ID: 908218335

View in Genome Browser
Species Human (GRCh38)
Location 1:61978040-61978062
Sequence GGAGGCACAAAGTGACTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 169}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908218335 Original CRISPR GGAGGCACAAAGTGACTTCT GGG (reversed) Intronic
903567459 1:24278891-24278913 TCAGGCACAAAGCGACTGCTTGG - Intergenic
904812966 1:33175819-33175841 GGAGGCACAAAGTAAGTTATGGG - Intronic
904992851 1:34607697-34607719 GGAGACACAGAAGGACTTCTGGG - Intergenic
905010672 1:34745007-34745029 GGGGGTACAGAGAGACTTCTAGG + Intronic
906952621 1:50347095-50347117 AGAGGCAAAACATGACTTCTAGG + Intergenic
906976706 1:50582056-50582078 AGGGGCCCAAAGTGACTTTTGGG + Intronic
908218335 1:61978040-61978062 GGAGGCACAAAGTGACTTCTGGG - Intronic
908255752 1:62302233-62302255 GGAGGGACAAGGTGAGCTCTGGG + Intronic
908415495 1:63909441-63909463 AGAGGCACAGAGTGGCTTCAAGG - Intronic
910532809 1:88259771-88259793 GGAAACAGAAATTGACTTCTGGG - Intergenic
915527467 1:156484891-156484913 GGAGGCACGGAATGACTTCAGGG + Intronic
915960271 1:160261034-160261056 GGGGGCACACATTCACTTCTAGG + Intronic
920884367 1:209912225-209912247 GGAAGCACAAAGTGCCTCATTGG - Intergenic
921637191 1:217510738-217510760 AAAGTCACAAAATGACTTCTAGG + Intronic
922225915 1:223645827-223645849 GGAGGCACAAAGAGTCCTCCTGG + Intronic
1064941927 10:20745036-20745058 GAAGGCTCAAAGAAACTTCTAGG + Intergenic
1066386099 10:34942575-34942597 GGAGGCACATAATCACTTTTTGG - Intergenic
1067284694 10:44899033-44899055 GGTGGCACAAAGTGACTGGGAGG + Intergenic
1067533465 10:47091480-47091502 GGAGCCAAAGAGTTACTTCTGGG - Intergenic
1071874296 10:89827609-89827631 GGAGCCACCAATTGAATTCTAGG - Intergenic
1071980775 10:91002640-91002662 GAAGGCACAAGCTGAGTTCTGGG + Intergenic
1072188945 10:93065350-93065372 GGAGTCACTAAATGTCTTCTTGG - Intronic
1072363126 10:94679949-94679971 GGAGACATAAAGGGACTTCTGGG + Intergenic
1072383750 10:94902043-94902065 GGAGACATAAAGGGGCTTCTGGG + Intergenic
1074307289 10:112290826-112290848 GGAGGAAGCAACTGACTTCTAGG + Intronic
1078010165 11:7566883-7566905 AGAGGCTCAAGGTGATTTCTGGG - Intronic
1079285317 11:19124978-19125000 GGAGCCACAAAGGGATTTCCTGG + Intronic
1080834042 11:35923265-35923287 AGAGGCATAAAGAGGCTTCTGGG + Intergenic
1082161143 11:48889111-48889133 TGAGGCACAAAGAGAGCTCTTGG + Intergenic
1082166815 11:48959745-48959767 TGAGGCACAAAGAGAGCTCTTGG - Intergenic
1082240212 11:49861379-49861401 TGAGGCACAAAGAGAGCTCTTGG + Intergenic
1083259106 11:61513630-61513652 GGAGGCAGGGAGGGACTTCTGGG - Intergenic
1087324750 11:96708004-96708026 GGAGGCACACAGGGAATTATGGG + Intergenic
