ID: 908222991

View in Genome Browser
Species Human (GRCh38)
Location 1:62027087-62027109
Sequence ATGTATACAGAGATTCAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1203
Summary {0: 1, 1: 0, 2: 38, 3: 276, 4: 888}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908222991_908222995 18 Left 908222991 1:62027087-62027109 CCAAACTGAATCTCTGTATACAT 0: 1
1: 0
2: 38
3: 276
4: 888
Right 908222995 1:62027128-62027150 TCTTCCCTCCTCTCAGCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908222991 Original CRISPR ATGTATACAGAGATTCAGTT TGG (reversed) Intronic
901162365 1:7188432-7188454 ATGGGTACAGAGTTTCAGTTTGG - Intronic
901248196 1:7750300-7750322 ATACATCCAGAGATACAGTTAGG + Intronic
902040967 1:13492078-13492100 ATGCGGACAGAGTTTCAGTTTGG - Intronic
903199048 1:21718170-21718192 ATGTACACACAGATGCAGTGAGG - Intronic
903505408 1:23831247-23831269 ATGGGTACAGAATTTCAGTTTGG + Intronic
903820587 1:26099549-26099571 ATGGATACAGAGTTGCAGTTTGG + Intergenic
904173636 1:28609860-28609882 ATGGATATAGAGTTTCAGTTTGG - Intronic
904323764 1:29713753-29713775 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
904367836 1:30027618-30027640 ATGGATACAAAGTTTCAGTGTGG + Intergenic
904451312 1:30614408-30614430 AAGGGTACAGAGTTTCAGTTAGG - Intergenic
904631356 1:31844916-31844938 ATGGGTACACAGTTTCAGTTGGG - Intergenic
905160738 1:36031648-36031670 ATGGATAAAGAGTTTCAGTTTGG - Intronic
905383793 1:37584679-37584701 ATGGGTACAGGGTTTCAGTTTGG + Intronic
905671972 1:39797506-39797528 ATGGATACACAGTTTCAGTTTGG + Intergenic
905778532 1:40687213-40687235 ACGTATACAGAATTTCAGTATGG + Intergenic
905836624 1:41129320-41129342 ATAGGTACAGAGTTTCAGTTGGG - Intronic
905930302 1:41782335-41782357 ATGGGTACAGGGTTTCAGTTTGG + Intronic
906246787 1:44281791-44281813 ATGGATACAGACATGCAATTTGG + Intronic
906552876 1:46680600-46680622 ATGGGTACAGAGATTCTGTGAGG + Intronic
906576649 1:46897165-46897187 ATGTGTACAGAGTTCCAGTTTGG + Intergenic
906595269 1:47070420-47070442 ATGTGTACAGAGTTCCAGTTTGG - Intronic
906681053 1:47725606-47725628 ATCTATACAGAGATGGAGTCAGG - Intergenic
906724179 1:48031779-48031801 ATGGATACAGAGTTTCTGTTTGG + Intergenic
907538365 1:55186791-55186813 ATGGGTACAGAGTTTCAGCTGGG + Intronic
907653297 1:56317225-56317247 ATGGATACAAAGTTTCAGTTTGG + Intergenic
907724198 1:57003653-57003675 ATGGGTACAGAGTTTCTGTTTGG - Intronic
907736722 1:57120575-57120597 ATAGGTACAGAGTTTCAGTTTGG - Intronic
907797398 1:57731344-57731366 ATGAGTACAGAGTATCAGTTAGG + Intronic
908222991 1:62027087-62027109 ATGTATACAGAGATTCAGTTTGG - Intronic
908266382 1:62383442-62383464 ATGGGTACAGAATTTCAGTTTGG + Intergenic
908322972 1:62995866-62995888 ATGTATAAACAGATTCTGTTGGG + Intergenic
908345732 1:63230419-63230441 GTGGGTACAGAGTTTCAGTTTGG - Intergenic
908384333 1:63626833-63626855 ATGGACACAGACTTTCAGTTTGG - Intronic
908631301 1:66111381-66111403 ATGGGTAAAGAGTTTCAGTTTGG - Intronic
909242604 1:73234293-73234315 AAGGGTACAGAGTTTCAGTTAGG - Intergenic
909670249 1:78180535-78180557 ATGGGTACAGAGTTTCAATTTGG - Intergenic
909925477 1:81432892-81432914 GTGTATACAGAGTTTCAATGTGG + Intronic
910151370 1:84150768-84150790 ATTTATAAAGAGATTTATTTTGG - Intronic
910292189 1:85610146-85610168 ATGGGTACTGAGTTTCAGTTTGG - Intergenic
910316439 1:85889867-85889889 ATGGGTACAGAGTTTCAGTTTGG - Intronic
910329367 1:86052602-86052624 TTGGGTACAGAGTTTCAGTTTGG + Intronic
910335687 1:86127610-86127632 ATTTATACAAAGATACAGATGGG - Intronic
910563403 1:88617364-88617386 ATGGGTACAGAGCTTCAGTTAGG + Intergenic
911018855 1:93366049-93366071 ATGAATACATAATTTCAGTTTGG - Exonic
911130625 1:94383804-94383826 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
911345193 1:96688449-96688471 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
911473037 1:98342128-98342150 ATATATACAAAGACTTAGTTTGG + Intergenic
911815079 1:102339272-102339294 ATGGATACAGAGTCTCAGCTTGG - Intergenic
912178548 1:107190186-107190208 ATGGGCACAGAGTTTCAGTTTGG + Intronic
912215009 1:107599584-107599606 CTGGATACAGAAATTCATTTAGG + Intronic
912548651 1:110469488-110469510 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
912586723 1:110773574-110773596 ATGTGTACACAGTTTCAGTCTGG + Intergenic
912844334 1:113065990-113066012 ATGCATAGTGAGTTTCAGTTTGG - Intergenic
913313541 1:117529887-117529909 ATGGTTACAGAGTTTCTGTTTGG - Intergenic
914143765 1:144975104-144975126 ATGTATCCATAGATTAAGTCAGG - Intronic
914340987 1:146760311-146760333 CTGGGTACAGAGTTTCAGTTCGG + Intergenic
914723498 1:150308501-150308523 ATGGGTACAGAGTTTCAGTTTGG + Exonic
914749043 1:150520288-150520310 ATGGTTACAGAGCTTCTGTTTGG - Intergenic
914941417 1:152026430-152026452 ATGGATGCAGACTTTCAGTTTGG + Intergenic
914973916 1:152340014-152340036 ATGGATACAGAGTTTCAGCTTGG + Intergenic
915159474 1:153907522-153907544 ATATATACAAAGTTTCAGTTTGG + Intronic
915594936 1:156891506-156891528 ATGGGTACAGAGTTGCAGTTTGG + Intergenic
915707641 1:157861729-157861751 ATGGGCACAGAGTTTCAGTTTGG + Intronic
916500821 1:165385246-165385268 ATGATTACAGAGTTTCTGTTTGG - Intergenic
916841526 1:168606573-168606595 ATGGGTACAGAGTTTCTGTTAGG + Intergenic
916936944 1:169638693-169638715 AAGGATACAGAGTCTCAGTTAGG + Intergenic
917515473 1:175704075-175704097 ATGGATACAGCATTTCAGTTTGG + Intronic
917519797 1:175738537-175738559 CTGTGTACAGAGTTTCAATTTGG + Intronic
917644956 1:177020751-177020773 AGGTAAACAGAGACTCACTTGGG + Intronic
917665237 1:177219866-177219888 GTATATACAGAGACTCAGCTGGG + Intronic
917950625 1:180029582-180029604 ATGAATACAGAGCTTCAGTACGG - Intronic
917985796 1:180317374-180317396 ATGGGTACAGAGTTTCAGTTTGG + Intronic
918190305 1:182167524-182167546 ATGAATATGGAGTTTCAGTTTGG + Intergenic
918394914 1:184103725-184103747 ATGGATACAGAGTTTAATTTTGG - Intergenic
918401314 1:184165193-184165215 ATGCTTATAGAGTTTCAGTTTGG + Intergenic
918484256 1:185012679-185012701 ATGAACACACAGATTCTGTTTGG - Intergenic
918652385 1:186981687-186981709 ATGGTTACAGAGTTTTAGTTTGG - Intronic
919090530 1:192973692-192973714 ATGTATGGAGAGATTCCTTTTGG - Intergenic
919360782 1:196591366-196591388 ATTTATAAAGAGATTAATTTTGG - Intronic
919552436 1:199007854-199007876 ATTTATCCAGTGAATCAGTTAGG - Intergenic
919697273 1:200590658-200590680 ACAAATACAGAGTTTCAGTTTGG + Intronic
919734965 1:200942281-200942303 ATGTAGACAGAAATTCAGCAAGG - Intergenic
919831472 1:201543787-201543809 ATGAGTACAGAGTTTAAGTTTGG - Intergenic
919900248 1:202038948-202038970 ATGGGTACAGAGTTGCAGTTAGG + Intergenic
920121549 1:203662426-203662448 ATGGGTACAGAGTTTCAGTTTGG - Intronic
920175083 1:204095788-204095810 ATGGGAACAGAGTTTCAGTTTGG - Intronic
920410066 1:205752211-205752233 ATGGGCACAGAGTTTCAGTTTGG - Intergenic
920481121 1:206323341-206323363 ATGTATCCATAGATTAAGTCAGG + Intronic
920808257 1:209255493-209255515 ATGGGTACAGAGTTTCAGCTTGG - Intergenic
920991587 1:210944877-210944899 ATGGGTGCAGAGTTTCAGTTTGG - Intronic
921201834 1:212814113-212814135 ATATATACAGAGGTTCAGCCAGG - Intronic
921218540 1:212956986-212957008 ATGGATACAAGGTTTCAGTTAGG - Intronic
921989743 1:221351728-221351750 ACGTGTACAGAGTTTCTGTTGGG - Intergenic
922205922 1:223446208-223446230 ATGGGTATAGAGTTTCAGTTTGG + Intergenic
922209024 1:223472935-223472957 ATGGATACAGAGTTTCTGTTAGG - Intergenic
922295000 1:224242172-224242194 ATGGGGACAGAGTTTCAGTTTGG + Intronic
922779734 1:228241922-228241944 AAGTGTACAAAGTTTCAGTTTGG + Intronic
922985412 1:229862532-229862554 AGGAGTACAGAGTTTCAGTTTGG - Intergenic
922996766 1:229970463-229970485 ATGGATACAGGGTTTCAGTTTGG + Intergenic
923069223 1:230547594-230547616 ATGGAGACAGAGTTTCAGTTTGG - Intergenic
923205101 1:231751588-231751610 ATGGGTACAGAGTGTCAGTTGGG - Intronic
923720575 1:236463691-236463713 ATGGGTACAGAATTTCAGTTTGG - Intronic
923741992 1:236663389-236663411 ATGTGTGCAGAGTTTCAGTTTGG + Intergenic
924545493 1:245022864-245022886 ATGGGTACAGAGTTTCAGTTTGG - Intronic
924600577 1:245485235-245485257 ATGGGTACAGAGCTTCAGTTTGG + Intronic
924799899 1:247321391-247321413 ACGTATAGAGAATTTCAGTTTGG + Intronic
1062763104 10:42323-42345 GTGGATACAGAGTTTCACTTTGG + Intergenic
1062949018 10:1482542-1482564 ATGGGGACAGAGTTTCAGTTTGG + Intronic
1063051576 10:2454978-2455000 ATCTGGACAGAGATTCAGGTAGG - Intergenic
