGTATTTGTGTGGTTTTGAAGG + Intronic
917193466 1:172443296-172443318 CTGGATTTGTGTAAATTTATAGG + Exonic
918789656 1:188810387-188810409 ATGTAGTTGTGTGGTTTTAGCGG + Intergenic
920430017 1:205912770-205912792 CTGGATTTTTGTGGCTATAGGGG - Intergenic
920899484 1:210092605-210092627 CTGGAATTCTGTGGGTTTTTTGG + Intronic
921243625 1:213213445-213213467 CTTGATTACTGTGGCTTTATAGG + Intronic
922474326 1:225896795-225896817 ATGGATTTGTTTGCTTTTGTGGG + Intronic
922792991 1:228320750-228320772 ATGGAGTTGTATGGTTGTATAGG - Intronic
923953020 1:238981666-238981688 TTGGAGTTTTGTGGTTTAATAGG - Intergenic
924307696 1:242708353-242708375 TTGGATTTGAGTGGTTCTAATGG - Intergenic
924871931 1:248056647-248056669 CTGTAGTTGTGTGGTTTTGAGGG + Intronic
1062875097 10:936724-936746 CTGGTTTTTTGTTGTTTTTTGGG - Intergenic
1064763238 10:18643906-18643928 ATGTACATGTGTGGTTTTATGGG - Intronic
1065455567 10:25903379-25903401 CTGGTTTTGTGTGGTTAGAGGGG - Intergenic
1068132643 10:52913529-52913551 CTGGATTGGACTGGGTTTATAGG + Intergenic
1068951443 10:62781631-62781653 CTCCATTTGTCTGGTATTATTGG - Intergenic
1072875627 10:99170017-99170039 CTGTTTTTGTATAGTTTTATTGG - Intronic
1073065565 10:100757151-100757173 GTGGATTTGTGTGTGTTTGTGGG + Intronic
1073366354 10:102945395-102945417 CTGTATTTGTTTTGTCTTATTGG - Intronic
1075263242 10:120980390-120980412 GTGGATTTGCGTGGTTTACTCGG - Intergenic
1075536693 10:123277545-123277567 CTGGTTCTGCGGGGTTTTATTGG + Intergenic
1075542177 10:123324123-123324145 CTGGAGTTGTGTGTTTTCAGGGG - Intergenic
1077682587 11:4257119-4257141 GGGGGTTTGTGTGGTTTTATAGG + Intergenic
1077687447 11:4309619-4309641 GGGGGTTTGTGTGGTTTTATAGG - Intergenic
1077692615 11:4360809-4360831 GGGGGTTTGTGTGGTTTTATAGG - Intergenic
1079564202 11:21861226-21861248 CTGGATTTTGGAGGTTTTAAAGG + Intergenic
1079609516 11:22414630-22414652 CTTGAATTATGTTGTTTTATGGG + Intergenic
1079868191 11:25761613-25761635 TTGTATTTCTGTGGGTTTATTGG - Intergenic
1080153619 11:29081166-29081188 CTAGTTTTGTGGGGTTTTCTTGG - Intergenic
1080935127 11:36855166-36855188 CTGGAGCTGTGTGCTCTTATAGG + Intergenic
1080944892 11:36959877-36959899 TTGTTTTTGGGTGGTTTTATAGG - Intergenic
1080967341 11:37228475-37228497 ATAGATTTGTGTGTTTGTATTGG + Intergenic
1081246005 11:40767091-40767113 CTGTCTATGTGTGTTTTTATAGG - Intronic
1081630431 11:44685804-44685826 CTGGACATATGTGGTTTTGTCGG + Intergenic
1084334909 11:68451237-68451259 CTGGCCTAGTGTGTTTTTATAGG - Intergenic
1085722695 11:78926897-78926919 CTGGCTTTGCGTGATTTTCTAGG + Intronic
1085952371 11:81347565-81347587 CTGAATTTGTGTCTTTTCATAGG - Intergenic
1086819010 11:91411917-91411939 TTGCATTTATGTGGTTCTATTGG - Intergenic
1087367878 11:97244523-97244545 CTGGATTTGTGTGTGTGTGTTGG + Intergenic
1087375232 11:97331544-97331566 ATGGAATTCCGTGGTTTTATTGG - Intergenic
