ID: 908219920

View in Genome Browser
Species Human (GRCh38)
Location 1:61994847-61994869
Sequence AAGAATCCTGTATATGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 1, 2: 3, 3: 33, 4: 215}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908219920_908219928 13 Left 908219920 1:61994847-61994869 CCCAGCCCATATACAGGATTCTT 0: 1
1: 1
2: 3
3: 33
4: 215
Right 908219928 1:61994883-61994905 CCATCTTCTCATTGGGCTTTAGG 0: 1
1: 0
2: 1
3: 26
4: 209
908219920_908219924 5 Left 908219920 1:61994847-61994869 CCCAGCCCATATACAGGATTCTT 0: 1
1: 1
2: 3
3: 33
4: 215
Right 908219924 1:61994875-61994897 TTTATAACCCATCTTCTCATTGG 0: 1
1: 0
2: 2
3: 20
4: 165
908219920_908219925 6 Left 908219920 1:61994847-61994869 CCCAGCCCATATACAGGATTCTT 0: 1
1: 1
2: 3
3: 33
4: 215
Right 908219925 1:61994876-61994898 TTATAACCCATCTTCTCATTGGG 0: 1
1: 0
2: 0
3: 19
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908219920 Original CRISPR AAGAATCCTGTATATGGGCT GGG (reversed) Intronic
900772681 1:4558318-4558340 AGGAATCTTGCATATTGGCTTGG + Intergenic
900845676 1:5098341-5098363 AAGAAACCTATATATTAGCTCGG - Intergenic
901157799 1:7152217-7152239 AAGAATCCTGGGTAAGGCCTTGG + Intronic
901593144 1:10363394-10363416 AAGTATCCTGTATTTAGGCTGGG + Intronic
903417012 1:23190483-23190505 AAGAAACCTGCTTATGGGCTGGG - Intergenic
904659914 1:32076704-32076726 AAAAAGCCTGCATATGGGCAAGG + Intronic
905213925 1:36393549-36393571 CAGAATCCTATATGTGGCCTTGG - Exonic
905566144 1:38966676-38966698 AAGAATACAGTATATAGGCCGGG - Intergenic
906792932 1:48674486-48674508 CAGAATGCTGTAGGTGGGCTGGG + Intronic
908025919 1:59951529-59951551 AAGAACCCTGTAACTAGGCTTGG + Intergenic
908219920 1:61994847-61994869 AAGAATCCTGTATATGGGCTGGG - Intronic
909181401 1:72428448-72428470 AAGAATGTTGAATATTGGCTTGG - Intergenic
910498764 1:87864357-87864379 AAGTATATTGTACATGGGCTGGG - Intergenic
911638077 1:100258036-100258058 AAAAATCATGTATGTGGGCCAGG - Intergenic
912094143 1:106118856-106118878 AAGAATCCATTTTCTGGGCTGGG + Intergenic
912438361 1:109678449-109678471 TAAAAATCTGTATATGGGCTGGG + Intronic
912440874 1:109696912-109696934 AAAAAATCTGTGTATGGGCTGGG + Intronic
914724230 1:150313983-150314005 AAGGATCAGGTATCTGGGCTGGG - Intergenic
920583997 1:207139548-207139570 AAGAACCCAATATAGGGGCTGGG + Intronic
921488334 1:215742888-215742910 AAGACTCCTTTATGTGAGCTAGG + Intronic
923252596 1:232191447-232191469 GAGAATGCTTTATGTGGGCTGGG + Intergenic
924350588 1:243110660-243110682 AAAATTCGTGTGTATGGGCTGGG + Intergenic
1063928398 10:11003709-11003731 AAGCATCATGTAAATGAGCTTGG - Intergenic
1067232667 10:44423041-44423063 AAGACTCGTGTGTATGGGATGGG + Intergenic