1063175781 10:3549786-3549808 AAGGATACAGAATTTCAGTTAGG - Intergenic
1063521568 10:6746193-6746215 ATGGGGACAGAGTTTCAGTTTGG - Intergenic
1063618729 10:7625379-7625401 ATGGGTACAAAGTTTCAGTTTGG + Intronic
1064015727 10:11770749-11770771 ATGGGTACAGAGTTTCATTTGGG - Intergenic
1064094089 10:12409822-12409844 ATGGGTACAGAGTTTCTGTTTGG - Intronic
1064947405 10:20806275-20806297 ATCTCTACACAGATTCATTTAGG + Intronic
1065415440 10:25480455-25480477 ATGAATACAGAGTTTTAGCTTGG - Intronic
1065459424 10:25941729-25941751 TTGAATCCAGAGTTTCAGTTTGG - Intronic
1065661136 10:28005207-28005229 ATAAGTACAGAGTTTCAGTTTGG + Intergenic
1065696027 10:28380455-28380477 ATGTGTACAGAGTTTCTGTTTGG - Intergenic
1065786548 10:29221008-29221030 ATGGATACAGAATTTCTGTTTGG - Intergenic
1066050383 10:31629661-31629683 ATGAATACAGAGCTTCTGTTTGG - Intergenic
1066110561 10:32192585-32192607 ATGGGTACAGAGTTTTAGTTTGG - Intergenic
1066252999 10:33652336-33652358 ATGAGTACAGAGTTTCAGCTTGG - Intergenic
1066544803 10:36488341-36488363 ATGTGTACAGAGCTTCAGTTTGG - Intergenic
1066611714 10:37255599-37255621 ATGACTACAGAGTTTCAGTTTGG - Intronic
1067407408 10:46035675-46035697 ATGGATATAGAGTTTCAGATTGG + Intronic
1067546770 10:47197456-47197478 ATGGGAACAGAGTTTCAGTTTGG - Intergenic
1067856867 10:49801929-49801951 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
1069402078 10:68059059-68059081 ATGTATAGAGAGCTACATTTTGG - Intronic
1069676487 10:70252400-70252422 ATAGATACAGAGTTGCAGTTTGG + Exonic
1069712376 10:70498043-70498065 ATGGGTGCAGAGTTTCAGTTTGG - Intronic
1070000936 10:72376732-72376754 ATGTATACAGAATTTCTGTCTGG + Intronic
1070051006 10:72889791-72889813 ATGCATACAGAGTGTCAGTTTGG + Intergenic
1070062627 10:72999614-72999636 ATGAGTACAGAGTTTCAGTTGGG - Intergenic
1070073512 10:73112745-73112767 AAGTGTACAAAGTTTCAGTTAGG - Intronic
1070368732 10:75761559-75761581 ATGGATACAGAGTTTCTGTTTGG + Intronic
1070441917 10:76454973-76454995 ATGAGTACAGAGTTTTAGTTTGG + Intronic
1070452147 10:76570906-76570928 ATGTATACATAGAGTCAATAAGG - Intergenic
1071499367 10:86192560-86192582 ATGAGTACAGAGTTTCGGTTTGG + Intronic
1071529761 10:86380171-86380193 ATGGGGACAGAGTTTCAGTTTGG + Intergenic
1071689987 10:87807213-87807235 ATTTATACAAATATTCAGATTGG + Intronic
1071913429 10:90262542-90262564 ATGGGTATAGAGTTTCAGTTTGG + Intergenic
1072079941 10:92019207-92019229 ATGAATATAGAGTTTCTGTTTGG - Intronic
1072136501 10:92551730-92551752 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1072154280 10:92709802-92709824 ATGGATACAGAGTTTTATTTTGG - Intergenic
1072201905 10:93167750-93167772 ATTGGTACAGAGTTTCAGTTGGG + Intergenic
1072497632 10:95977945-95977967 ATGTGTACAGAGTTTCAGTTTGG + Intronic
1072724586 10:97804363-97804385 ATGGGTACAGAGTTTCCGTTTGG - Intergenic
1073144225 10:101269371-101269393 ATAGGTACAGAGTTTCAGTTTGG + Intergenic
1073222303 10:101885647-101885669 ATGGATATAGAGTTTCAGTATGG + Intronic
1073230470 10:101965041-101965063 ATGAGTACTGAGTTTCAGTTTGG + Intronic
1073489352 10:103842504-103842526 ATGAATACAAAAATACAGTTGGG - Intronic
1073564984 10:104527306-104527328 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1073616143 10:104998096-104998118 ATGGAAAAAGAGGTTCAGTTGGG + Intronic
1074500118 10:114016120-114016142 ATGGGTACAGAGCTCCAGTTTGG + Intergenic
1074712436 10:116188488-116188510 ATGGGTATAGAGTTTCAGTTTGG + Intronic
1074955771 10:118387740-118387762 ATGGATACAGAATTTCTGTTTGG - Intergenic
1075071534 10:119323172-119323194 ATGGGTTCAGAGTTTCAGTTTGG + Intronic
1075346312 10:121684349-121684371 ATGGATACAGACTTTCCGTTTGG - Intergenic
1075525381 10:123180653-123180675 ATGAGTACAGAATTTCAGTTTGG + Intergenic
1075535352 10:123266947-123266969 ATGGGTACAGAGTTTCAGTTGGG - Intergenic
1075803377 10:125167214-125167236 ATTGGTACAGAGTTTCAGTTTGG + Intergenic
1076064025 10:127434537-127434559 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1077668875 11:4139123-4139145 ATTGATACAGAGTTTCTGTTTGG - Intergenic
1077726320 11:4678631-4678653 ATGGGTGCAGAGGTTCAGTTTGG - Intergenic
1079208630 11:18440502-18440524 ATGAGTACAGAGCTACAGTTTGG + Intronic
1079220191 11:18553866-18553888 ATGTGTACAGAGCTTCCTTTTGG + Intronic
1079250594 11:18784518-18784540 ATGAGTACAGCGATTCAGTCTGG + Intronic
1079904386 11:26226903-26226925 ATGAGTACTGAGTTTCAGTTTGG - Intergenic
1080375288 11:31702409-31702431 ATGGATACAGAGTTTCAATTTGG + Intronic
1080688000 11:34531573-34531595 ATAGGTACAGAGTTTCAGTTTGG + Intergenic
1080731515 11:34959920-34959942 ATAGATACAGAGTTTCAATTTGG + Intronic
1080788419 11:35497448-35497470 ATGGTTACAGAGTTTCTGTTTGG + Intronic
1080960082 11:37147817-37147839 ATGGCTACAGAGTTTCAGTTTGG - Intergenic
1081187096 11:40057061-40057083 AGGGATACAAAGTTTCAGTTAGG + Intergenic
1081225986 11:40522667-40522689 ATGAGTTCAGAGTTTCAGTTAGG - Intronic
1082130232 11:48479776-48479798 ATGAATGCATAGATTAAGTTGGG + Intergenic
1082131371 11:48493479-48493501 ATATATACAGAAATACAGTTAGG + Intergenic
1082245434 11:49916652-49916674 ATATATACAGAAATACAGTTAGG - Intergenic
1082563753 11:54650689-54650711 ATGAATGCATAGATTAAGTTGGG + Intergenic
1082564864 11:54664356-54664378 ATATATACAGAAATACAGTTAGG + Intergenic
1082892003 11:58149583-58149605 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1083327971 11:61883170-61883192 ATGGGGACAGAGTTTCAGTTGGG - Intronic
1083863335 11:65438493-65438515 ATGAATACAGAGCGTCTGTTTGG - Intergenic
1084281539 11:68098527-68098549 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1084616250 11:70237998-70238020 ATGCAGACAGAGTTTCCGTTTGG - Intergenic
1084677447 11:70644287-70644309 ATGGGGACAGAGTTTCAGTTTGG - Intronic
1084724639 11:70933391-70933413 ATGGGGACAGAGTTTCAGTTTGG + Intronic
1084753598 11:71220795-71220817 ATGCGGACAGAGTTTCAGTTTGG + Intronic
1084763010 11:71285942-71285964 ATGGGAACAGAGTTTCAGTTTGG - Intergenic
1084976855 11:72805470-72805492 ATGTTTACAGAATTTCTGTTTGG - Intergenic
1084997414 11:72994952-72994974 ATGGATACAGAGTTTCTTTTTGG - Intronic
1085059517 11:73431897-73431919 ATGGTTACAGAGTTTCTGTTTGG - Intronic
1085192840 11:74643675-74643697 ATGTATTCAGAAATGAAGTTGGG + Intronic
1085240939 11:75054776-75054798 ATAGGTACAGAGTTTCAGTTTGG - Intergenic
1085242343 11:75068520-75068542 ATAAATACAGAGTTTCTGTTTGG - Intergenic
1085564971 11:77505525-77505547 ATGGATATGGAGTTTCAGTTTGG - Intergenic
1085738469 11:79059709-79059731 ATGGGTACAGATTTTCAGTTTGG - Intronic
1085802664 11:79604788-79604810 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1086130059 11:83392255-83392277 ATGGATAGAGAGTTTCAGTTTGG - Intergenic
1086337817 11:85816508-85816530 ATGGATACAGAGTCTCAGTGTGG + Intergenic
1086430751 11:86733993-86734015 ATCTATACAGATATGCATTTTGG - Intergenic
1086535333 11:87837582-87837604 ATGTTTACTGAGAATCAGTTTGG + Intergenic
1086849217 11:91789408-91789430 ATGTATACATATATCCAGTCTGG + Intergenic
1086933265 11:92716771-92716793 ATCTAAAGAGAGATTCATTTGGG + Intronic
1086975284 11:93125197-93125219 ATGGGTACAGATTTTCAGTTTGG - Intergenic
1087231357 11:95669387-95669409 ATGTATATAGGGCTTCATTTTGG - Intergenic
1087796902 11:102463772-102463794 ATGGGTACAGAGCTTCTGTTTGG + Intronic
1087803952 11:102535285-102535307 ATGGATACAGAGTTTCTCTTTGG - Intergenic
1088215880 11:107508626-107508648 ATTGATACAGAGTTTCAGTTTGG - Intronic
1088377262 11:109155517-109155539 CTGGGTACAGAGTTTCAGTTTGG + Intergenic
1088434285 11:109793892-109793914 ATGGGTACAGAGTTTCGGTTTGG + Intergenic
1088522987 11:110719270-110719292 ATGATTACAGAGATTCTGTTTGG + Intergenic
1088779775 11:113123103-113123125 ATGGATACAAACATACAGTTAGG + Intronic
1088791995 11:113234407-113234429 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1088898651 11:114097330-114097352 GTGGGTACAGAGTTTCAGTTGGG + Intronic
1089008849 11:115115871-115115893 ATGGGTACAAAGTTTCAGTTTGG + Intergenic
1089136137 11:116250800-116250822 ATATATACAGACAGACAGTTGGG + Intergenic
1089277569 11:117348755-117348777 ATGGCTATAGAGTTTCAGTTTGG - Intronic
1089776526 11:120840850-120840872 ATGGGTACAGAGTTTCTGTTTGG - Intronic
1090285925 11:125499137-125499159 ATGGATACAGAGTTTCTGTTTGG - Exonic
1090365843 11:126204800-126204822 ATGGGTCCAGAGTTTCAGTTTGG - Intronic
