ID: 908220285

View in Genome Browser
Species Human (GRCh38)
Location 1:61999263-61999285
Sequence CCATAGGACAGGAAGGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908220285_908220290 10 Left 908220285 1:61999263-61999285 CCAACTTCCTTCCTGTCCTATGG No data
Right 908220290 1:61999296-61999318 GACTGTAGTGAAATGCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908220285 Original CRISPR CCATAGGACAGGAAGGAAGT TGG (reversed) Intronic
No off target data available for this crispr