1068544759 10:58333445-58333467 AAGATTGCTTTAAATGGGCTGGG - Intergenic
1073229862 10:101959880-101959902 AAGAATTCTCTACAGGGGCTGGG + Intronic
1074393217 10:113075160-113075182 AAGAATACTTTAAATGGGCGGGG + Intronic
1074678679 10:115881323-115881345 AAGACTCCTGGCTAAGGGCTGGG - Intronic
1075958937 10:126550249-126550271 AAGAATGCTGTATAGGAGCCAGG - Intronic
1081202893 11:40239532-40239554 AAGAATCTTGGATATGTGATTGG - Intronic
1082916050 11:58438619-58438641 AAAAATCATGCATATGGGCAAGG + Intergenic
1085516976 11:77117296-77117318 ATGAGTCCTGAATGTGGGCTAGG + Intronic
1086795149 11:91091521-91091543 AAAAAATCTGAATATGGGCTGGG - Intergenic
1087433847 11:98088122-98088144 TAGAATATTGTATATGGACTAGG - Intergenic
1087971756 11:104493155-104493177 AAGAACCGTTTATCTGGGCTGGG + Intergenic
1089037573 11:115410920-115410942 AAGAATCCTTTTTATGGTCATGG - Intronic
1090326945 11:125896062-125896084 AAGAATAGCCTATATGGGCTGGG - Exonic
1091425620 12:386261-386283 AAGAATTTTGTATTTAGGCTTGG - Intronic
1091527231 12:1315310-1315332 AAAACTTCTGAATATGGGCTGGG - Intronic
1096390823 12:51227686-51227708 AAGAATACAGGATGTGGGCTGGG - Intergenic
1096650054 12:53058126-53058148 AAGAATCCTGGAGATGGGGCAGG + Intronic
1100517909 12:95345781-95345803 AAGAATTCTGTATTTGATCTGGG + Intergenic
1101313050 12:103601294-103601316 AAGAAACCTTTAAAGGGGCTGGG + Intronic
1101551899 12:105771094-105771116 AAGAATCATGAATTTGGGGTGGG + Intergenic
1103879709 12:124156668-124156690 CAGAAACCTGCATATAGGCTGGG - Intronic
1105343987 13:19556784-19556806 AATAATGTTGTATATGGACTTGG - Intergenic
1105536050 13:21264805-21264827 AATAATGTTGTATATGGACTTGG + Intergenic
1106061107 13:26293305-26293327 AAAAATTGTGTATATTGGCTGGG + Intronic
1106793881 13:33184339-33184361 AACAAGCTTGTATATGGGCACGG + Intronic
1106930403 13:34657681-34657703 AAGAATCATGTATATGGGCTGGG - Intergenic
1107467110 13:40661247-40661269 GATAATCCTGTATATGTACTTGG - Intronic
1108020808 13:46126087-46126109 AAAAATACTGGTTATGGGCTGGG + Exonic
1108143155 13:47447708-47447730 AGGAATCCTGTATCTGGCCATGG - Intergenic
1110190384 13:72723579-72723601 AAGAATTCTGTGTTTGGACTTGG + Intronic
1110704331 13:78587456-78587478 AAATATCTTGTATATGGGTTCGG + Intergenic
1112103970 13:96219975-96219997 AAGAATCCTACCTGTGGGCTGGG - Intronic
1112121752 13:96420027-96420049 AAAAATCCTGTATATAAGTTTGG + Intronic
1112762092 13:102702885-102702907 AAGAATGCTGTTTTTGGGGTTGG - Intergenic
1114226963 14:20747390-20747412 AAGAATACAGTTTCTGGGCTGGG - Intronic
1115667993 14:35575248-35575270 AAGACTTCTGTACATGGGATAGG + Intronic
1117331653 14:54718706-54718728 AAGAATCCTGACTTTGGGCCAGG + Intronic
1118587836 14:67372533-67372555 AAAAATCCTGTATCTAGGCTGGG + Intronic