1090743560 11:129689319-129689341 ATGAGTACAGAGTTTCTGTTTGG + Intergenic
1091107026 11:132932179-132932201 ATGGATTCTGAGTTTCAGTTTGG + Intronic
1091164550 11:133463274-133463296 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1091412067 12:248724-248746 AAGTATACAGAAAATCAGTATGG + Intronic
1091442531 12:522538-522560 ATGGGTACGGAGTTTCAGTTCGG + Intronic
1091546812 12:1506645-1506667 AAGTATACAGAGTTTCAATCTGG + Intergenic
1091568980 12:1668033-1668055 ATGGGGACAGAGTTTCAGTTGGG + Intergenic
1091608646 12:1982337-1982359 ATGGGTACAGAGTTTTAGTTTGG - Intronic
1091664348 12:2408267-2408289 TTAAATACAGAGTTTCAGTTTGG + Intronic
1091919356 12:4291979-4292001 ATGCGTACGGAGTTTCAGTTTGG + Intronic
1091983819 12:4890771-4890793 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1092149837 12:6240211-6240233 ATGAGTACAGAGTTTCTGTTTGG + Intergenic
1092232751 12:6785809-6785831 ATGGGTACAGAGTTTCATTTGGG + Intergenic
1092768677 12:11877098-11877120 ATATATACAAAGATTCAATTAGG + Intronic
1092814237 12:12299233-12299255 ATGGATATGGAGTTTCAGTTTGG - Intergenic
1093156274 12:15689742-15689764 ATGGGTACACAGTTTCAGTTAGG - Intronic
1093560325 12:20531225-20531247 ATGTTTACCTAGATGCAGTTAGG - Intronic
1093952336 12:25177299-25177321 TGGTATACAGGGTTTCAGTTTGG - Intronic
1094335062 12:29340983-29341005 ACGTATATAGAATTTCAGTTTGG + Exonic
1094462790 12:30715538-30715560 ATGATTACAAAGTTTCAGTTGGG + Intronic
1094666177 12:32523412-32523434 ATGAGTACAGAGTTTCAGTTGGG - Intronic
1094776590 12:33736506-33736528 ATGAGTATAGAGTTTCAGTTTGG - Intergenic
1094812998 12:34160000-34160022 GTGGATACAGAGTTTCACTTTGG + Intergenic
1095246091 12:39923525-39923547 ATGTGTACAGAGTTTCTGTTTGG + Intronic
1095265567 12:40153267-40153289 ATGGGTATAGAGTTTCAGTTTGG - Intergenic
1095320620 12:40821243-40821265 ATGTATCCAGAGAGACAGATTGG + Intronic
1095423991 12:42055697-42055719 ATGGGTATAGAGTTTCAGTTTGG - Intergenic
1095722783 12:45418740-45418762 ATGTGTACAGACATTCACTCTGG + Intronic
1096014669 12:48258775-48258797 ATGGGTACAGAGTTTCAGTTGGG + Intergenic
1096898464 12:54849573-54849595 ATATATAGAGAGATAAAGTTTGG + Intronic
1097158757 12:57030780-57030802 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1097774090 12:63625783-63625805 ATGTATACAAAGTTTCAGTTAGG + Intronic
1097781525 12:63711738-63711760 ATGGATACAGAGTTTCTGTTTGG + Intergenic
1098238047 12:68437609-68437631 ATGAGCACAGAGTTTCAGTTGGG + Intergenic
1098373460 12:69785372-69785394 ATGTATAGAGAGATACAGAGAGG + Intronic
1099340868 12:81432225-81432247 ATGTGTACAGAATTTCAGTTTGG - Intronic
1099659885 12:85544192-85544214 ATATATACAGATATACAGATGGG + Intergenic
1100454992 12:94742989-94743011 ATGGGTACAGAATTTCAGTTTGG - Intergenic
1100625708 12:96329165-96329187 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1100955031 12:99898312-99898334 ATCTAAACAGAAATTCAGCTTGG + Intronic
1101210743 12:102533204-102533226 ATGGATATGGAGTTTCAGTTTGG + Intergenic
1101293007 12:103390417-103390439 ATGGATGCAGAGTTTCTGTTTGG - Intronic
1101670271 12:106864803-106864825 ATGTGTACAGAGTTTCATTGGGG - Intronic
1102138895 12:110598231-110598253 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1102787783 12:115618519-115618541 ATGGATACAGAGTTTCAATTTGG + Intergenic
1102887297 12:116531857-116531879 ATGGGTACCGAGATTCTGTTTGG + Intergenic
1103030901 12:117611991-117612013 ATGAGTACAGAGTTTCAGTTGGG + Intronic
1103040963 12:117695251-117695273 ATGGGTACAGAGCTTTAGTTTGG + Intronic
1103292283 12:119856290-119856312 ATGGATAGAGAGTTTCTGTTTGG + Intronic
1103424620 12:120822120-120822142 ATGCATACAGAGTTTCTGTTTGG + Intronic
1103962804 12:124619870-124619892 ATGGAGACAGAGTTTCAGTTTGG + Intergenic
1104412861 12:128573727-128573749 ATGGGGACAGAGTTTCAGTTTGG + Intronic
1104509036 12:129359287-129359309 ATGGTTACAGAGTTTCTGTTTGG + Intronic
1104648697 12:130515334-130515356 ATGAAGACAGAGTTTCAGTTGGG - Intronic
1105226501 13:18439473-18439495 ATGAGTACAGAGTTTCAGTTTGG - Intergenic
1105776576 13:23667687-23667709 ATGGAGACAGAGTTTCAGTTTGG - Intronic
1105778933 13:23689691-23689713 ATGGATACTGAGTTTCTGTTGGG + Intergenic
1105848643 13:24315171-24315193 ATGGGTACAGAGTTTCTGTTTGG - Intronic
1105909487 13:24848737-24848759 ATGAATATAGAATTTCAGTTAGG - Intronic
1106010451 13:25816037-25816059 ATTAATACAGAATTTCAGTTTGG + Intronic
1106014593 13:25856709-25856731 ATGAGCACAGAGTTTCAGTTTGG - Intronic
1106065890 13:26348662-26348684 ATGGATTCAGAGTTTCTGTTTGG + Intronic
1106200234 13:27530229-27530251 ATGGGCACAGAGTTTCAGTTTGG - Intergenic
1106322167 13:28651251-28651273 ATGTATACTAAGATACATTTTGG - Intergenic
1106331343 13:28742443-28742465 ATGGGTACAGAGTTTCAGTGTGG - Intergenic
1106392532 13:29348606-29348628 ATGTAGACAGAAAATCAGTAAGG - Intronic
1106438994 13:29748823-29748845 TTGAGTACAGAGCTTCAGTTTGG - Intergenic
1106464725 13:30002939-30002961 ATGGGTACAGAGTTTCTGTTTGG + Intergenic
1106474139 13:30082813-30082835 ATGGGTGCAGAGTTTCAGTTTGG + Intergenic
1106520653 13:30494757-30494779 ATGGATACAGAGTTTTAATTGGG - Intronic
1106700763 13:32225952-32225974 CTGTATAGAGATATTCAGGTTGG - Exonic
1107241864 13:38245015-38245037 ATGGTTACAGAGTTTCTGTTTGG + Intergenic
1107660178 13:42631110-42631132 ATGAATAGAGAGATGAAGTTTGG + Intergenic
1107664237 13:42672686-42672708 ATGGGTACAGAGTTTCTGTTGGG + Intergenic
1108032887 13:46255299-46255321 ATGGATATAGAGTTTCTGTTTGG + Intronic
1108349198 13:49575092-49575114 ATGGGTACAGAGTTTCACTTTGG + Intronic
1108431974 13:50362420-50362442 ATGGGTACAGAGTTTCTGTTTGG - Intronic
1108506830 13:51119777-51119799 ATCTGGACAGAGTTTCAGTTTGG + Intergenic
1108896628 13:55336446-55336468 AAGGTTACAGAGGTTCAGTTAGG - Intergenic
1108900433 13:55398390-55398412 ATGTTTTCAAAGATTCAGTTAGG - Intergenic
1109290566 13:60470003-60470025 ATGGGTACAGAGTTTAAGTTTGG - Intronic
1109440402 13:62363894-62363916 ATGTGTACAGTGACTCAGTTTGG + Intergenic
1110040349 13:70747460-70747482 AGGAATTCAAAGATTCAGTTAGG - Intergenic
1110341287 13:74393565-74393587 ATGTCTACAGAGTTTCTTTTAGG - Intergenic
1110576210 13:77058170-77058192 ATGTATCCAGACATTAAGATGGG - Intronic
1110727171 13:78838985-78839007 AAGAATACAAAGATTCAGTTAGG - Intergenic
1110781336 13:79469051-79469073 ATGGGTACACAGTTTCAGTTTGG + Intergenic
1111100657 13:83580868-83580890 TTGGATACAGAGTTTCAGTAGGG - Intergenic
1111194147 13:84850678-84850700 ATGGGTACAGAGTTTCAATTTGG - Intergenic
1111425492 13:88075175-88075197 ATGTAAACAAATCTTCAGTTTGG + Intergenic
1111859830 13:93688792-93688814 ATAGATACACAGTTTCAGTTTGG + Intronic
1112022422 13:95383283-95383305 ATGGGTACAGAGTTTCAGTTGGG + Intergenic
1112025655 13:95408644-95408666 ATAGGTACAGAGTTTCAGTTTGG + Intergenic
1112059255 13:95721019-95721041 ATGGATGCAGAGTTTCAGTTTGG - Intronic
1112162824 13:96887263-96887285 ATGTATGCAGAAAATCAGTAAGG - Intergenic
1112182195 13:97094785-97094807 ATGTTCACAGAGGTTAAGTTCGG - Intergenic
1112312556 13:98332190-98332212 ATGGGGACAGAGTTTCAGTTTGG - Intronic
1112370464 13:98788732-98788754 ATGGGTGCAGAGTTTCAGTTGGG - Intergenic
1112500475 13:99939336-99939358 ATGGACTCAGAGTTTCAGTTTGG - Intergenic
1112501873 13:99949304-99949326 ATGGGTACAAAGATTCTGTTTGG + Intergenic
1112502192 13:99951686-99951708 TCATATACAAAGATTCAGTTTGG + Intergenic
1112526137 13:100149423-100149445 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1112781773 13:102908513-102908535 ATGTATATGTAGATTCATTTAGG + Intergenic
1112932428 13:104758560-104758582 ATGGCAACAGAGTTTCAGTTAGG + Intergenic
1113021707 13:105894788-105894810 ATGTATTCAGAGATTCAATTAGG - Intergenic
1114010954 14:18367976-18367998 ATGAGTACAGAGTTTCAGTTTGG - Intergenic
1114437547 14:22719956-22719978 ATGGGTATAGAGTTTCAGTTTGG + Intergenic
1114873853 14:26691005-26691027 ATGGATAGAGAGATTGAGGTGGG - Intergenic
1115307655 14:31948968-31948990 ATGGGTACAGGGTTTCAGTTTGG - Intronic
1115632316 14:35257320-35257342 ACGGATACAGAGTTTCAGTTTGG - Intronic
1115708786 14:36027110-36027132 ATGGATACAGTGTTTTAGTTTGG + Intergenic
1115779451 14:36753095-36753117 ATGGGTTCAGAGTTTCAGTTTGG + Intronic
1115898354 14:38116794-38116816 ATGGATAGAAAGTTTCAGTTTGG + Intergenic
1116051021 14:39803270-39803292 ATGGATACAGAGTTTCAGTTTGG - Intergenic
