ID: 908213898

View in Genome Browser
Species Human (GRCh38)
Location 1:61931127-61931149
Sequence GTCTAAAGCATGTTAAGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908213893_908213898 22 Left 908213893 1:61931082-61931104 CCTTCCCAAAGTGCTGGGATTAT 0: 294
1: 2762
2: 3456
3: 3346
4: 3393
Right 908213898 1:61931127-61931149 GTCTAAAGCATGTTAAGAGCTGG No data
908213896_908213898 17 Left 908213896 1:61931087-61931109 CCAAAGTGCTGGGATTATAGGCG 0: 9370
1: 149078
2: 285159
3: 214832
4: 149190
Right 908213898 1:61931127-61931149 GTCTAAAGCATGTTAAGAGCTGG No data
908213897_908213898 -10 Left 908213897 1:61931114-61931136 CCATCACACACTAGTCTAAAGCA No data
Right 908213898 1:61931127-61931149 GTCTAAAGCATGTTAAGAGCTGG No data
908213895_908213898 18 Left 908213895 1:61931086-61931108 CCCAAAGTGCTGGGATTATAGGC 0: 20277
1: 245443
2: 271371
3: 174555
4: 143969
Right 908213898 1:61931127-61931149 GTCTAAAGCATGTTAAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908213898 Original CRISPR GTCTAAAGCATGTTAAGAGC TGG Intronic
No off target data available for this crispr