1120967298 14:90179008-90179030 GAGAAACCTGAATATGGACTGGG + Intronic
1120990162 14:90368452-90368474 AAAAATACTGTAAATAGGCTGGG - Intergenic
1125286020 15:38093155-38093177 AAGAATCCTATACCAGGGCTGGG + Intergenic
1126741827 15:51785115-51785137 AAGAATACTTTATTTGGGCCGGG + Intronic
1128963917 15:72038337-72038359 AAGAATTCTGTATTTTGGCCAGG - Intronic
1129490371 15:75919265-75919287 AAGAATATAGTATATGGGCCAGG - Intronic
1130165160 15:81448372-81448394 AATAATACAGTATATAGGCTGGG - Intergenic
1131087686 15:89590628-89590650 GAGAATGCAGTATTTGGGCTAGG - Intronic
1131597095 15:93809057-93809079 AAGAATACAGTATATAGGCCGGG - Intergenic
1137246126 16:46706587-46706609 AAGAATACAGTATATAAGCTGGG - Intergenic
1139843219 16:69898997-69899019 AAGAATCCTGCAGATTGGCTGGG - Intronic
1140228874 16:73100890-73100912 GAGAATCCTGGAAATTGGCTGGG - Intergenic
1141531028 16:84647349-84647371 AAAGATCCTGTAAGTGGGCTGGG + Intergenic
1141941980 16:87283052-87283074 AAAAAACATGTACATGGGCTGGG + Intronic
1143226490 17:5308945-5308967 AAGAATACTGTTTAAAGGCTAGG + Intronic
1143800882 17:9379671-9379693 AAGAATCCTTGATGTGGGCTGGG + Intronic
1143802550 17:9396386-9396408 AAAAATACTCTATATGGGCCGGG + Intronic
1144591010 17:16523835-16523857 AAGATTCCACTATATGGGCTGGG + Intergenic
1146884579 17:36462579-36462601 AAGAATCCTGATTCTGGGCTGGG + Intergenic
1148573303 17:48688263-48688285 AAGAATCTGTTATATGGGCCAGG - Intergenic
1148810832 17:50290036-50290058 AAGAATGCTGTGTCTAGGCTGGG - Intergenic
1149729400 17:58930098-58930120 AAGAATCAAGTATCTGGGCTGGG + Intronic
1150110474 17:62494868-62494890 AAGATTACTGTAGATTGGCTGGG + Intronic
1150326364 17:64261834-64261856 AAGAATATTGTTTATGGGCTAGG + Intronic
1151010871 17:70494543-70494565 AAGAAACCTGAAAATGGGCCAGG + Intergenic
1151344398 17:73492799-73492821 AGGAATCCTATGAATGGGCTGGG + Intronic
1151949516 17:77342670-77342692 AAGAAAGATGTATTTGGGCTGGG + Intronic
1153930223 18:9871810-9871832 AAGAAGCCTATATTTGGACTGGG + Intergenic
1154271373 18:12923250-12923272 AAATAGCCTGTATTTGGGCTGGG + Intronic
1156166035 18:34422332-34422354 AAATATCATGTATATGGGCCAGG + Intergenic
1156764054 18:40629894-40629916 ACAAATCCTGAATAAGGGCTGGG - Intergenic
1159444129 18:68519456-68519478 AAAAATCCTTTATATGGACTGGG + Intergenic
1159482945 18:69014434-69014456 AATATTCCTGTATTTGGCCTGGG - Intronic
1162537890 19:11274670-11274692 AAAAAACCTGTACATGAGCTGGG + Intergenic
1162538480 19:11278408-11278430 AAAAAACCTGTACATGAGCTGGG + Intergenic
1164303548 19:23983129-23983151 CACAATCCTGTATTTGGGCTGGG + Intergenic
1164325862 19:24190860-24190882 CACAATCCTGTACGTGGGCTGGG + Intergenic
1164326351 19:24195833-24195855 CACAATCCTGTATGTGGGCTGGG + Intergenic