1117098769 14:52324055-52324077 ATGGGTACAGAGTTTCAATTTGG + Intronic
1117123015 14:52589256-52589278 ATGGGTATAGAGTTTCAGTTTGG + Intronic
1117127963 14:52651896-52651918 ATGGGTACAAAGTTTCAGTTAGG - Intronic
1117279402 14:54223010-54223032 ATGGGTACAGAGTTTCAATTTGG + Intergenic
1117850893 14:59968300-59968322 ATGGGTACAGAGTTTCAGTCTGG + Intronic
1118036105 14:61868830-61868852 AAGTAGACAGAAATTCAGTAAGG - Intergenic
1118561232 14:67085826-67085848 ATGGGTATAGAGTTTCAGTTTGG - Intronic
1118601636 14:67474678-67474700 ATGGATACAAAGTTTCTGTTTGG - Intronic
1118661686 14:68020628-68020650 ATATATATAGAGTTTCAGTTTGG + Intronic
1118733626 14:68686726-68686748 ATGGGCACAGAGTTTCAGTTTGG - Intronic
1118850361 14:69578364-69578386 ATGTCTACAGACACTCAGTTTGG - Intergenic
1118885434 14:69861827-69861849 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1119004819 14:70914542-70914564 TTGAATACACAGATTCAGTCAGG + Intronic
1119037040 14:71239213-71239235 ACGGATACTGAGTTTCAGTTGGG + Intergenic
1119588521 14:75861972-75861994 GTGAGTACAGAGCTTCAGTTTGG - Intronic
1119983299 14:79106784-79106806 ATGCATAAAGAGATTCTATTTGG - Intronic
1120368249 14:83598074-83598096 AAGGATACAAACATTCAGTTAGG + Intergenic
1121213291 14:92225974-92225996 ATGAGTACAGAGTTTTAGTTTGG - Intergenic
1121235311 14:92387674-92387696 ATGGGTACAGAGGTTCAGCTTGG - Intronic
1121395253 14:93616254-93616276 ATGTATAAAGAAATTCAGCATGG - Intronic
1121397668 14:93641276-93641298 ATGTTTACAGAATTTAAGTTTGG + Intronic
1121800727 14:96772004-96772026 ACGGGTACAGAGCTTCAGTTTGG + Intergenic
1122379459 14:101291436-101291458 ATGGGTACAGAGCTTCTGTTTGG - Intergenic
1124047822 15:26166602-26166624 ATGTGTACAGAGTTTCAGTTTGG - Intergenic
1124057872 15:26259336-26259358 ATGGATACAAAGTTACAGTTAGG - Intergenic
1124411515 15:29441342-29441364 CTGGATACAGAGTTTCAGTTGGG + Intronic
1124415420 15:29469602-29469624 ATGACTACAGAGTTTCAGCTTGG + Intronic
1124463755 15:29917950-29917972 ATAAGTACAGAGTTTCAGTTTGG - Intronic
1124873674 15:33569365-33569387 ATAAATACAGAGTTTCAGTTTGG - Intronic
1125035856 15:35122625-35122647 GTGGGTACAGAGTTTCAGTTTGG + Intergenic
1125118439 15:36123071-36123093 ATGTAGACACAGAATCAGTTTGG - Intergenic
1125319313 15:38466644-38466666 ATGGGTACAGAGTTTCAGTGAGG + Intronic
1125396525 15:39254570-39254592 ACGGATACAAAGTTTCAGTTAGG + Exonic
1125553223 15:40563538-40563560 ATGGGTACACAGTTTCAGTTTGG + Intronic
1125647978 15:41288985-41289007 ATGTGTACAAGGTTTCAGTTTGG + Intergenic
1125871808 15:43108997-43109019 ATGGATACGGAGTTTCATTTTGG + Intronic
1125988471 15:44079974-44079996 ATGGATACAGAGTTTCAGTTTGG + Intronic
1126461026 15:48914879-48914901 ATGCTTATAGAGTTTCAGTTGGG - Intronic
1126581197 15:50243870-50243892 ATGGATACAGAGTTTCTGCTCGG + Intronic
1127220584 15:56876305-56876327 ATTGGTACAGAGTTTCAGTTTGG + Intronic
1127312393 15:57764094-57764116 ATGGGTACATAGTTTCAGTTTGG - Intronic
1127695829 15:61446279-61446301 ATGGATACAAAGTTTCAGTTTGG + Intergenic
1128021428 15:64394238-64394260 ATGTATACATATTTTTAGTTCGG + Intronic
1128055341 15:64695160-64695182 TTGTATACAGAGAATTAATTAGG + Intronic
1128220627 15:65965946-65965968 ATGGGTGCAGAGTTTCAGTTTGG - Intronic
1128355606 15:66924329-66924351 ATGGGTACTGAGTTTCAGTTTGG - Intergenic
1128473339 15:67975114-67975136 ATGGGTACAGAGTTTCAGTTGGG - Intergenic
1128702891 15:69816937-69816959 ATGGATATAGAAATCCAGTTTGG + Intergenic
1128914207 15:71545033-71545055 GTGAATACAGAGTTTCTGTTTGG + Intronic
1130084028 15:80762262-80762284 GTGGGTACAGAGTTTCAGTTTGG - Intergenic
1131081438 15:89539634-89539656 ATGGGTACTGAGTTTCAGTTTGG + Intergenic
1131761836 15:95632071-95632093 ATGAGTGCAGAGCTTCAGTTGGG - Intergenic
1131789946 15:95953395-95953417 ATGTGTTAAGTGATTCAGTTGGG - Intergenic
1131906699 15:97150352-97150374 ATGGGGACAGAGTTTCAGTTTGG + Intergenic
1132041805 15:98531228-98531250 ATGTTTGCAGAGTTTCTGTTTGG + Intergenic
1132057980 15:98666770-98666792 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1132093898 15:98967882-98967904 ATAGGTACAGAGTTTCAGTTTGG + Intergenic
1132303528 15:100791132-100791154 ATGAGTACAGAATTTCAGTTTGG + Intergenic
1132401951 15:101515549-101515571 ATGAATACAGAATTTCTGTTTGG - Intronic
1133946389 16:10352479-10352501 AAGGGTACAGAGTTTCAGTTTGG - Intronic
1134081815 16:11329985-11330007 ATGGATACAGAGTTTCCTTTGGG - Intronic
1135357165 16:21778994-21779016 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1135455669 16:22595110-22595132 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1135502007 16:23004180-23004202 ATGGGTATAGAGTTTCAGTTTGG + Intergenic
1136094108 16:27941974-27941996 ATGACTACAGAGTTTCAGTTTGG + Intronic
1136858859 16:33683074-33683096 ATGGGTACAAAGTTTCAGTTTGG + Intergenic
1137066167 16:35846341-35846363 ATATATACAGAGTTTCTGTTAGG + Intergenic
1137295376 16:47087470-47087492 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1137297186 16:47106327-47106349 ATGGGTATAGAGTTTCAGTTTGG + Intronic
1137689422 16:50411272-50411294 ATGGATACAGAGTTTCCGTTTGG - Intergenic
1137697520 16:50471670-50471692 ATGAGTATAGAGCTTCAGTTGGG - Intergenic
1137750164 16:50855494-50855516 ATGGAAATAGAGTTTCAGTTGGG - Intergenic
1137795987 16:51220522-51220544 ATGGGTACAGAGTTTTAGTTTGG - Intergenic
1137912736 16:52394740-52394762 ATGGGTACAGAGTTTCCGTTTGG + Intergenic
1138028032 16:53538388-53538410 ATGGGTCCAGAGTTTCAGTTTGG + Intergenic
1138875900 16:60949102-60949124 AAGTATACACAAGTTCAGTTTGG + Intergenic
1139289327 16:65843279-65843301 ATGGGTGCAGAGTTTCAGTTTGG + Intergenic
1139567796 16:67790323-67790345 ATGGGTACAGAGTTTCTGTTTGG + Intronic
1139695748 16:68673393-68673415 ATGAGTACAGAGTTTCTGTTGGG - Intronic
1139791260 16:69438030-69438052 ATAAGTACAGAGTTTCAGTTTGG - Intronic
1139840926 16:69879339-69879361 ATGGATACAGAGAATCCGTTTGG - Intronic
1139898338 16:70306836-70306858 ATGTGTACAGAGTTTCCTTTTGG - Intronic
1139935298 16:70566175-70566197 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1139993298 16:70957095-70957117 ATGGGTACAGAGTTTCAGTTCGG - Intronic
1140689284 16:77466054-77466076 ATGGTTACAGAGTTTCCGTTTGG + Intergenic
1203120433 16_KI270728v1_random:1531568-1531590 ATGGGTACAAAGTTTCAGTTTGG + Intergenic
1142543136 17:677487-677509 ATGTTTACAGAGTTTCTATTTGG + Intronic
1142870481 17:2816763-2816785 ATGTATACGAAGTTTCAGTTTGG - Intronic
1142938276 17:3357583-3357605 ATGGGTACAGAGTTTCAATTGGG + Intergenic
1143087277 17:4425572-4425594 ATGGGCACAGAGTTTCAGTTGGG - Intergenic
1143157134 17:4844976-4844998 ATGGGTACAGAGCTTCATTTGGG - Intronic
1143673869 17:8416148-8416170 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1143702726 17:8673413-8673435 ATGGATACAGAGTTTCAGTTTGG + Intergenic
1143760995 17:9104231-9104253 ATGGGTACAGAGTTTCAATTTGG + Intronic
1143991166 17:10963480-10963502 ATGTGTACAGAATTTTAGTTGGG + Intergenic
1144798531 17:17909628-17909650 ATGAACACAGAATTTCAGTTTGG + Intronic
1144821839 17:18080553-18080575 ATGGGTGCAGAGTTTCAGTTTGG - Intergenic
1145065854 17:19760776-19760798 ATGGACACAGAGTTTCAGTTTGG - Intergenic
1145120214 17:20252484-20252506 GTGGATACAGAGTTTCAGTCAGG - Intronic
1145376703 17:22356355-22356377 AAGAATGCAGAGTTTCAGTTTGG - Intergenic
1146045342 17:29500996-29501018 ATGGATGCAGAGTTTCTGTTTGG + Intronic
1146345158 17:32055465-32055487 ATAGATACAGAGTTTCAATTTGG - Intergenic
1146417451 17:32649315-32649337 ATGGGTATAGAGCTTCAGTTTGG - Intronic
1146497870 17:33338947-33338969 ATGGATACAGAGTTTCAGTTTGG + Intronic
1146783378 17:35696375-35696397 ATGGATACAAACATACAGTTAGG + Intronic
1146933575 17:36795404-36795426 ATGGATACAAAGTTGCAGTTTGG - Intergenic
1146961350 17:36982813-36982835 AATGATACAGAGTTTCAGTTTGG - Intronic
1146971870 17:37079916-37079938 ATGAGTACAGAGTTTCAGTATGG - Intergenic
1147027575 17:37601571-37601593 ATGGGTACAGAGTTTCTGTTTGG - Intronic
1147860450 17:43518716-43518738 ATGGGTACAGAGTTTCTGTTTGG - Intronic
1148281358 17:46350193-46350215 ATGGATACAAAGTTTCTGTTGGG + Intronic
1148303586 17:46568128-46568150 ATGGATACAAAGTTTCTGTTGGG + Intronic
1148485238 17:47986647-47986669 ATGTCCACAGAGATGCATTTGGG - Intergenic
1148636922 17:49156130-49156152 ATGGGTACAGAGTTTCAGTTGGG - Intronic