1089965143 11:122649565-122649587 CTGGATTTTTTTTGTTTGATTGG + Intergenic
1092292552 12:7171009-7171031 CTAGCTTTGTGTGGTTATTTTGG + Intergenic
1093261267 12:16940639-16940661 ATGGGTTTGTGTGGTGGTATGGG - Intergenic
1093269795 12:17046107-17046129 GTGGATGTGGGTGGTTATATGGG + Intergenic
1093389833 12:18604743-18604765 ATGTATTTGTGTGGTTTTGAAGG - Intronic
1093511309 12:19932244-19932266 CTGTATGTGTGTGCTTATATAGG + Intergenic
1094787215 12:33862612-33862634 CTTGTTTTGTTTGGTTTTGTTGG + Intergenic
1095467713 12:42505256-42505278 CTGGATTTGTGTGAGTGTTTGGG + Intronic
1095647713 12:44567986-44568008 TTTGATTAGTGTGATTTTATAGG - Intronic
1098910055 12:76199676-76199698 CTGGTTTTGTATAATTTTATAGG - Intergenic
1100415701 12:94371669-94371691 CAGTATTTATGGGGTTTTATTGG - Intronic
1100664431 12:96736040-96736062 CTGGATTTGTGAGGATTTTTTGG + Intronic
1101097290 12:101355587-101355609 CTGTTTTTGTACGGTTTTATTGG + Intronic
1101709777 12:107254487-107254509 CTGGAATTGTGTTGTTTGTTTGG + Intergenic
1104349746 12:128034743-128034765 CTGGCTTTGAATTGTTTTATTGG - Intergenic
1104624518 12:130340166-130340188 CTGGATTCTTGTGGTTTCAGAGG + Intronic
1104870645 12:131992864-131992886 CAGCATCAGTGTGGTTTTATTGG + Intronic
1105240590 13:18605553-18605575 CTGTATTTGTCTGTTTTTATAGG - Intergenic
1106672844 13:31925723-31925745 CTGTCTTTGTTAGGTTTTATAGG + Intergenic
1107606040 13:42058047-42058069 CTGGTTTTGTTGGGTTTTAGAGG + Intronic
1108055843 13:46484198-46484220 TTGGCTGTGTGTGGATTTATGGG + Intergenic
1109877866 13:68429324-68429346 ATTGTTTTGTGTGTTTTTATTGG - Intergenic
1109984267 13:69956584-69956606 CCAGATTTGTGTACTTTTATAGG - Intronic
1110689976 13:78421604-78421626 CTGGATATATGTGGTTATATAGG - Intergenic
1110833615 13:80059739-80059761 CAGGTTTTTTGTGTTTTTATTGG + Intergenic
1113063151 13:106346146-106346168 GTGGATTTAAGTGGTTTGATTGG - Intergenic
1115672952 14:35636448-35636470 GTTGTTTTGTGAGGTTTTATTGG - Intronic
1115882800 14:37939037-37939059 CTGTATTTGTGTTCTTTTATGGG + Intronic
1116972649 14:51082600-51082622 CAGGAGTTGTGGGGTTTTAGTGG + Intronic
1117199273 14:53371758-53371780 TTGGATTTTGGTGGTTGTATAGG + Intergenic
1117318587 14:54598653-54598675 CTGTATTTTTCTGGTTTTAAAGG + Intronic
1119913064 14:78368803-78368825 ATGGATTTATGAGGTTTTAAGGG + Intronic
1120677307 14:87435546-87435568 CTGCCTTTTTGTGCTTTTATAGG + Intergenic
1121649392 14:95546308-95546330 CTGTATTAGTGTGATTATATTGG + Intergenic
1121765585 14:96482739-96482761 CTTGATTTGAGTGGTTGAATGGG - Intronic
1123490683 15:20778816-20778838 CTGTATTTGTCTGTTTTTATAGG + Intergenic
1123547185 15:21347907-21347929 CTGTATTTGTCTGTTTTTATAGG + Intergenic
1124040684 15:26100106-26100128 CTGGATTTATGTGTTTTTAATGG + Intergenic
1124232498 15:27957375-27957397 CTGGTTTTGTGTTGTTTCTTTGG + Intronic