1165644552 19:37424296-37424318 AAGGATCCTGTATATGAGGGTGG + Intronic
1166209020 19:41293699-41293721 CATAATCCTGTAAATGGGCTGGG + Intronic
1166498024 19:43319063-43319085 AAGAATCCTCTCTTTGGGCATGG - Intergenic
1166502269 19:43350715-43350737 AAGAATAATCTATATAGGCTGGG + Intergenic
1166507838 19:43382741-43382763 AAGAATAATCTATATAGGCTGGG - Intergenic
1168531938 19:57137187-57137209 AAGAATGCTTTTTCTGGGCTGGG + Intronic
925747814 2:7059050-7059072 AAAAATACTGTGGATGGGCTGGG + Intronic
928767178 2:34661250-34661272 AAAAATGCTGTAAATGGGCTAGG + Intergenic
931881242 2:66573701-66573723 AACAATCCCATCTATGGGCTGGG - Exonic
932378324 2:71258381-71258403 AACAACCATGTAAATGGGCTGGG - Intergenic
935264055 2:101379789-101379811 CAGAATCCTTAATATGGCCTAGG - Intronic
940013601 2:149080544-149080566 AAGAATCCAGTATATTAGCTGGG + Intronic
940105868 2:150099346-150099368 AAGAATACTGTATCAGGGCTGGG - Intergenic
940932361 2:159448296-159448318 AAGAATCATGATTCTGGGCTGGG + Exonic
942714698 2:178878612-178878634 AATAATTCTGAAAATGGGCTGGG - Intronic
943422990 2:187692008-187692030 AATGATCCTGTATATGACCTAGG - Intergenic
946236135 2:218325499-218325521 AAAAATCCCAAATATGGGCTGGG - Intronic
946492166 2:220159086-220159108 AGGAATCCTGTAGAGGGACTGGG + Intergenic
947175253 2:227359925-227359947 AAGAATTTTGGATAAGGGCTGGG - Intergenic
947808604 2:232985319-232985341 AAGAATTCAGTTTATGGGCTGGG + Intronic
1169461211 20:5797263-5797285 AAGAATAATGTGTGTGGGCTGGG + Intronic
1169808495 20:9584088-9584110 AAGAATCATGTATATAACCTGGG + Intronic
1170226623 20:13997025-13997047 AAGAATCCACTATATAGGATCGG + Intronic
1170632056 20:18074266-18074288 TAGAATCCTGTGTATTGGCTGGG - Intergenic
1170693971 20:18640924-18640946 AAGAATTCTGTAGATAGGCTGGG - Intronic
1171568964 20:26227456-26227478 CAGAATCCTGTAAATGAGCTGGG + Intergenic
1172866297 20:38101329-38101351 AAAAATCCTATCTATTGGCTGGG - Intronic
1174313045 20:49674319-49674341 AAAAATCCTGTAAATGGGCCAGG + Intronic
1175690771 20:61064641-61064663 AGAAATCCTGCATAGGGGCTTGG - Intergenic
1176001719 20:62834932-62834954 AAGAATTCACTAAATGGGCTGGG - Intronic
1177892399 21:26822354-26822376 AAGGATCCTGTCCATAGGCTTGG + Intergenic
1178717380 21:34978231-34978253 AAAAATACTGTTTATGGGCGGGG - Intronic
1179088978 21:38246199-38246221 ACGAATCATGTATCTAGGCTAGG + Intronic
1180281964 22:10708191-10708213 CAGAATCCTGCAAATGAGCTGGG - Intergenic
1183954949 22:41374055-41374077 AAGAATACAGTATATAGGCTGGG - Intronic
1203239207 22_KI270732v1_random:39354-39376 CAGAATCCTGCAAATGAGCTGGG - Intergenic
949972356 3:9419120-9419142 AAAAATCCTGTAAGTGGGCCGGG - Intronic
950262260 3:11551723-11551745 AAGAACCCATTATATTGGCTGGG - Intronic