1148833210 17:50449878-50449900 ATGGGTACAGAATTTCAGTTGGG - Intronic
1149190999 17:54062117-54062139 TTGTATGCAGAGCTTCTGTTAGG - Intergenic
1149709874 17:58730902-58730924 ATGGGTACAGAGTTTCAGTATGG - Intronic
1149787254 17:59446409-59446431 ATGTAATCATTGATTCAGTTTGG + Intergenic
1150045596 17:61910264-61910286 ATGGATACAGAGTTTCTGTTTGG + Intronic
1150188048 17:63206748-63206770 ATGGATACAGAATTTCAGTTGGG + Intronic
1150353217 17:64461731-64461753 ATGGGGACAGAGTTTCAGTTTGG - Intronic
1150665838 17:67136810-67136832 ATGCATACAGAGTTTCAGTTTGG + Intronic
1150681519 17:67288394-67288416 ATGGGTACAGAGTTTCTGTTGGG + Intergenic
1151217308 17:72586036-72586058 ATGGGTACAGAGTTTTAGTTTGG + Intergenic
1151649951 17:75460935-75460957 ATGGTGACAGAGTTTCAGTTTGG - Intronic
1151796610 17:76350626-76350648 ATGGGTACAGAGTTTCTGTTTGG + Intronic
1151847403 17:76666939-76666961 ATGGCTACAGAGTTTCAGTTGGG - Intergenic
1151953428 17:77368177-77368199 ATGAGGACAGAGTTTCAGTTTGG + Intronic
1152129907 17:78469940-78469962 ATGGAGACAGAGCTTCTGTTTGG + Intronic
1152364292 17:79846085-79846107 ATGAAGACAGAGTTTCAGTTTGG - Intergenic
1152388734 17:79990712-79990734 ATGGAGACAAAGCTTCAGTTTGG - Intronic
1152490256 17:80626915-80626937 ATGGAGACAGAGTTTCTGTTTGG - Intronic
1152613431 17:81327113-81327135 ATGAGTACAGAGTTTCTGTTTGG - Intronic
1152956013 18:42654-42676 GTGGATACAGAGTTTCACTTTGG + Intergenic
1153319785 18:3761203-3761225 ATGGGTACAGGGTTTCAGTTTGG - Intronic
1153358598 18:4166902-4166924 TTGGATACAGAGTTTCAGTTTGG + Intronic
1153709380 18:7782555-7782577 ATAGGTACAGAGTTTCAGTTGGG - Intronic
1153903159 18:9636898-9636920 ACGGGTACAGAGCTTCAGTTGGG + Intergenic
1153957605 18:10111389-10111411 ATGGTTACAGAGATTCTATTTGG + Intergenic
1154131638 18:11741988-11742010 ACGGGTACAGAGATTCAGTTTGG - Intronic
1154192073 18:12238151-12238173 ATGGGTGCAGAGTTTCAGTTTGG + Intergenic
1154192211 18:12239713-12239735 ATGGGTACAGAGTTTCTGTTTGG - Intergenic
1154233387 18:12579512-12579534 ATAAATACAGAGTTTCAATTTGG + Intronic
1154526884 18:15300007-15300029 ATGAGTACAGAGTTTCAGTTTGG + Intergenic
1155118615 18:22795660-22795682 ATGGGTACAGAGTTTCTGTTTGG + Intergenic
1155150000 18:23115685-23115707 ATGGGTACAGAGTTTCAGCTGGG - Intergenic
1155723425 18:29048829-29048851 ATGGATACAGATATTCATTTTGG + Intergenic
1156022280 18:32613559-32613581 ATGGCTACAGAGTTTCTGTTTGG - Intergenic
1156323437 18:36050107-36050129 ATGGATACAAAGTTTCAGTTTGG + Intronic
1156329398 18:36105268-36105290 ATGGGTACAGAGTTTCAATTTGG + Intergenic
1156340267 18:36204194-36204216 ATGGGTACAGAGTTTCTGTTTGG - Intronic
1157618067 18:48999257-48999279 ATGGGAACAGAGTTTCAGTTTGG - Intergenic
1157686075 18:49643917-49643939 ATGGAGGCAGAGTTTCAGTTTGG - Intergenic
1157693932 18:49705687-49705709 ATGGATACAGAACTTCAGTTTGG - Intergenic
1157876309 18:51276944-51276966 ATGGATATAGAGTTTCAGTTTGG - Intergenic
1158038125 18:53059279-53059301 ATATATACACTGATACAGTTTGG - Intronic
1158129572 18:54138161-54138183 ATGAATACTAAGTTTCAGTTGGG - Intergenic
1158170236 18:54590127-54590149 ATGAATACACAATTTCAGTTTGG - Intronic
1158425402 18:57335532-57335554 GTGGGTACAGAGTTTCAGTTTGG + Intergenic
1158578045 18:58656831-58656853 ATGGGTATAGAGTTTCAGTTGGG + Intergenic
1158672374 18:59488215-59488237 ACGGATACAGAGTTTCAGTTTGG + Intronic
1158683797 18:59594421-59594443 ATGGGTACAGAGTTTCCGTTGGG + Intronic
1158895207 18:61906249-61906271 ATGAATACAGAGTTCCAGTTTGG - Intergenic
1158965401 18:62618029-62618051 ATGGATACACAGTTTCAGTTTGG + Intergenic
1159006148 18:63014521-63014543 ACGGATACAGAGTTTCAGTTTGG - Intergenic
1159239435 18:65722253-65722275 ATGGTTACAGAGATTCTGTTTGG + Intergenic
1159301151 18:66570761-66570783 AGGTAAACAGAGATTCATGTGGG + Intronic
1159392895 18:67817306-67817328 ATGAGTACAGAGATTCAGTTAGG - Intergenic
1159617729 18:70600720-70600742 ATGGGTACAGAGTTTCTGTTTGG - Intergenic
1160463653 18:79057968-79057990 ATGAGGACAGAGCTTCAGTTTGG - Intergenic
1160624479 18:80193511-80193533 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1161128572 19:2574347-2574369 ATGGGGACAGAGTTTCAGTTTGG - Intronic
1161173392 19:2824818-2824840 ATGGGGACAGAGCTTCAGTTTGG - Intronic
1161202610 19:3024414-3024436 ATGGGGACAGAAATTCAGTTTGG - Intronic
1161245711 19:3250594-3250616 ATGGGGACAGAGTTTCAGTTTGG - Intronic
1161276207 19:3419102-3419124 ATGGGGACAGAGTTTCAGTTTGG + Intronic
1161296167 19:3521403-3521425 ATGGCGACAGAGTTTCAGTTTGG + Intronic
1161371747 19:3916013-3916035 ATGGAGACAGAGTTTCAGTTTGG - Intronic
1161554718 19:4934431-4934453 ATGGAGTCAGAGTTTCAGTTTGG - Intronic
1161634905 19:5381852-5381874 ATGGGGACAGAGTTTCAGTTTGG + Intergenic
1161739267 19:6010495-6010517 ATGGAGACAGAGCTTCAGTGTGG - Intronic
1161920610 19:7262872-7262894 ATGGGGACAGAGTTTCAGTTTGG + Intronic
1161928959 19:7323371-7323393 ATGGAGACAGAGTTTCAGTTTGG - Intergenic
1161931465 19:7343364-7343386 ATGGGGACAGAGTTTCAGTTTGG + Intergenic
1161987840 19:7667142-7667164 ATGGGGACAGAGTTTCAGTTTGG + Intergenic
1162330164 19:10023221-10023243 ATGGGGACAGAGTTTCAGTTTGG + Intergenic
1162509581 19:11110020-11110042 ATGGGGACAGAGCTTCAGTTTGG - Intronic
1162517038 19:11154778-11154800 ATGGGGACAGAGCTTCAGTTTGG + Intronic
1162862994 19:13522104-13522126 ATGGGGACAGAGTTTCAGTTTGG - Intronic
1162872353 19:13595837-13595859 ATGGAGACAGAGTTTCAGTTTGG + Intronic
1162889678 19:13723446-13723468 ATGGGTACAGAGTTTCAGCTTGG + Intergenic
1164440650 19:28275944-28275966 ATGGGTACAGAGTTTCTGTTTGG - Intergenic
1165500971 19:36189047-36189069 ATGGGTACAGAGTTTCTGTTTGG + Intronic
1165598618 19:37033325-37033347 AAGGGTACAGAGTTTCAGTTTGG - Intronic
1167002597 19:46755082-46755104 ATAAGTACAGAGTTTCAGTTTGG - Intronic
1167190218 19:47982981-47983003 ATGGGTGCAGAGTTTCAGTTTGG + Intronic
1167255540 19:48425797-48425819 ATATATACATAGATACAGTGAGG + Intronic
1167786199 19:51638499-51638521 ATGAGTACACAGATTCAGTATGG - Intronic
1168512371 19:56983061-56983083 ATGGATGCAGAGTTTCAGTTGGG + Intergenic
925985987 2:9215302-9215324 CTGTATATTGAAATTCAGTTAGG + Intronic
926099866 2:10107822-10107844 ATGGGTCCAGAGTTTCAGTTTGG + Intergenic
926175529 2:10588349-10588371 ATGGGTACAGAGTTTCAGGTTGG - Intronic
926208583 2:10851683-10851705 ATGGACATAGAGTTTCAGTTTGG - Intronic
927261242 2:21093325-21093347 ATGAGTAGAGAGTTTCAGTTTGG - Intergenic
927750841 2:25669143-25669165 AGGGGTACAGAGTTTCAGTTGGG + Intronic
928163978 2:28955984-28956006 ATGGATACAGAGTTTCAGTGTGG - Intergenic
928596059 2:32860242-32860264 AAGGATACAAAGTTTCAGTTAGG - Intergenic
929106760 2:38372905-38372927 CTGTGGACAGAGATTTAGTTTGG - Intronic
929181123 2:39040448-39040470 ATGGATACAGAGTTTCAGTTTGG - Intronic
929191419 2:39143989-39144011 ATGCATACAGAGTATCAGTCTGG - Intergenic
929388979 2:41446011-41446033 ATGTGTACAGAGTTTCAATAAGG + Intergenic
929488214 2:42373712-42373734 ATGAGTACAGAGTTTCAGTTGGG - Intronic
929747666 2:44675788-44675810 ATGGTGACAGAGTTTCAGTTTGG - Intronic
929964832 2:46526501-46526523 ATGGATACAGAGTTTAAATTTGG - Intronic
929986323 2:46736443-46736465 ATGAGTACAGAGTCTCAGTTGGG - Intronic
930453882 2:51581109-51581131 CTGTATAGAGAGATTGAGTGTGG - Intergenic
930996050 2:57719751-57719773 ATGGGTACAGAGTTTCAGCTTGG + Intergenic
931019159 2:58023096-58023118 ATGGCTACAGAGTTTCAGTCTGG - Intronic
931032773 2:58199272-58199294 AGATAAACAGAGATCCAGTTTGG - Intronic
931142940 2:59483650-59483672 AATAATACAGAGTTTCAGTTAGG + Intergenic
931591954 2:63894318-63894340 ATGTATAAAGATCTTCAGTATGG + Intronic
931752872 2:65346473-65346495 ATAGGTACAGAGTTTCAGTTTGG - Intronic
932188944 2:69722643-69722665 ATGGATACAGACTTTCTGTTGGG + Intronic
932346100 2:70996123-70996145 ATGGATACAGGGTTTCAGTTTGG + Intergenic
933368206 2:81382343-81382365 GTGTATACAAAAATCCAGTTTGG - Intergenic
933866678 2:86524796-86524818 AGGTACATAGAGATTCATTTGGG + Intronic
934705189 2:96472374-96472396 ACGGGTACAGAGTTTCAGTTTGG + Intergenic
934858761 2:97746194-97746216 ACGTTTACAGAGTTTCTGTTGGG + Intergenic
935073092 2:99713106-99713128 ATGGGCACAGAGTTTCAGTTTGG + Intronic
935188795 2:100759044-100759066 ATGAGTACAGAGTTTTAGTTTGG + Intergenic
935324032 2:101919584-101919606 ATGTATATTGAGATGCAGATAGG + Intergenic
935433794 2:103006519-103006541 AAATATACAGAGTTGCAGTTAGG + Intergenic