1124255229 15:28136058-28136080 ATGTATTTGTGTTCTTTTATGGG - Intronic
1126133065 15:45362719-45362741 CTGGGTTTGTATGGTTATACAGG + Intronic
1128115945 15:65105564-65105586 CTTGATTTGCATGATTTTATGGG - Intronic
1131341434 15:91605406-91605428 CTGGATTTGGAAAGTTTTATTGG + Intergenic
1131743423 15:95419236-95419258 CTGGTTTAGTCTGGCTTTATGGG + Intergenic
1202955515 15_KI270727v1_random:75136-75158 CTGTATTTGTCTGTTTTTATAGG + Intergenic
1132927132 16:2436686-2436708 CTGCAATTCTGTGGTTTTTTAGG + Intronic
1133761798 16:8804666-8804688 CTGGAGTTTAGCGGTTTTATTGG + Intronic
1133986546 16:10673295-10673317 CTAGTTTTGTGAAGTTTTATTGG + Intronic
1135486094 16:22866233-22866255 TTGGTTTTCTTTGGTTTTATAGG - Intronic
1138836396 16:60441288-60441310 CTGGAATTGTGTGGTTGGGTGGG + Intergenic
1139205851 16:65027686-65027708 CTATATTTCTGTGGTTTCATGGG - Intronic
1140658995 16:77169356-77169378 CTGGATGTGTCTGCTTATATAGG - Intergenic
1142987334 17:3704123-3704145 TGGGTTTTGTGTGGTTTTTTGGG - Intergenic
1143372589 17:6449605-6449627 CTGAATGTGTGTGGTCTTCTGGG + Intronic
1144407954 17:14971093-14971115 ATGTATTTGTGTGGTTTTGAAGG - Intergenic
1145029972 17:19496970-19496992 CTTGATTTGCGTGATTTTGTGGG - Intronic
1146575882 17:33991113-33991135 CTGGATTTTTATGAGTTTATGGG + Intronic
1147039927 17:37710663-37710685 CTGGGTTTGTGTTGTTTTGCAGG - Exonic
1148539591 17:48469567-48469589 TTGGACTTGTGTGGTTTTAAGGG + Intergenic
1149215699 17:54351472-54351494 CTGGATTTGGATGAATTTATTGG - Intergenic
1149347059 17:55749883-55749905 CTGGTTCTGTTTGGCTTTATAGG - Intergenic
1149980787 17:61309645-61309667 CTGGATGTGTGTGTTTTCCTTGG - Intronic
1150741765 17:67784783-67784805 CTTGATTTGCGTGATTTTGTGGG - Intergenic
1150857077 17:68763606-68763628 CTGGGTTTGGGAGGTCTTATGGG - Intergenic
1151072019 17:71225452-71225474 CTGGAATCCTGAGGTTTTATTGG - Intergenic
1151103868 17:71589275-71589297 CTGGACTTCTATGTTTTTATAGG - Intergenic
1151722361 17:75864700-75864722 CTGGCTTTCTGTGGTTTTGGAGG - Intergenic
1154448285 18:14453515-14453537 CTGTATTTTTCTGTTTTTATAGG + Intergenic
1155490905 18:26401028-26401050 CTGTATTTGTATTGTTTTCTTGG + Intergenic
1155727891 18:29112441-29112463 GTGGGTTTGTGTGTTTGTATAGG + Intergenic
1156196360 18:34778069-34778091 ATGGATTTGTGAGGTTTTACAGG + Intronic
1157884579 18:51354275-51354297 CTGGAATTGTTGGGTGTTATTGG + Intergenic
1158781288 18:60654955-60654977 CTTGATTAGTGTAGCTTTATGGG - Intergenic
1158902618 18:61980060-61980082 TTGCATTAGTGTGGTTTCATTGG + Intergenic
1159554870 18:69934983-69935005 TTGTTTTTGTTTGGTTTTATAGG - Intronic
1160097490 18:75888792-75888814 CTGGTTTTGTGTGGTTTTGTGGG + Intergenic
1160134604 18:76261845-76261867 CTGGAATTATGTGGGTTTTTCGG + Intergenic
1161524794 19:4747223-4747245 GTGGATTTCTGTGGTTCTCTTGG + Intergenic