1087530337 11:99373340-99373362 GGTGGCCCAAAGGGACATCTTGG + Intronic
1089574328 11:119430893-119430915 GGAGGCGGAAGGTGGCTTCTGGG + Intergenic
1090275747 11:125418167-125418189 AGAGGCAGAAAGTGAATTCATGG - Intronic
1090772895 11:129937127-129937149 GGCAGCACAAAGAAACTTCTAGG + Intronic
1092105363 12:5918160-5918182 GGAGCCACCAAGTGAGCTCTGGG + Intronic
1092527820 12:9320150-9320172 GGAGGGACAAATTCCCTTCTAGG + Intergenic
1092533194 12:9362070-9362092 GGAGGCACGAAGTCTCTTCTCGG + Intergenic
1095820675 12:46475310-46475332 GGAACCAGAAATTGACTTCTGGG - Intergenic
1096157896 12:49351418-49351440 GGAGGCACAGAGGCACTTCCTGG + Exonic
1096607544 12:52777448-52777470 GTAGGCATTAAGTTACTTCTTGG + Intergenic
1097424713 12:59428914-59428936 GGAGGCACAGTGGTACTTCTAGG + Intergenic
1098925961 12:76349569-76349591 TGAGGCACAAAGCGACTTGAAGG - Intergenic
1104046301 12:125165474-125165496 AGAGGCTCAGAGTGACTTGTGGG + Intergenic
1104540618 12:129661076-129661098 GGAGGGAAAACGTCACTTCTAGG + Intronic
1108260711 13:48653057-48653079 GGAAGTTAAAAGTGACTTCTAGG + Intergenic
1108624156 13:52211118-52211140 GAAGGCACACAGTGCCTACTGGG - Intergenic
1111369757 13:87301690-87301712 GGAGGAACACAGTGATTTTTAGG + Intergenic
1111661629 13:91219940-91219962 GAAGGCACAAATATACTTCTAGG - Intergenic
1115175012 14:30552321-30552343 GGAGGCACAAAGGGATAACTGGG + Intergenic
1116940014 14:50782078-50782100 ATAGGAACAAAATGACTTCTTGG - Intronic
1120942916 14:89966423-89966445 GAATGTCCAAAGTGACTTCTTGG - Intronic
1125427413 15:39563036-39563058 GAAGGCAGAAAGTAAGTTCTAGG - Intergenic
1128707030 15:69843861-69843883 GGAGAAACAAAGTGACTGCTTGG - Intergenic
1130757361 15:86779075-86779097 GGAGACACCAGGAGACTTCTGGG - Intronic
1131081523 15:89540369-89540391 GGGGACACACAGTGGCTTCTAGG + Intergenic
1132627621 16:899217-899239 GGAGGCACAAAGCGCTTTCAGGG + Intronic
1132935162 16:2476138-2476160 GGAGTCACCAGGTGACTTCCAGG + Intronic
1133037254 16:3040612-3040634 GGAGGGACAGAGTGACCTCAGGG + Intergenic
1136989002 16:35140631-35140653 GAAGCCACAAACTGACTTCCAGG + Intergenic
1138101716 16:54257185-54257207 AGAGGAACAAAGTGACTTTATGG + Intronic
1140832402 16:78764134-78764156 GGAGAAACACAGTGACTTTTCGG - Intronic
1143171325 17:4932323-4932345 GAAGGCACAGAGCGTCTTCTAGG - Exonic
1143195853 17:5075917-5075939 GGAAACAGAAAGTGATTTCTGGG + Intergenic
1147432543 17:40381761-40381783 GTGGGCACAAACTCACTTCTGGG - Intergenic
1147697563 17:42367444-42367466 GGAGGCAAAGAGAGACATCTGGG - Intronic
1148519100 17:48252501-48252523 GAAGGCAACCAGTGACTTCTAGG + Intronic
1148990844 17:51666013-51666035 GGAGTCACAAAGTGGCTGCCAGG - Intronic