950540106 3:13607279-13607301 AAGAATACAGAATATAGGCTGGG - Intronic
950609059 3:14113337-14113359 AGGAATGCTGGATATGTGCTAGG - Intronic
952230597 3:31425535-31425557 AAAAATCCTATGTATTGGCTAGG - Intergenic
952347313 3:32500897-32500919 AAGAATGCTTCAGATGGGCTGGG + Intronic
952464359 3:33565516-33565538 AATAATACAGTATATAGGCTGGG + Intronic
957109887 3:75940878-75940900 CAGAATCCTGTAAATGAGTTGGG - Intronic
957399664 3:79692889-79692911 ATGAATTCTGTGTTTGGGCTTGG - Intronic
958057601 3:88432817-88432839 ATAAATCCTGTAAATGAGCTTGG + Intergenic
958937280 3:100270271-100270293 AATAATTCAGTATATGGGTTAGG + Intronic
962218626 3:133544157-133544179 AAGAATAATGTATATAGGCTGGG - Intergenic
962759686 3:138498627-138498649 AAGAATGTTGTATATTGGCTGGG - Intronic
962956360 3:140270581-140270603 ATGAATCCTCTATATGAGCCTGG + Intronic
963251555 3:143108810-143108832 AGGAACCCTGTATAGGGACTAGG - Intergenic
964525090 3:157609173-157609195 ATGAATCATGTATCTGGGCGTGG + Intronic
965265892 3:166543103-166543125 AATAATCTTGTATGTGAGCTGGG + Intergenic
965580317 3:170260746-170260768 AAGCATCATGTAAATGGGCCTGG - Intronic
968213083 3:196865882-196865904 AATAATCTTACATATGGGCTGGG + Intergenic
969366821 4:6700262-6700284 AAAAATACTGTTTAGGGGCTGGG - Intergenic
970502980 4:16697127-16697149 AAAAATCCTGTCTTTGGCCTAGG + Intronic
972926058 4:44008877-44008899 AAGAATCCCATTCATGGGCTGGG - Intergenic
973087605 4:46086814-46086836 AATAAACCTGTATATGGGCAAGG - Intronic
973312231 4:48721933-48721955 AAGAAACGTACATATGGGCTGGG - Intronic
976294734 4:83458848-83458870 TAGAATTCTGTATGTTGGCTGGG + Intronic
981210825 4:142102563-142102585 AAGAATCCTAAATATAGTCTGGG - Intronic
982473956 4:155827446-155827468 AAGAATACAGTGTATAGGCTGGG + Intergenic
982722616 4:158874781-158874803 AAGAAAGCTATATATGGGCCAGG + Intronic
983690554 4:170464627-170464649 AAGGATCCTGTATAGAGCCTTGG - Intergenic
984048864 4:174838712-174838734 AAGAATGCTTATTATGGGCTGGG - Intronic
984146177 4:176064416-176064438 CAGAATTCTATATATGGGTTAGG - Intergenic
985136397 4:186790290-186790312 CAGAATCCTGGACAGGGGCTTGG - Intergenic
985497052 5:214732-214754 AAAAATCTAGTAAATGGGCTGGG + Intronic
985738517 5:1600226-1600248 AAAAATCTAGTAAATGGGCTGGG - Intergenic
987120628 5:14763449-14763471 CAGTTTCCTGCATATGGGCTGGG + Intronic
987614460 5:20254403-20254425 AAGAATGCTGGAAATAGGCTGGG - Intronic
987822537 5:22984532-22984554 AAGAATTCAGTAGTTGGGCTGGG + Intergenic
988240481 5:28601610-28601632 AAGAATACAGTATATAGGCCGGG + Intergenic
988855228 5:35221985-35222007 AAGAATCCTTTATATGTGTTGGG - Intronic
989565208 5:42894774-42894796 AAGATTGCTATAGATGGGCTGGG + Intergenic
992769188 5:80031239-80031261 AGGGTTCCTGTACATGGGCTAGG + Intronic