1161760803 19:6170534-6170556 ATGTATTTGTGTGGTTTTGAGGG + Intronic
1161896859 19:7089020-7089042 CTGATCTTGTGGGGTTTTATAGG + Intergenic
1162609122 19:11735769-11735791 CTGGATTGGAGTGATTTTACTGG - Intronic
1162709864 19:12584792-12584814 CTGGATTTGCATGGTTCTAATGG - Intronic
1164300580 19:23958417-23958439 CTGGATTTGTATGGATTAATAGG + Intergenic
1164611064 19:29632028-29632050 CTGAATTTGTGTAGTTTTGTTGG - Intergenic
1165563969 19:36707316-36707338 CTGGTTTTGTAGAGTTTTATTGG + Intronic
925782219 2:7391799-7391821 CTGGAATTGTTTGTTTTTAAGGG + Intergenic
927245298 2:20952587-20952609 CTGCTTTAGTGTGTTTTTATAGG - Intergenic
927288311 2:21379383-21379405 CTGGAGGTCTGTGGTTTTGTGGG - Intergenic
929367546 2:41178347-41178369 ATATAGTTGTGTGGTTTTATTGG + Intergenic
931088281 2:58858825-58858847 CAGGATTTGTTTTGTTTTATAGG - Intergenic
931119706 2:59202749-59202771 CTATAATTGTGTGGTTTTATTGG + Intergenic
932376580 2:71241311-71241333 CTGGATTCATGTGGTCTTCTGGG + Intergenic
932857615 2:75253684-75253706 ATGGAATTGTGTGGTTTTATGGG + Intergenic
936854189 2:116936932-116936954 CAGGACTTGGGTGGATTTATAGG + Intergenic
938771146 2:134502030-134502052 GTGTATATGTGTGTTTTTATAGG - Intronic
938886646 2:135656587-135656609 CTGAATATGTGTGTTTTTCTAGG + Intronic
939004958 2:136776142-136776164 TTGAATCTGTGGGGTTTTATAGG + Intronic
940709158 2:157141613-157141635 ATGTATTTGTGTGGTTTTGAAGG + Intergenic
941062401 2:160862660-160862682 CAGGATTTGTGTGCTTTTCTTGG - Intergenic
941116083 2:161473938-161473960 CTGCATTTTTGTGGTTGTATTGG + Intronic
941227517 2:162867541-162867563 CTGGATCTGTCTGGTTTTATAGG + Intergenic
941278501 2:163520660-163520682 ATGGATTTGTGTAGTTTTCTAGG - Intergenic
943285665 2:185995747-185995769 ATGCATTTGTGTTGTGTTATAGG - Intergenic
943623157 2:190171874-190171896 CTGGATTTCTGTGGCATGATTGG + Intronic
944762373 2:202830011-202830033 CTTTATTTGTGTTGATTTATTGG - Intronic
945534887 2:211003686-211003708 CTGCATTTGTAAGGTTTAATTGG - Intergenic
1168947780 20:1776131-1776153 CCTGAATTGTGTGGTCTTATCGG - Intergenic
1169061806 20:2665901-2665923 CTGGTTTTGGTTGGTTTCATGGG - Intergenic
1170941831 20:20854412-20854434 CTGGATCTGTGTGTTGTTGTAGG + Intergenic
1174427503 20:50442822-50442844 ATGGTTTTATGGGGTTTTATTGG + Intergenic
1175017357 20:55806435-55806457 CAGGGTCTGTGAGGTTTTATAGG + Intergenic
1175674694 20:60936624-60936646 CTGGAGTTGTGGGGTTTGATGGG + Intergenic
1179052685 21:37902040-37902062 CTGGAGTCATGTGGTTCTATGGG - Intronic
1179822466 21:43944584-43944606 CTGGTTTTCTGTGCTTTTCTGGG - Intronic
1182790448 22:32948166-32948188 AAGGACTTGTGTGGTTTGATGGG + Intronic
1185411370 22:50684686-50684708 GTAGATTCGTGTGGTTTTCTGGG + Intergenic
949264308 3:2138963-2138985 TTGTATGTGTATGGTTTTATGGG + Intronic
949719446 3:6971476-6971498 CTTGATTTTGATGGTTTTATTGG - Intronic