1150591904 17:66570238-66570260 ACAGGCACAAGGGGACTTCTGGG + Intronic
1153801803 18:8677644-8677666 AGAGGCACAAGGAGGCTTCTGGG + Intergenic
1154408271 18:14117471-14117493 GTAGGGAAAAAGTGACTTCTGGG + Intronic
1158040100 18:53082885-53082907 GGAGGCACAAACTGGAGTCTAGG - Intronic
1158184186 18:54752680-54752702 GGAGGAACACAGAAACTTCTAGG - Intronic
1158212146 18:55063931-55063953 GCAGGCTCAAGGGGACTTCTGGG - Intergenic
1162561709 19:11421263-11421285 GGAGGGGGAACGTGACTTCTCGG - Intronic
1167056571 19:47114787-47114809 AGAGGCACCATGTGACTTCCTGG + Intronic
1167291709 19:48628474-48628496 GGAGGCACTCAGTGAATTGTAGG + Intronic
924995712 2:358855-358877 AGAGGGACACAGTGACTTTTAGG - Intergenic
929923599 2:46191678-46191700 GGGGGCACAAAAGGGCTTCTGGG + Intergenic
931239485 2:60439522-60439544 GGTGGCACAAACAGCCTTCTGGG - Intergenic
933335392 2:80951595-80951617 ACAGGCACAGAGGGACTTCTGGG - Intergenic
936412928 2:112276118-112276140 GGAGCCACACAGAGACGTCTAGG - Intronic
937133185 2:119528687-119528709 TGAGGGGCAAAATGACTTCTAGG - Intergenic
938415433 2:131100159-131100181 GGAGGGACAAAATGAGTTCTTGG - Intergenic
938915030 2:135929540-135929562 GAAGGTACACAGTGATTTCTGGG - Intronic
939648181 2:144727843-144727865 GGAGGCACAAGGAAACTTATGGG + Intergenic
941508479 2:166376342-166376364 AGCCACACAAAGTGACTTCTCGG - Intergenic
944853053 2:203740069-203740091 GGAGGGAAAAAGTGAATTCGGGG - Intergenic
947155517 2:227159341-227159363 AGAGGCAGAAAGAAACTTCTGGG + Intronic
948151282 2:235747039-235747061 GGATGCACTGAGTGTCTTCTGGG - Intronic
1171024677 20:21618807-21618829 GGAAGCACAAAGTAGCTTCTGGG - Intergenic
1172251170 20:33480273-33480295 GGAGGGACAGAGAGACCTCTAGG - Intergenic
1173718221 20:45229987-45230009 GGGGACACCAAGTGACTTCCAGG - Intergenic
1174064892 20:47857272-47857294 GCTGCCACAAAGGGACTTCTGGG - Intergenic
1175291844 20:57881268-57881290 GGAGGCAGAAGGTGATTTCTTGG - Intergenic
1179505466 21:41836908-41836930 TGAGGCACAAATTGACCTCCAGG - Intronic
1180182298 21:46123403-46123425 GGAGGCACAGAGCACCTTCTGGG - Intronic
1180820428 22:18823430-18823452 GGAGGCACAAGGGAACTTTTTGG + Intergenic
1181042142 22:20197217-20197239 GGAGGCTCGAAGTGAGTTCCTGG - Intergenic
1181206652 22:21257902-21257924 GGAGGCACAAGGGAACTTTTTGG + Intergenic
1181456607 22:23063582-23063604 GGAGGCACTCAGTGACCGCTGGG + Intronic
1181753855 22:25008990-25009012 GGAGGCACAGAGATACTCCTGGG + Intronic
1182023958 22:27102805-27102827 GGAGGCCGAGAGTGACTTGTTGG - Intergenic
1182105585 22:27686719-27686741 AGAGGCTGAAAGTGACCTCTGGG - Intergenic
1183411596 22:37658219-37658241 CGAGGCACATGGTGTCTTCTTGG - Intronic
949375243 3:3381848-3381870 AGAGGTACAAAATGGCTTCTGGG + Intergenic