993393333 5:87350268-87350290 AAGCAACCTGTATATGAGGTAGG - Intronic
994681888 5:102898321-102898343 AAGAACACTGTATCTGAGCTTGG - Intronic
995301661 5:110591629-110591651 AAGAATACTGTCCATGGGATAGG - Intronic
998327666 5:141296289-141296311 AAAAATTCTATATGTGGGCTGGG + Intergenic
1000527352 5:162374141-162374163 AAAAATCCTCTATATTTGCTGGG + Intergenic
1001237786 5:170044627-170044649 AGGAATCAAGTATATGGGCCAGG - Intronic
1004045911 6:12022463-12022485 AAAAATCCTGTATATGGGCCAGG - Intronic
1006637619 6:35471778-35471800 AACAATGCTGTATTTTGGCTGGG + Intergenic
1006830341 6:36964430-36964452 AAGTATCTTGTTTAGGGGCTGGG - Exonic
1007652260 6:43430384-43430406 AAGAATTCTATTTCTGGGCTGGG - Intronic
1009339993 6:62541919-62541941 AAGCATGCTGTCCATGGGCTGGG + Intergenic
1009743715 6:67783989-67784011 GAGAATCCTGGACATGGGATGGG + Intergenic
1011810786 6:91129861-91129883 CAGAACACTGTATATGGGATAGG + Intergenic
1013235783 6:108196914-108196936 AAAAATCGTGTGTAGGGGCTGGG + Intergenic
1014086755 6:117355003-117355025 AAGAATCCTGTTTAGGCTCTTGG - Intronic
1014946832 6:127508595-127508617 AAGAATCTTGTGTATGGGTGAGG + Intronic
1020502848 7:8944703-8944725 ATGAATCCTGGCTATGTGCTAGG + Intergenic
1021712965 7:23434998-23435020 AAAAATCCTGAAAATGGGCCAGG + Intronic
1026685468 7:72505637-72505659 AAGAATCCTGGATGTGGTTTTGG - Intergenic
1027242491 7:76341095-76341117 CAGAATCTTGTACAGGGGCTGGG + Intronic
1027591268 7:80121780-80121802 AAGAATCCAGCATATGGGCTGGG - Intergenic
1027821415 7:83050007-83050029 AAGAAGACTGTATATGGGTCAGG - Intronic
1028531718 7:91845673-91845695 TAGGATCCTGAATATGGGCAAGG + Intronic
1028573438 7:92318223-92318245 AAGAATCCTGTGGCTGGGCGCGG + Intronic
1028724714 7:94074178-94074200 AAGAATCCTTTATGTGGACTGGG - Intergenic
1028839447 7:95411984-95412006 ATGAATTCTGTATATGGAGTAGG - Intronic
1030052133 7:105547435-105547457 AAGAATCCTGTGTTTGGACTTGG + Intronic
1030137220 7:106266279-106266301 AAGGATACTGTATGTGGGCAAGG - Intronic
1030290432 7:107866960-107866982 AAGAATTATATTTATGGGCTAGG + Intergenic
1031867923 7:127059629-127059651 AAAAATCATTTATATGGGCCGGG - Intronic
1032039667 7:128548771-128548793 AAGATTACTGTAGATTGGCTGGG + Intergenic
1032960434 7:137027314-137027336 CAGAATCCTTTATCTGGCCTAGG + Intergenic
1033524878 7:142201363-142201385 AAGGATGTTATATATGGGCTGGG - Intronic
1033793357 7:144818537-144818559 AAGAGTTATGTATATGGGCCGGG - Intronic
1036939608 8:13038881-13038903 AAGAATATTGCATATAGGCTGGG + Intergenic
1037485127 8:19339794-19339816 AAGAAAAATGTATAGGGGCTGGG - Intronic
1039152553 8:34523238-34523260 CTGATTCCTGTATATGGGCAAGG - Intergenic
1039365874 8:36927416-36927438 AGGAACCCTGCATATGGGCCTGG - Intronic