949760428 3:7464528-7464550 CTGGAATTGTGTCATTTTCTAGG - Intronic
951415738 3:22419372-22419394 CTAGATTTTTGTGGTCTTGTGGG - Intergenic
951764006 3:26176761-26176783 GTGTATTTGTATGGTTTTAAAGG + Intergenic
951843077 3:27055770-27055792 ATGAATTTGTGTGGTTTTGAGGG + Intergenic
952427185 3:33187493-33187515 CTGGATATGAGTGGTGTTTTTGG - Intronic
952667054 3:35919971-35919993 GTGGTTTTGTGTGATTTTATTGG + Intergenic
953421323 3:42755701-42755723 CTGGATTTAAGTGGTTTTCAGGG + Intronic
955107582 3:55913485-55913507 CTGGATTTTTGTGGTTTTTCAGG - Intronic
955175399 3:56608898-56608920 ATGTATTTGTGTGGTTTTGAAGG + Intronic
956606973 3:71082997-71083019 CTGGATCTACGTGGTTTTAAGGG + Intronic
961232636 3:125331238-125331260 CTGTATTTGTGTACTTTTGTAGG - Exonic
961395219 3:126582350-126582372 CTGGATTTGTCTGCTTCTCTTGG - Intronic
963412020 3:144940733-144940755 CAGGATTTGTGTGATTAGATTGG + Intergenic
963552346 3:146739976-146739998 CTGGATTTTTCTGTTCTTATGGG + Intergenic
967390900 3:188953193-188953215 CTGGATTATGGTGTTTTTATAGG - Intronic
967645318 3:191916063-191916085 CTTGATTTGTTTGCTTTTTTAGG + Intergenic
968852112 4:3088729-3088751 CAGGATTTGTGTTTTTTTTTTGG + Intronic
969034707 4:4243882-4243904 CTGTATTTGTGTCCTTATATTGG - Intronic
970687353 4:18583721-18583743 CTAGAGTTGTGTGTTTTTACAGG + Intergenic
972893614 4:43591177-43591199 CTGGATATGTTTGATATTATGGG + Intergenic
974180557 4:58379447-58379469 CTGGTTCTGTGTGTTTTTAGTGG + Intergenic
975243572 4:72092129-72092151 ATGTATTTGCGTGGTTTTGTGGG + Intronic
975717114 4:77215886-77215908 CTGGATTTGTAGGGTTTACTGGG - Intronic
975807731 4:78130369-78130391 CTGCATTTGTGTGTGTTTAATGG + Intronic
977294921 4:95199646-95199668 ATGTATTTGTGTGTGTTTATTGG + Intronic
978126024 4:105136138-105136160 CCAGATGTGTGTGGTTTTATGGG - Intergenic
980238084 4:130134383-130134405 ATGTATTTGTGTGGTTTTGAAGG - Intergenic
980493907 4:133566833-133566855 CTGGGGTTATGTGGTTTTAGGGG - Intergenic
981295670 4:143127877-143127899 CTGTTTTTGTATGGTTGTATGGG + Intergenic
982162079 4:152580328-152580350 CTTGTTGTGTGTGGTGTTATTGG - Intergenic
982603778 4:157486815-157486837 CTTGATTTTGGTGGTTTTATAGG - Intergenic
984671154 4:182489462-182489484 CAGGGTTTGTGTGGATTTATAGG + Intronic
986041121 5:3995066-3995088 GTGGATTTCTGTCGTTTTCTAGG - Intergenic
989488987 5:42028399-42028421 CAGTTTTTGTGTGTTTTTATAGG + Intergenic
989783360 5:45297330-45297352 CTGGAAGTGTGTGGGTTTATGGG - Intronic
990601804 5:57366666-57366688 CTGCCTTTGTGTGATTTTTTTGG + Intergenic
990993530 5:61708281-61708303 CTGGAATTGTGAGGTTTTCAAGG + Intronic
991716423 5:69454983-69455005 CTGGTTTGGTTTGGTTTGATTGG - Intergenic
991910302 5:71552969-71552991 TTGGAGTTTTTTGGTTTTATTGG + Intronic
992110952 5:73493003-73493025 CTGACTATGTGTGGTTTTGTTGG + Intergenic