951426431 3:22551675-22551697 AGGGGCACAAATAGACTTCTGGG + Intergenic
951930701 3:27963759-27963781 AGAAGCACAAAATGACTTTTGGG - Intergenic
953911643 3:46896288-46896310 GGAGGCACACACTGAAGTCTGGG + Intronic
955329243 3:58033239-58033261 AGAGGCACAAGGAAACTTCTGGG - Intronic
959216288 3:103454647-103454669 GGAAGCACAAAGTGACTGCAAGG - Intergenic
961714617 3:128849880-128849902 GGAGGCACAATCAGACTTCAGGG + Intergenic
961859047 3:129899837-129899859 AGGGGCACAAAGAAACTTCTGGG + Intergenic
964205060 3:154165162-154165184 GGAGGCATACAGTGACCCCTAGG - Intronic
964494497 3:157273584-157273606 GGAGGCATAAAATGCATTCTAGG + Intronic
964724121 3:159796392-159796414 GCTGGCACAAAGTGACTGCTTGG + Intronic
968285382 3:197505561-197505583 GGAGGTACAATGGGACTTCCGGG - Intergenic
968453452 4:685922-685944 GGATGCACAAAGTGTCAGCTCGG + Intronic
972702914 4:41511222-41511244 GGAAGCACAAAGAGAATTGTAGG - Intronic
973963916 4:56141013-56141035 GGAGGCCCAGAATAACTTCTAGG + Intergenic
975768707 4:77697853-77697875 GGAATCAGAAAGTGACATCTGGG - Intergenic
977465822 4:97382093-97382115 GGAGGCCCACAATGACTTTTTGG - Intronic
978087184 4:104668238-104668260 GGAGGCAAAAAGTGGTTTCATGG - Intergenic
982175858 4:152704949-152704971 GGGGGCACAAGGAGACTTTTGGG - Intronic
984257245 4:177403511-177403533 GTAGGCAGAAAGTGACAGCTGGG - Intergenic
985713331 5:1442364-1442386 GGAGGCCCAAAGAGGCTCCTGGG + Intronic
986172457 5:5325747-5325769 GGAACCACACAGCGACTTCTGGG - Intergenic
987420981 5:17719615-17719637 GCAGGAAAAAAGTGACTTCTCGG - Intergenic
987444495 5:18001081-18001103 GTAGGCACACAGGCACTTCTAGG - Intergenic
990746218 5:58961743-58961765 ACAGACACAAAGTGATTTCTGGG - Intergenic
991208673 5:64079130-64079152 CGAGGCACGAAGTGATTTTTGGG - Intergenic
993704718 5:91156535-91156557 GGAAACATAAAGTGAATTCTTGG + Intronic
994040713 5:95256584-95256606 GAAGCCAAAAAGGGACTTCTAGG - Intronic
995754503 5:115488244-115488266 GGAGTCACAAACTGAACTCTTGG + Intergenic
996177960 5:120382548-120382570 AGAGGCACAATGTGAGTACTTGG + Intergenic
997106074 5:131020203-131020225 CGAGGCAGAAAGGGCCTTCTAGG + Intergenic
997678019 5:135729131-135729153 GGAGGTACATGGGGACTTCTGGG + Intergenic
998015021 5:138724992-138725014 GGAAGCACAAAGTCTCCTCTTGG - Intronic
1003490300 6:6615375-6615397 GGAGGCCCCAACTGACATCTAGG + Intronic
1004695855 6:18032240-18032262 GGAGGCAGAAAGGGAGTTTTGGG + Intergenic
1005662588 6:28014310-28014332 GGAGACACAAAATGACATCGTGG - Intergenic
1006310280 6:33252872-33252894 GGAAGCACATAATGTCTTCTTGG - Intronic
1010780042 6:79934708-79934730 AGGGGCACTAAGTAACTTCTTGG - Intronic
1013286255 6:108684777-108684799 GGGAGAACAAAGAGACTTCTTGG - Intergenic