935479574 2:103569216-103569238 ATGGTTACAGAGTTTCTGTTTGG + Intergenic
935647098 2:105347139-105347161 ATGTGTACAGATTTACAGTTTGG - Exonic
935716766 2:105946076-105946098 ATGGAGACTGAGTTTCAGTTTGG + Intergenic
936001000 2:108830281-108830303 ATGGATACAGAGTTTCATTTTGG + Intronic
936157804 2:110060350-110060372 ATGAATACAGGGGTTCATTTTGG - Intergenic
936186888 2:110311094-110311116 ATGAATACAGGGGTTCATTTTGG + Intergenic
936379750 2:111973853-111973875 ATGTATACAGAGATTTGGAGGGG + Intronic
937030554 2:118735745-118735767 ATGAGTACAGAGTTTCAGTTTGG - Intergenic
937210324 2:120264718-120264740 ATGGGTGCAGAGGTTCAGTTTGG - Intronic
937302142 2:120849206-120849228 ATGTGCACAGAGTTTCAGTTTGG + Intronic
937440916 2:121915177-121915199 ATGTATTGAGCGATGCAGTTTGG + Intergenic
937893376 2:126957465-126957487 ATGGGTACAGAGCTTCTGTTTGG + Intergenic
938321036 2:130364187-130364209 ATGAATACAGAATTTCTGTTTGG - Intronic
938525981 2:132131364-132131386 ATGAGTACAGAGTTTCAGTTTGG + Intergenic
939150817 2:138470498-138470520 CTGCATACAGAAATTAAGTTTGG + Intergenic
939155501 2:138520423-138520445 ATGTACACAGACATACATTTGGG + Intronic
940197321 2:151109691-151109713 ATGGGCACAGAGTTTCAGTTTGG - Intergenic
940212743 2:151272959-151272981 ATGGGTACAGAGTTTCAGTTTGG + Intronic
940251662 2:151684090-151684112 ATGAATACAGAATTTCAGTCTGG + Intronic
940325245 2:152418419-152418441 ATGGGTAGAGAGTTTCAGTTTGG - Intronic
940421483 2:153483902-153483924 ATGGGTACAGAGTTTGAGTTTGG + Intergenic
940641967 2:156354321-156354343 ACTGATACAGAGTTTCAGTTTGG - Intergenic
940801932 2:158142752-158142774 ATGAGCACAGAGTTTCAGTTTGG + Intergenic
940854792 2:158721663-158721685 ATGAATATAGAGTTTAAGTTTGG + Intergenic
940875774 2:158895773-158895795 ATGTGTATAGAGTTTCAGTTTGG - Intergenic
940887381 2:159001391-159001413 ATGAGTACAGAGTTTCAGTTGGG + Intronic
940937265 2:159510487-159510509 ATGGTTACAGAGTTTCTGTTTGG + Intronic
940977665 2:159964257-159964279 ATGGTTACAGAGTTTCTGTTTGG + Intronic
940981577 2:160009556-160009578 ATGGGTACAGAGTTTCAGTTTGG + Intronic
941092210 2:161190825-161190847 ATGGATACAGAGTTTCAGTTAGG + Intronic
941105093 2:161343183-161343205 ATGGGTACAGAGTTTCAGTTTGG - Intronic
941415779 2:165219298-165219320 ATGTACACAGAGAAACACTTGGG + Intergenic
941784939 2:169487998-169488020 GTATATAGAGAGCTTCAGTTTGG - Exonic
941901879 2:170686623-170686645 ATGTGTACTGAGTTTCAGTTTGG + Intergenic
941915111 2:170807029-170807051 ATGAGGACAGAGTTTCAGTTGGG - Intergenic
942364174 2:175205415-175205437 ATGGATACAGAATTTCAGTTTGG - Intergenic
942617492 2:177809133-177809155 ATGGGTACAGAGTTTCAGTTTGG + Intronic
942714155 2:178871883-178871905 ATGGGTACAGAGTTTCTGTTTGG - Intronic
942879951 2:180847375-180847397 ATGTAAAAAGAAATTCATTTGGG + Intergenic
943000819 2:182326582-182326604 ATGGATACAGAGTTTCAGTTTGG + Intronic
943514963 2:188873899-188873921 ATGTATACATAGATGAAGTGGGG - Intergenic
943613581 2:190065319-190065341 ATAGATACAGAGTTTCAGTCTGG + Intronic
943644718 2:190397873-190397895 ATGAACACAGAGATTCAGTCTGG + Intergenic
943715480 2:191147532-191147554 AAGAGTACAGAGTTTCAGTTTGG + Intronic
944155852 2:196606837-196606859 ATGAATACAGAGATTTGTTTTGG + Intergenic
944210729 2:197203976-197203998 ATGGATACAGAGTTTCATTTGGG + Intronic
944315503 2:198281194-198281216 ATGGTTACAGAGTTTCAGTTTGG - Intronic
944376315 2:199047648-199047670 TTATACACAGAGCTTCAGTTAGG - Intergenic
944733392 2:202537540-202537562 ATGGGTACAGAGTTTCAGTTTGG + Intronic
946493616 2:220173355-220173377 ATGGGTACAGAGATTCTGTTTGG + Intergenic
946902772 2:224388588-224388610 ATGGGTACAGAGTTTCTGTTTGG + Intronic
947346813 2:229200310-229200332 ATGTATACAGAGAATTGCTTGGG + Intronic
948105261 2:235408342-235408364 ATGGATACAGATTTTCAATTTGG + Intergenic
948233582 2:236370302-236370324 ATGTTTACAGCGATTTAGTGAGG + Intronic
948399874 2:237676090-237676112 ATGTGTACAGAATTTCAGTTTGG - Intronic
948582158 2:238995692-238995714 ATAGGTACAGAGGTTCAGTTAGG + Intergenic
948706308 2:239795571-239795593 ATGGGGACAGAGTTTCAGTTTGG - Intronic
948986628 2:241529051-241529073 ATGAGTACAGAGCTTCTGTTTGG + Intergenic
1169098524 20:2925152-2925174 ATGGATATGGAGTTTCAGTTTGG - Intronic
1169344090 20:4816484-4816506 ATGGGTACAGAGCTTCTGTTTGG + Intronic
1169387204 20:5160676-5160698 ATGGGTACAGAGTTTCATTTGGG - Intronic
1170027951 20:11911280-11911302 ATGTACACAGAGTTTTAGTTGGG + Intronic
1170161073 20:13311821-13311843 AAGTGTACAAAGTTTCAGTTAGG + Intergenic
1170269385 20:14507145-14507167 ATGGGTACAGGGTTTCAGTTTGG + Intronic
1170443394 20:16400872-16400894 ATGAGTACAGAGTTTTAGTTTGG + Intronic
1170650210 20:18232583-18232605 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
1171300806 20:24058735-24058757 TTGTGTACAGAGTTTCAGTCTGG + Intergenic
1172070207 20:32251196-32251218 ATGGGTCCAGAGTTTCAGTTTGG - Intergenic
1172321242 20:33996749-33996771 ATGGGTACAGAATTTCAGTTGGG - Intronic
1172422888 20:34832355-34832377 ATGAATACAAAGTTTCAGTTGGG + Intergenic
1172554648 20:35830230-35830252 ATAGATACAGGGTTTCAGTTTGG - Intronic
1172616257 20:36287067-36287089 ATGTATCCTGAAATTCAGTGGGG - Intergenic
1172638548 20:36426591-36426613 ATGGGTACAGAGTTTCTGTTTGG + Intronic
1172979968 20:38933763-38933785 ATGGGTACAGAGGTTCACTTTGG - Intronic
1173046107 20:39513866-39513888 ATATGTACAGAGTTTCAATTGGG + Intergenic
1173344394 20:42185327-42185349 ATATAGGCAGAGATTCAGATAGG - Intronic
1174525409 20:51166571-51166593 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
1174894351 20:54433121-54433143 AGGGATACAAAGTTTCAGTTAGG - Intergenic
1175635392 20:60578608-60578630 AGGTGTACAGTGGTTCAGTTTGG + Intergenic
1176378702 21:6100945-6100967 ATGGGTTCAGAGTTTCAGTTTGG - Intergenic
1176770552 21:13068498-13068520 ATGAGTACAGAGTTTCAGTTTGG - Intergenic
1177265607 21:18779488-18779510 ATGGATATAAAAATTCAGTTGGG - Intergenic
1177453972 21:21310736-21310758 ACGTATACATAGATTCATCTTGG + Intronic
1177474625 21:21603478-21603500 ACGGATACAGTGTTTCAGTTGGG + Intergenic
1177596369 21:23248310-23248332 ATTTAGTCAGAGATACAGTTAGG - Intergenic
1177705335 21:24696788-24696810 ATGGGTACAGAGTTTCAATTGGG + Intergenic
1179428125 21:41297942-41297964 ATGGATACAAAATTTCAGTTAGG + Intergenic
1179744773 21:43437292-43437314 ATGGGTTCAGAGTTTCAGTTTGG + Intergenic
1179948170 21:44694438-44694460 ATGGGGACAGAGTTTCAGTTCGG + Intronic
1180435448 22:15298780-15298802 ATGAGTACAGAGTTTCAGTTTGG - Intergenic
1180517644 22:16162591-16162613 ATGAGTACAGAGTTTCAGTTTGG - Intergenic
1181046887 22:20219132-20219154 ATGGATACAGAGTTTCAGTTTGG - Intergenic
1181784447 22:25216742-25216764 ATGGGTACAGAGTTTCTGTTTGG - Intergenic
1181975398 22:26725479-26725501 ATGGGTACAGAGTTTCTGTTTGG - Intergenic
1182233707 22:28859202-28859224 ATGGGTACAGAGTTTCTGTTTGG - Intergenic
1182408844 22:30163913-30163935 ATGGGTATAGAGTTTCAGTTTGG - Intronic
1182636270 22:31729781-31729803 ATGCGTACTGAGTTTCAGTTTGG + Intronic
1182672008 22:32004304-32004326 ATGGATACAGAGTTTCTGTTTGG - Intergenic
1184016465 22:41789603-41789625 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1184267014 22:43353627-43353649 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
1184429936 22:44436719-44436741 ATGAAGACAGAGTTTCAGTTTGG - Intergenic
1184621106 22:45678101-45678123 ATGTTTACAGAGTTTCTATTTGG + Intronic
1184931552 22:47685017-47685039 ATGCCTATAGAGTTTCAGTTTGG - Intergenic
949132859 3:526563-526585 AGTTATGCACAGATTCAGTTAGG + Intergenic
949324606 3:2849283-2849305 AGGGATACAGAGTTTCAGTTTGG + Intronic
949385318 3:3495424-3495446 ATGGGTACAGAGTTTCTGTTTGG + Intergenic
949857433 3:8474760-8474782 ATGGGTACAGAGTTTCAGTCTGG + Intergenic
949958951 3:9295762-9295784 ATGGGTACAGAGTTTCAGTTTGG - Intronic
950036475 3:9889651-9889673 ATGGGTACAGAGCTTCAGTTCGG - Intergenic
950106080 3:10389626-10389648 ATGGGTGCAGAGCTTCAGTTTGG + Intronic
950527161 3:13531150-13531172 ATGGGGACAGAGTTTCAGTTTGG + Intergenic
950732211 3:14970447-14970469 ATGGATACCGAGTTTCAGTCTGG - Intronic
951108306 3:18771096-18771118 ATTTATACAGAGATTCTGTGTGG - Intergenic
951448389 3:22808661-22808683 ATAGGTACAGAGTTTCAGTTGGG + Intergenic
952230544 3:31425072-31425094 GTATACACAGAGATTCACTTAGG - Intergenic
952292907 3:32035913-32035935 ATGGATACAGAGTTTCAATTTGG - Intronic