992445777 5:76832192-76832214 CTGGTTTAGTTTGGTTTTATGGG - Intronic
993547730 5:89232964-89232986 CTGGATGTGGGTAGTTTTAGAGG + Intergenic
994362708 5:98872332-98872354 CTGAATTTTTATGGTGTTATTGG - Intronic
995113240 5:108451193-108451215 CTGGATTTATCTTGTTTGATTGG - Intergenic
995714764 5:115071647-115071669 CTTGATTTGTTTGGTCTTAATGG - Intergenic
996025461 5:118640292-118640314 ATGTATTTGCGTGGTTTTAAAGG - Intergenic
997258338 5:132446096-132446118 TTGGATTTCTCTGGGTTTATGGG + Intronic
997339182 5:133129315-133129337 CTGGATTTGAGTGGTTTCTCTGG + Intergenic
997665138 5:135624613-135624635 CCTGATTTGTCTGTTTTTATGGG + Intergenic
1001113379 5:168917659-168917681 CTGGCTTTGTGTTTTTTGATGGG - Intronic
1001517261 5:172364685-172364707 TTGGTTTTGTTTGGTTTTTTTGG - Intronic
1003153722 6:3573882-3573904 CTGCATGTGTGTGTGTTTATGGG + Intergenic
1003168523 6:3701958-3701980 CTGGATTCATGAGATTTTATTGG - Intergenic
1003640979 6:7874764-7874786 CTGGATTTTTTTGTTTTTGTGGG - Intronic
1004091949 6:12512619-12512641 CTGGATTTGTATATATTTATGGG - Intergenic
1004269636 6:14182722-14182744 CTGGATTTATGTGATTTCTTAGG + Intergenic
1004560084 6:16741299-16741321 CTGGATAACTGTGGTTTTAAAGG + Intronic
1004790105 6:19016179-19016201 CTGGATTTGTGTGGTCTCCATGG + Intergenic
1005234401 6:23742993-23743015 CTGGTTTGGTTTGGTTTTAAGGG + Intergenic
1005368143 6:25100386-25100408 CTGTATTTGTCTGAATTTATTGG - Intergenic
1006199190 6:32271342-32271364 ATGTATTTGCGTGGTTTTAAAGG - Intergenic
1008364262 6:50657851-50657873 CTGCATTTCTGTGTTTTTCTAGG + Intergenic
1008475220 6:51928942-51928964 CTGAAATTGTTTGGTTTTAGGGG - Intronic
1009356473 6:62753219-62753241 CTGTATTTGTTTTCTTTTATTGG - Intergenic
1010924372 6:81725704-81725726 CTGGTTTTGTGTGCTTTTGATGG + Intronic
1011125388 6:84002004-84002026 CTGAATTTATGTAATTTTATAGG - Intergenic
1013528450 6:110997161-110997183 TGGGATTTATTTGGTTTTATAGG + Exonic
1013711891 6:112910560-112910582 CTGCATTTCTGTTGTTTTAAGGG - Intergenic
1015762385 6:136678399-136678421 CTCGTTTGGTGTGTTTTTATGGG - Intronic
1016298535 6:142602647-142602669 CTGGTTTTATGTGGTTATCTTGG - Intergenic
1017415583 6:154216961-154216983 CTTGGTTTGCATGGTTTTATGGG - Intronic
1017957140 6:159188185-159188207 CAGCATTTTTGGGGTTTTATTGG + Intronic
1018184553 6:161255145-161255167 CTGGATGTGTGAGGTATTACAGG - Intronic
1018234089 6:161705808-161705830 CTGCATTTCTGTGGTTCTACTGG + Intronic
1020017164 7:4837943-4837965 CGGCTTTTGTTTGGTTTTATTGG - Intronic
1021762527 7:23915138-23915160 CAGAATTTGTGGGGTTTTTTGGG - Intergenic
1022170851 7:27828366-27828388 TTGGATTTGGGAGGTTTTAAGGG + Intronic
1023096291 7:36662931-36662953 TTAAATTTGTGTGGATTTATGGG - Intronic
1024714130 7:52055237-52055259 GTGGATTTGTTTGTTTTTGTAGG - Intergenic
1025044450 7:55681047-55681069 CTGGTTTTCTGATGTTTTATTGG - Intergenic