1014173834 6:118309482-118309504 AGAGGCACAAAGTGGACTCTGGG - Intronic
1014534375 6:122597919-122597941 GGAGGAACACAGTGACATTTTGG + Intronic
1016516092 6:144894521-144894543 GGGTGCACAAAGAGACTTCCTGG + Intergenic
1016899311 6:149085943-149085965 GGAGGCAAAACTTGTCTTCTTGG - Intergenic
1018351503 6:162964645-162964667 GGAGGCTCCAAGTGAGCTCTTGG + Intronic
1018946873 6:168353705-168353727 GGTGACATAAAGTGACTTCGAGG + Intergenic
1021355470 7:19649889-19649911 GAAGACACAAAGGGACTTATGGG + Intergenic
1023280961 7:38568978-38569000 AGAGGCACAAGGTAACATCTGGG + Intronic
1023364374 7:39449151-39449173 GGAGGCACAAGGTGGTTTCCTGG + Intronic
1024173945 7:46819182-46819204 GGAGGAACATTGTGACTGCTGGG - Intergenic
1032195394 7:129785725-129785747 GGAGGGAGAAAGGGACTCCTAGG - Intergenic
1033014086 7:137653855-137653877 GGAGGCAGTGAGTGACTGCTGGG + Intronic
1034709926 7:153182459-153182481 GGAGGCAGAGAATGACTTGTAGG + Intergenic
1034926321 7:155125250-155125272 CGTGGCACACAGTGACTTCAGGG - Intergenic
1035374381 7:158397653-158397675 GGAGGCACAGAGTGACTGGGGGG - Intronic
1037778120 8:21849081-21849103 GGGGGCACAGGGTGCCTTCTGGG - Intergenic
1038358562 8:26854644-26854666 GCAGGGACAAAGTGACTCCCTGG + Intronic
1039255802 8:35717874-35717896 GGAGCCTTAAAGTGACTTCCTGG - Intronic
1042516886 8:69668665-69668687 GGAGCCAGAAAGTGTCTTTTTGG - Exonic
1042916684 8:73882256-73882278 GGACCCACAAAGGGACTACTGGG + Intergenic
1043573210 8:81628898-81628920 TGAAACACATAGTGACTTCTGGG - Intergenic
1043578269 8:81682819-81682841 TGAAGGACATAGTGACTTCTGGG - Intronic
1043923866 8:86014992-86015014 GGAGTCCCAAAGTTCCTTCTTGG + Intronic
1044110634 8:88268645-88268667 TGATGGACAAATTGACTTCTGGG - Intronic
1047144450 8:122181606-122181628 GAAGGCACAAAGTGAATTTTAGG - Intergenic
1047387588 8:124424456-124424478 GGAGGAACAAAGTGAGTACTAGG - Intergenic
1050150386 9:2614014-2614036 GGATGCATAAAGTGACGACTGGG + Intergenic
1051533507 9:18131537-18131559 GGAAGCTCAAAGTGAAATCTCGG - Intergenic
1055297328 9:74847758-74847780 AGAGACACAAAGTTACTTATGGG - Intronic
1057319749 9:94001534-94001556 GGAGGCTCAAAATGAGTTGTGGG + Intergenic
1058194855 9:101959922-101959944 GCAGCCACAAAGAGACCTCTAGG + Intergenic
1058952182 9:109914219-109914241 TGAGGCACAAACTGCCATCTTGG - Intronic
1061135981 9:128733723-128733745 GGAGGCAAGAGGTGACTCCTTGG + Intronic
1187451759 X:19403111-19403133 AGGGGCACAAAGCAACTTCTGGG + Intronic
1189892206 X:45615289-45615311 AGAGGCACAAAGAACCTTCTGGG - Intergenic
1192775620 X:74241273-74241295 GGTCAAACAAAGTGACTTCTTGG + Intergenic
1196017433 X:110954903-110954925 GGAGGCAGGGAGTGACTTCCTGG + Intronic