952345300 3:32478288-32478310 ATGGATACAAAGTTACAGTTAGG + Intronic
952459573 3:33510247-33510269 ATGGGTACAGAGTTTCAGTCTGG + Intronic
952675170 3:36021088-36021110 ATGGGTACAAAGATACAGTTAGG + Intergenic
952773775 3:37025181-37025203 ATGGGCACAGAGTTTCAGTTTGG + Intronic
952821366 3:37488943-37488965 ATGGGTACAGAGCTTTAGTTTGG - Intronic
953005589 3:38975848-38975870 ATGGATATAGAGTTTCAATTTGG + Intergenic
953231398 3:41068225-41068247 ATGGGCACAGAGTTTCAGTTGGG - Intergenic
953408695 3:42675161-42675183 ATATGTACAGAGTTTCAGTTTGG - Intergenic
953559992 3:43980574-43980596 ACGTGTACAGAGTTTCAGTTTGG - Intergenic
953602688 3:44383569-44383591 ATGTGTACAGAGTTTGAGTTGGG + Intronic
953695558 3:45155682-45155704 ATGGTTGCAGAGTTTCAGTTCGG - Intergenic
953724375 3:45384869-45384891 AGGGATACAGAGTTCCAGTTTGG - Intergenic
953812785 3:46129024-46129046 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
954100092 3:48365452-48365474 ATCTATACAGTGTATCAGTTTGG - Intergenic
954175259 3:48839983-48840005 ATAGGTACAGAGTTTCAGTTTGG - Intronic
954283919 3:49604334-49604356 ATGGGTACAGAGTTTCTGTTTGG - Intronic
954339795 3:49944118-49944140 ATGGGTACAGAAACTCAGTTTGG - Intronic
955101426 3:55853785-55853807 ATGAGTGCAGAGTTTCAGTTTGG + Intronic
955460143 3:59173158-59173180 ATGGATACAAAAATACAGTTAGG - Intergenic
955462194 3:59195431-59195453 ATGGGCACAGAGTTTCAGTTTGG + Intergenic
955508579 3:59656556-59656578 ATGGATTCAGAGATTCTGTTTGG - Intergenic
955771424 3:62388512-62388534 AAGGGTACAGAGTTTCAGTTAGG - Intergenic
955900126 3:63744625-63744647 ATGGGTATAGAGTTTCAGTTAGG + Intergenic
955944564 3:64180429-64180451 ATGAGTACAGAGTTTCAGTATGG - Intronic
956027585 3:64999861-64999883 ACGGGTACAGAGTTTCAGTTTGG + Intergenic
956064288 3:65380471-65380493 ATGAGTACAGAGTTTCAATTTGG - Intronic
956121461 3:65970364-65970386 ATCGATAAAGAGTTTCAGTTTGG + Intronic
956443675 3:69305025-69305047 ATGTATAAAGAGTTCCAGCTTGG - Intronic
957944591 3:87047063-87047085 ATCTATACAGACATTCAATTAGG + Intergenic
958774742 3:98468448-98468470 ATGGTTACAGAGTTTCAGTTTGG - Intergenic
959036823 3:101376224-101376246 ATAGATACAGAGTTTCAGTTTGG + Intronic
959037117 3:101380197-101380219 ATAGATACAGAGTTTCAGTTTGG + Intronic
961021383 3:123510113-123510135 ATGGGTACAGAGTTTCTGTTTGG - Intronic
961068107 3:123893196-123893218 ATGTGTACAAAGTTTCTGTTTGG - Intergenic
961347019 3:126269642-126269664 AGGGATACAGACATACAGTTAGG + Intergenic
961366180 3:126401203-126401225 ATGCACGCAGAGTTTCAGTTTGG + Intronic
961525075 3:127491523-127491545 ATGGGGACAGAGGTTCAGTTTGG + Intergenic
961529518 3:127532031-127532053 TTGAATACAGAGATCCAGTCAGG + Intergenic
961617107 3:128191582-128191604 ATGGGTACAGAGTTTCAGTTTGG - Intronic
961765862 3:129210478-129210500 ATGAGTACAGAGTATCAGTTTGG + Intergenic
962111865 3:132459448-132459470 ATGATTACAGAGTTTCAGTTTGG + Intronic
962182030 3:133216555-133216577 AAGGATACAAAGTTTCAGTTAGG - Intronic
962365864 3:134780369-134780391 ATGAGTACAGAGTTTCTGTTTGG - Intronic
963208856 3:142666277-142666299 ATGGATATGGAGTTTCAGTTTGG - Intronic
964790226 3:160446991-160447013 ATGGGTACACAGTTTCAGTTTGG + Intronic
964939412 3:162136980-162137002 ATGTGTAGAGAGTTTCTGTTTGG - Intergenic
965461515 3:168970592-168970614 ATGGGTACAGAGCTTCTGTTTGG + Intergenic
965505370 3:169509465-169509487 TTGGGTACAGAGTTTCAGTTTGG - Intronic
965616207 3:170595255-170595277 ATGGGTACAGAACTTCAGTTTGG - Intronic
966412797 3:179660242-179660264 ATGGATACAGAGTTTCAGTTTGG - Intronic
966742421 3:183246309-183246331 ATAGGTACAGAGATTCAGTTTGG - Intronic
966838881 3:184072098-184072120 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
966890260 3:184402140-184402162 ATGGGTACAGAGTTTCTGTTTGG - Intronic
967052148 3:185794782-185794804 ATGGGAACAGAGTTTCAGTTTGG - Intronic
967199811 3:187062982-187063004 ATGAATACTGTGATTCATTTTGG + Intronic
967217332 3:187221459-187221481 ATGTATACAAAAATGAAGTTTGG + Intronic
967663879 3:192148473-192148495 ATGAGTACAGAGTTTCAGTTGGG + Intronic
967906282 3:194503222-194503244 ATGGATACAGAGTTTCTTTTGGG + Intergenic
968200547 3:196750998-196751020 ATGAGTACCGAGTTTCAGTTGGG - Intronic
968215051 3:196882349-196882371 ATGGGTACAGAATTTCAGTTTGG - Intronic
968358331 3:198125582-198125604 GTGGATACAGAGTTTCACTTTGG - Intergenic
969371845 4:6736541-6736563 ATGGGGACAGAGTTTCAGTTGGG - Intergenic
969372157 4:6739771-6739793 ATGGGTACAGAGTTTCTGTTTGG + Intergenic
969918287 4:10511477-10511499 ATGGATACAGAGTTTCAGTTTGG - Intronic
970176421 4:13344103-13344125 ATGGGGACAGAGTTTCAGTTTGG + Intergenic
970373160 4:15429347-15429369 GGGTATAGAGAGTTTCAGTTTGG - Intronic
970569681 4:17367602-17367624 ATGGGTACAAAGCTTCAGTTTGG + Intergenic
970619569 4:17803487-17803509 ATCTTTACAGTGATGCAGTTAGG + Exonic
971350277 4:25849555-25849577 ATGGGTCCAGAGTTTCAGTTTGG + Intronic
971368527 4:25996379-25996401 ATGGATACAGACTTTCAGCTGGG - Intergenic
971411382 4:26376245-26376267 ATGAGCACAGAGTTTCAGTTTGG - Intronic
971434290 4:26603926-26603948 ATGGGTACAGAGTTTCAGCTTGG - Intronic
971511530 4:27432342-27432364 ATGACTACAGAGTTTCATTTTGG + Intergenic
971985769 4:33821645-33821667 ATGGGTACAGAGCTTCAGTTTGG - Intergenic
972544436 4:40066829-40066851 CTGGGTACAGAGTTTCAGTTTGG - Intronic
972744388 4:41919389-41919411 ATGGGTACAGAGTTTCTGTTTGG + Intergenic
972823365 4:42728082-42728104 AAGTGTACAAAGTTTCAGTTAGG - Intergenic
973080638 4:45988002-45988024 AAGTGTACAAAGTTTCAGTTAGG + Intergenic
974217015 4:58861322-58861344 ATGTCTAGAGTGATTTAGTTGGG - Intergenic
974557839 4:63474740-63474762 TTATATACAGAAATTCATTTTGG + Intergenic
974773321 4:66444862-66444884 ATGGGTACAGAGTTTTAGTTTGG + Intergenic
974925014 4:68287235-68287257 ATGTGTACAGATATTCTTTTAGG - Intergenic
975014007 4:69388920-69388942 ATGGATGCAGAAATTCAGTGGGG + Intronic
975015260 4:69408267-69408289 ATGGATGCAGAAATTCAGTGGGG + Intronic
975264866 4:72351354-72351376 ATGTATATAGAAAATCATTTAGG - Intronic
975385701 4:73757227-73757249 ATGGGTACAGAGTTTCAATTTGG - Intergenic
975634123 4:76429249-76429271 ATGGGTACAGAGCTTCAGTCTGG - Intergenic
975636256 4:76452344-76452366 ATGGATACAGAGTTTCAGTTTGG - Intronic
975815426 4:78211816-78211838 ATGGTTACAGGGATTCTGTTTGG - Intronic
975927125 4:79470573-79470595 ATTAATACAAAGTTTCAGTTTGG - Intergenic
976171068 4:82304844-82304866 ATGTGTACAGAGTTTCAGTTTGG + Intergenic
976252236 4:83064471-83064493 ATAGGTACAGAGTTTCAGTTTGG - Intronic
976280751 4:83324793-83324815 ATGGGTACAGAGTTTCAGTTTGG + Intronic
976384802 4:84444471-84444493 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
976705187 4:88012684-88012706 ATGAGTACAGAGTTTCTGTTTGG - Intronic
976879651 4:89904402-89904424 ATGGGTACAGAGCTTCAGTTTGG - Intronic
976894042 4:90085673-90085695 ATGGATACAAAGATTCTGTTTGG - Intergenic
977358013 4:95970830-95970852 AATTATACAGAGTTTCAGTGGGG - Intergenic
977550697 4:98439955-98439977 ATGAGTACAGAGTTTCAGTTTGG - Intronic
977727658 4:100315950-100315972 ATGATTGCAGAGTTTCAGTTTGG - Intergenic
977749969 4:100597772-100597794 ATGAATACAGAGTTTCAGTTTGG - Intronic
977809230 4:101339768-101339790 TTGTATTCAGAGTTTTAGTTTGG - Intronic
977833840 4:101624666-101624688 TTGGATACAGAGTTTCAGTCTGG + Intronic
978275780 4:106948045-106948067 ATGGATACAGAGTTTTATTTAGG - Intronic
978477892 4:109152906-109152928 ATGGGTACAGAGATTCAGCTGGG + Intronic
978668678 4:111219018-111219040 ATGTCTACAGAGATACAACTGGG - Intergenic
978822068 4:112978440-112978462 ATGTGTACAGAGTTTCAGTTTGG - Intronic
978851682 4:113344939-113344961 ATAGATACAGAATTTCAGTTAGG + Intronic
979274806 4:118803118-118803140 ATGGGTACAGAGTTTCAGTGTGG + Intronic
979836101 4:125369735-125369757 ATGGGTAGAGAGTTTCAGTTTGG - Intronic
979947995 4:126858863-126858885 ATGTATGCTCAGATTCAGATTGG - Intergenic
981189950 4:141851140-141851162 ATGTTCAGAGAGAATCAGTTGGG - Intergenic
981553803 4:145969587-145969609 ATGAATATAGAGTTTTAGTTTGG + Intergenic
981661254 4:147169246-147169268 ATGGACATAGAGTTTCAGTTTGG + Intergenic
981833936 4:149032905-149032927 ATGTAAACAAAGATTCTTTTGGG + Intergenic
981866229 4:149422771-149422793 ATGTTTACAGAGAGCCAGTTAGG - Intergenic
981936719 4:150247334-150247356 ATGAATGCAGAGTTTCGGTTTGG - Intronic