1026298275 7:69075138-69075160 CTGGATTTATGTCTTTTTATAGG + Intergenic
1026306352 7:69145431-69145453 CTGGATATGAGTGTTTCTATGGG + Intergenic
1026370480 7:69693490-69693512 CTGGATGTGTGTGTTATTTTGGG + Intronic
1027746769 7:82085003-82085025 CTGGATTAGAGTTATTTTATAGG - Intronic
1027808751 7:82865188-82865210 CGGCATTTGTGTGGTTCTACAGG - Intronic
1028036994 7:85996924-85996946 CTGTATTTGTCTGTTTTTATAGG + Intergenic
1028363081 7:89992613-89992635 CTGGAAATGTGTGAATTTATAGG - Intergenic
1028573163 7:92314897-92314919 CTGGGTTTGTGTGGTGGTACTGG + Intronic
1029048776 7:97660959-97660981 CTGTATTTGAGTGCTATTATAGG + Intergenic
1029554283 7:101257278-101257300 CTGGCTTTGTTTTGTTTTAAGGG - Intergenic
1031219405 7:118945744-118945766 CTGGGTTTCAGGGGTTTTATAGG - Intergenic
1031673245 7:124578066-124578088 CTGCATTTTCATGGTTTTATTGG + Intergenic
1032587366 7:133159498-133159520 CTTGATTTGTGTTGCATTATTGG + Intergenic
1032632111 7:133664634-133664656 CTGGATTTGTTTGCCTTTATGGG - Intronic
1033862112 7:145641077-145641099 ATTGATTTGTGTGGTTTAACTGG + Intergenic
1034592760 7:152156975-152156997 CTTGATTTGCATGGTGTTATTGG - Intronic
1035437479 7:158869943-158869965 CAGGACTCGTGTGGTTTTCTTGG + Intronic
1036510663 8:9397268-9397290 CTGGTTTTGTAAGGTTTTTTGGG + Intergenic
1036666409 8:10745612-10745634 CAGGATTTGTCTTTTTTTATTGG + Intronic
1037131976 8:15417509-15417531 CTGGACATCTGTGGTTTTACAGG - Intronic
1038657990 8:29471729-29471751 CTGCATTTGGGTGGGGTTATTGG + Intergenic
1039288035 8:36063983-36064005 CAGGCCTTGTGTGGTTTTGTGGG + Intergenic
1039540730 8:38366348-38366370 CTATATTTGTGTGTTTTTGTGGG - Intronic
1039726816 8:40227120-40227142 CTGTATTTTTGTTGTTTTAGAGG + Intergenic
1041040030 8:53837538-53837560 CTTCATTTGTGTGGCTGTATAGG - Intronic
1041449556 8:57992974-57992996 CAGGATTTGACTGGTTTTAGAGG + Intergenic
1042856135 8:73269706-73269728 CTGGGTTTGTGTTGTATTATTGG - Intergenic
1042865401 8:73352594-73352616 TTGTATTTGTGTGTTGTTATAGG + Intergenic
1043636724 8:82393114-82393136 CTTGATTACTGTGGCTTTATAGG + Intergenic
1045796743 8:106055187-106055209 ATGGATTTCTTTGGTTTTAGGGG - Intergenic
1046248949 8:111604584-111604606 CTGGATTTCTGTGTCTTTAAAGG + Intergenic
1046266239 8:111834454-111834476 CTGTATGTGTGTGTTTTTATTGG - Intergenic
1046673626 8:117084647-117084669 CCGGACTTTTGTGTTTTTATAGG + Intronic
1048367902 8:133754294-133754316 ATGGATTTTTGTTGTATTATAGG + Intergenic
1049185243 8:141247758-141247780 ATTGATTTCTGTAGTTTTATGGG - Intronic
1049329240 8:142041295-142041317 TTAGAATTGTGTGGTTTAATTGG + Intergenic
1051078432 9:13268222-13268244 ATGAATTGGTGTGGTTTTTTGGG - Intronic
1052218556 9:25994943-25994965 TGGGATTGGAGTGGTTTTATAGG - Intergenic
1052219320 9:25999892-25999914 TGGGATTGGAGTGGTTTTATAGG - Intergenic
1052242347 9:26289394-26289416 CAGGATTTGTTTGGTTATTTGGG + Intergenic