1040748763 8:50679944-50679966 CAGAAACCTGTATTTGGGCAAGG + Intronic
1040981330 8:53248988-53249010 AAAAATCCTGTAGATTAGCTAGG - Intronic
1042793744 8:72637492-72637514 AGGAAGCCTGTGTGTGGGCTGGG + Intronic
1043997435 8:86835850-86835872 AAAAATCCTGTACACTGGCTGGG + Intergenic
1045528154 8:102959242-102959264 AAAAATCCTGTTTTTGGGCCAGG + Intronic
1053174805 9:35915015-35915037 AAAAGTCCAGTAAATGGGCTGGG - Intergenic
1053680585 9:40483008-40483030 AAGTTTCCAGTATATGTGCTGGG - Intergenic
1054283127 9:63141927-63141949 AAGTTTCCAGTATATGTGCTGGG + Intergenic
1054842024 9:69753101-69753123 AAGAATCCTGTTTCTGGGTATGG + Intronic
1055003262 9:71477922-71477944 AACAAAAGTGTATATGGGCTTGG + Intergenic
1055679382 9:78699282-78699304 AAAAATACTCTAAATGGGCTGGG - Intergenic
1056246079 9:84696951-84696973 AAGAGTCCTGTATATGGACTTGG + Intronic
1056607721 9:88100260-88100282 AAGAATTCTGTTTATGGGGTGGG - Intergenic
1056607739 9:88100495-88100517 AAGAATTCTGTTTATGGGGTGGG - Intergenic
1057737061 9:97672831-97672853 AAGAATATAGCATATGGGCTGGG + Exonic
1057764609 9:97905858-97905880 AAAAATCAATTATATGGGCTGGG + Intronic
1058478316 9:105363758-105363780 AAAAATCATGAATATGGGCTGGG - Intronic
1058767179 9:108192827-108192849 GAGAAACCTGGACATGGGCTGGG - Intergenic
1058863380 9:109139258-109139280 CAGAAGCCAGTATATGGGGTAGG + Intronic
1060610827 9:124963092-124963114 AAGAATACAGTATATAGGCTGGG - Intronic
1061125566 9:128673095-128673117 AACAATCATGTATATGTGCCAGG + Intergenic
1185558206 X:1037925-1037947 AAGAATACCATATATAGGCTGGG + Intergenic
1186000871 X:5009016-5009038 AAGAATTCTTTATATGCACTAGG - Intergenic
1187246978 X:17561654-17561676 AGGAATGCTGGATTTGGGCTTGG + Intronic
1189708935 X:43789033-43789055 ATGAATCTGGTATTTGGGCTTGG - Intronic
1190077727 X:47330273-47330295 AAAAATTCTATACATGGGCTGGG - Intergenic
1190550306 X:51572591-51572613 AAGAACCCTGGATATGTACTGGG - Intergenic
1190623497 X:52313007-52313029 AAGAACTCTGTATATGTACTGGG + Intergenic
1192674793 X:73184528-73184550 AAGAATGTTAAATATGGGCTGGG - Intergenic
1192736757 X:73856518-73856540 AAAAATACTGTAAATGGGCTGGG + Intergenic
1196781877 X:119390872-119390894 AAAAATCCTATTTATAGGCTGGG - Intergenic
1198080254 X:133233062-133233084 AAAAATCCAGTATATGGATTTGG + Intergenic
1199822432 X:151462586-151462608 AAGAATCCTTTTTGTGGTCTAGG - Intergenic
1200714650 Y:6524380-6524402 AAGAATGATGTATGTGGGCAAGG - Intergenic
1201019174 Y:9636750-9636772 AAGAATGATGTATGTGGGCAAGG + Intergenic
1202255465 Y:22916057-22916079 CAGAATCCCATATATGGACTAGG - Intergenic
1202408456 Y:24549806-24549828 CAGAATCCCATATATGGACTAGG - Intergenic
1202462326 Y:25120274-25120296 CAGAATCCCATATATGGACTAGG + Intergenic