1054783757 9:69190549-69190571 CTTGTTTTGAGTGTTTTTATTGG - Intronic
1054865897 9:70000648-70000670 CTGGATTTGTTTGGATCTAGAGG + Intergenic
1055143516 9:72904394-72904416 GTTGATTGGTGTGGATTTATGGG - Intronic
1055525859 9:77133178-77133200 CTTGTCATGTGTGGTTTTATAGG - Intergenic
1055950103 9:81722433-81722455 CTGGAACCGTGTGGTTTCATAGG + Intergenic
1056474880 9:86944413-86944435 ATGGATTTGTGTATTTTTTTTGG - Exonic
1056680429 9:88713051-88713073 ATGCATTTGTGTGGGTATATGGG + Intergenic
1057139025 9:92715715-92715737 CTTGAGTTTTGTGGTTTTGTGGG + Intronic
1057611177 9:96545125-96545147 CAGGATTTGTGTTGATTTGTAGG - Intronic
1059152084 9:111958033-111958055 TGGTATTTGTGTCGTTTTATTGG - Intergenic
1060265419 9:122109083-122109105 CTGGTTTGGGGTGGTTTTCTTGG - Intergenic
1060373862 9:123100972-123100994 TTGGCTTTTTGTGGTTTAATTGG + Intronic
1062713849 9:137992881-137992903 CTGTATTTGCCTGGTTTTGTGGG - Intronic
1187662607 X:21566809-21566831 CTTGCTTTGTGTATTTTTATTGG - Intronic
1187670363 X:21659963-21659985 CTGGATTTGTGGGGATTTGGGGG + Intergenic
1188155766 X:26740558-26740580 ATGGTTTTGTGTTGTTTTCTAGG - Intergenic
1190030439 X:46967495-46967517 CTGGATGTTTTTGGTTTTCTAGG + Intronic
1190946951 X:55104363-55104385 CAGGCTATGTGTGTTTTTATAGG - Intronic
1191820013 X:65295727-65295749 TTGTATTTCTGTGGTTTTAGTGG - Intergenic
1192687116 X:73318702-73318724 CTGGAAGTTTGTGGGTTTATGGG - Intergenic
1192746327 X:73942611-73942633 CTGGTTTTATGTGGTGTTTTTGG + Intergenic
1193311316 X:80013903-80013925 CTGGATTAGTGCGGTTTAATTGG - Intergenic
1193547357 X:82846291-82846313 CTCAATTTCTGTGGCTTTATAGG - Intergenic
1193701649 X:84769937-84769959 GTGCATGTGTGTGTTTTTATAGG - Intergenic
1194470034 X:94282927-94282949 ATGCATTTGTATGGTTTTGTGGG + Intergenic
1194846525 X:98816297-98816319 CTGGTTTTGTGTTGTTATGTAGG + Intergenic
1196024770 X:111030130-111030152 ATAGATTTGTGTATTTTTATGGG + Intronic
1196477836 X:116109606-116109628 ATGTATTTGTGTGGCTTTAAAGG + Intergenic
1197003245 X:121464824-121464846 TAGGATATGTGTGTTTTTATAGG + Intergenic
1197268763 X:124403613-124403635 CTGGAATTGGGTGGTTGTTTGGG + Intronic
1197474207 X:126900552-126900574 CTGTATTTGTGTGGTATCAGTGG - Intergenic
1198148092 X:133879076-133879098 CTGGATTACTGTGGCTTTGTTGG + Intronic
1198440919 X:136662473-136662495 CTGGTTTTGTTTTGTTTTAGTGG - Intergenic
1198949513 X:142054759-142054781 TTGGTTTTGTGTGGTCTGATGGG + Intergenic
1199544105 X:148989131-148989153 CTGGATGAGTCTGGTTGTATAGG - Intronic
1199662440 X:150065539-150065561 CTGTTTTTGTACGGTTTTATTGG + Intergenic
1201341280 Y:12937004-12937026 CTGGTTTTGTCTGGTCTTTTGGG - Intergenic
1201360128 Y:13137558-13137580 CTGGATTTATGGTGTTTAATGGG - Intergenic
1201500439 Y:14636630-14636652 CTTGTTTTGTTTTGTTTTATAGG + Intronic