981946225 4:150347242-150347264 ATGCTTAGAGAGTTTCAGTTTGG + Intronic
982253960 4:153434554-153434576 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
982474211 4:155830715-155830737 ATGCGTACAGAGTTTCAGTTAGG - Intronic
982506703 4:156227709-156227731 ATGAATACACAAATTCAGATGGG + Intergenic
982854850 4:160368476-160368498 ATGGATACAGAGTTTGAGTTTGG + Intergenic
982920618 4:161268721-161268743 ATGGGTACAAACATTCAGTTAGG + Intergenic
983187905 4:164721726-164721748 ATGGGTACAGAGTTTCAGATTGG - Intergenic
983571897 4:169217715-169217737 ATGGATACAGAGTTTTAGCTGGG + Intronic
983933231 4:173475954-173475976 ATGGATATAGAGTTTCAGTTTGG + Intergenic
984279257 4:177648813-177648835 CAGTATACAGAGTTTTAGTTCGG + Intergenic
984366946 4:178811560-178811582 ATGAATTCAGAGACACAGTTAGG + Intergenic
984454792 4:179951948-179951970 ATGTAGACAGAAAATCAGTGAGG - Intergenic
984462180 4:180052378-180052400 AACTATGCAGAGTTTCAGTTTGG + Intergenic
984897151 4:184551446-184551468 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
984977658 4:185243617-185243639 ATGGGTATAGAGTTTCAGTTTGG - Intronic
985107791 4:186515738-186515760 ATGGGTACAGAGTTTCAGCTGGG + Intronic
985243827 4:187959311-187959333 ATGGGTACAGAGTTTCAGTTGGG - Intergenic
985307269 4:188557037-188557059 AAGTGTACAAAGTTTCAGTTAGG + Intergenic
985526190 5:403230-403252 ATGTGGTCAGAGTTTCAGTTTGG + Intronic
985960304 5:3297380-3297402 ATGGAGACAGAGTTTTAGTTTGG - Intergenic
986063875 5:4216888-4216910 GTGTAGACAGAGATCCACTTTGG + Intergenic
986114095 5:4751838-4751860 AAATATACAGTGATACAGTTTGG - Intergenic
986636806 5:9830303-9830325 ATATATACAGAAATACAGATAGG + Intergenic
986694115 5:10336987-10337009 ATGTGTTCAGAGTTTCCGTTTGG + Intergenic
987016099 5:13820928-13820950 ATGAGTACAGAGTTTCAATTTGG + Intronic
987156567 5:15095560-15095582 ATGGGTACAGAGTTTCTGTTTGG - Intergenic
987629073 5:20443990-20444012 ATGCCTACAGAGATTAAGTAAGG - Intronic
987960039 5:24794839-24794861 ATATAATCAGAGATTCTGTTTGG - Intergenic
988121583 5:26970450-26970472 GTGTATACATAGATGCAGTGAGG - Intronic
989005138 5:36801679-36801701 ATGAGTACAGAGTTTCTGTTTGG + Intergenic
989132450 5:38121060-38121082 ATGGGTACAGAGTTTCTGTTTGG - Intergenic
989242264 5:39215054-39215076 ATGGATATAGAGTTACAGTTGGG + Intronic
989397511 5:40974170-40974192 ATGGATATAGAGCTTCAGTTTGG - Intronic
989659635 5:43786429-43786451 AAGAATACAGAATTTCAGTTAGG + Intergenic
990432292 5:55747693-55747715 ATGAGTACAGAGTTCCAGTTTGG - Intronic
991357408 5:65783167-65783189 ATGGTTACAGAGTTTCTGTTTGG + Intronic
991453707 5:66780180-66780202 ATGGGTACAAAGTTTCAGTTTGG - Intronic
991656250 5:68906545-68906567 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
991735057 5:69624272-69624294 ATGGATACAGAGTTTCCTTTGGG - Intergenic
992304907 5:75426806-75426828 ATGGACACAGAGTTTCAGCTGGG + Intronic
992350895 5:75928211-75928233 ATGGATACAAAGTTTCTGTTTGG - Intergenic
992402084 5:76420695-76420717 ATGTGTATGGAGTTTCAGTTTGG - Intronic
992938839 5:81741356-81741378 ATGAGTACAGAGTTTCAGTCTGG + Intronic
993321135 5:86468389-86468411 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
993699054 5:91096836-91096858 ATGGATATAGAGTTTCTGTTTGG - Intronic
993705558 5:91165870-91165892 GGGTATACAGAGTTTCTGTTTGG - Intergenic
993782117 5:92079488-92079510 ATATATACAGTACTTCAGTTAGG + Intergenic
993811508 5:92484205-92484227 ATGGGTACAGAGTTTCTGTTTGG + Intergenic
993934063 5:93978897-93978919 ATGGATACAAACATACAGTTAGG + Intronic
994088117 5:95782404-95782426 TTGGGTACAGAGTTTCAGTTTGG + Intronic
994651500 5:102534751-102534773 ATGGATACAGAGTTTCAATCTGG + Intergenic
994673358 5:102789661-102789683 ATAGGTACAGAGTTTCAGTTTGG + Intronic
994727842 5:103457393-103457415 ATGGGTACAGAGTTTCAGTTGGG - Intergenic
994963135 5:106630135-106630157 AAGGATACAGAGTTTCAGTTAGG + Intergenic
995119930 5:108525474-108525496 ATGAGTATAGAGATTCAGTTTGG - Intergenic
995762430 5:115577561-115577583 ATGGGTACAGAGTTTCTGTTTGG - Intergenic
995979389 5:118082752-118082774 ATGTAGACAGGGATTCAGGCTGG - Intergenic
996269821 5:121589815-121589837 ATGAGTACAAAGTTTCAGTTAGG + Intergenic
996469971 5:123848774-123848796 AGGTGTACAGAAATACAGTTGGG - Intergenic
996792663 5:127309405-127309427 ATGGGTACAGAGTTTCAATTTGG - Intronic
997169844 5:131706114-131706136 ATGGATACAGAGTTTCAGCTGGG + Intronic
997205635 5:132047545-132047567 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
997329563 5:133050073-133050095 AGGGATACAGAGTTTCAGTTTGG - Intergenic
997478603 5:134165108-134165130 ATGGGTACAGAGTTTCAGTGTGG + Intronic
997810777 5:136966119-136966141 ATGGATACAGAGATTCCATCTGG - Intergenic
997877793 5:137564889-137564911 ATGTAAAGAGGGATTCAGTGTGG - Intronic
997897402 5:137731958-137731980 ATGGATAGAGAGTTTCAGTTTGG - Intronic
998015764 5:138730770-138730792 ATGGATATGGAGTTTCAGTTTGG + Intronic
998165587 5:139841007-139841029 ATGTGTACAGAGTTTCAGTTTGG - Intronic
998268498 5:140685321-140685343 ATGGGTACAGAGTTTCAATTGGG + Intronic
998332044 5:141337646-141337668 ATAAGTACAGAGTTTCAGTTGGG + Intronic
998801111 5:145870196-145870218 ATGGATACAGAGTTTCAATTTGG - Intronic
998808988 5:145947100-145947122 ATGGGTACAGAGTTTCAGTATGG - Intronic
999038473 5:148380939-148380961 TTGTTTAAAGAGTTTCAGTTTGG + Intergenic
999509970 5:152239871-152239893 ATGAGTACAGAGTTTCTGTTTGG + Intergenic
999695807 5:154188128-154188150 ATGGGTACAGAGTTTCAGTTGGG + Intronic
999794555 5:154976943-154976965 ATGGATACAGAGTTTCAGATGGG - Intergenic
999795248 5:154982802-154982824 ATGGGTACAGAGTTTCAGTTGGG - Intergenic
999854860 5:155583171-155583193 ATGTATACAAAGTTTTTGTTTGG + Intergenic
1000700104 5:164438748-164438770 AAGTAGACAGAAAATCAGTTAGG - Intergenic
1000823786 5:166018236-166018258 ATGTAAAGAGTGATTCATTTGGG + Intergenic
1001047454 5:168385711-168385733 ACGAGTACAGAGTTTCAGTTTGG + Intronic
1001781564 5:174373443-174373465 ATGAATATAGAGTTTCAATTGGG + Intergenic
1001784481 5:174400379-174400401 ATGGGTACCGAGTTTCAGTTGGG + Intergenic
1001903781 5:175453869-175453891 ATGTATGCAAAGACTCAGGTGGG + Intergenic
1002147929 5:177200535-177200557 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1002165675 5:177343806-177343828 ATGGGTAGAGAGTTTCAGTTGGG + Intronic
1002209541 5:177589009-177589031 ATGTATGTAGAGGTTCAGTCAGG - Intergenic
1002703189 5:181141880-181141902 GAGTATACACAGTTTCAGTTAGG - Intergenic
1002791015 6:437558-437580 ATGGAGACAGAGCTTCAGTTTGG - Intergenic
1002908853 6:1472521-1472543 ATGGGTTCAGAGCTTCAGTTAGG + Intergenic
1002908997 6:1473844-1473866 ATGGGTGCAGAGTTTCAGTTTGG - Intergenic
1003092673 6:3117625-3117647 ATGGGGACAGAGTTTCAGTTTGG - Intergenic
1003161759 6:3641702-3641724 AAGTGTACAAAGTTTCAGTTAGG + Intergenic
1003243127 6:4361650-4361672 ATGGGTAGAGAGCTTCAGTTTGG - Intergenic
1003271207 6:4609471-4609493 ACGTGTACAGAGTTCCAGTTCGG + Intergenic
1003295578 6:4823851-4823873 ATGGTTACAGAGTTTCTGTTTGG - Intronic
1003509849 6:6770678-6770700 ATGGGTACAGAGCTTCAGTTTGG + Intergenic
1003531843 6:6943633-6943655 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1003536264 6:6978260-6978282 ATGGGGACAGAGTTTCAGTTTGG + Intergenic
1003549329 6:7088193-7088215 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
1003597207 6:7484697-7484719 ATAGGTACAGAGTTTCAGTTTGG - Intergenic
1003934283 6:10959419-10959441 ATGGGTACAGAGTTTCTGTTTGG + Intronic
1004361837 6:14978172-14978194 ATGTGTACAGAGTTTCTGTTTGG - Intergenic
1004550657 6:16644119-16644141 ATGAATGCAGAGCTTCTGTTCGG + Intronic
1004813475 6:19286636-19286658 ATGAATACAGAGTTTCCATTTGG + Intergenic
1004953050 6:20695896-20695918 ATGGGTACAGAGTTTTAGTTTGG - Intronic
1004978123 6:20991292-20991314 ATGGGTACAGAGTTTCAGTCTGG + Intronic
1005062529 6:21790345-21790367 ATGGGTACAGAGTTTCAGGTTGG - Intergenic
1005282512 6:24289457-24289479 ATTTTTGGAGAGATTCAGTTGGG - Intronic
1005320840 6:24651986-24652008 ATGGGTACAGAGTTTCAGTTGGG - Intronic
1005625281 6:27656631-27656653 ATGGTTATAGAGTTTCAGTTTGG + Intergenic
1006243701 6:32710029-32710051 ATGGTTACAGAGTTCCAGTTTGG - Intergenic
1006351233 6:33522476-33522498 ATGGGTACAGAGTTGCAGTTTGG - Intergenic
1006476901 6:34261611-34261633 ATGTGTACAGAGTTTCAGTTTGG + Intergenic
1006594171 6:35180710-35180732 ATGGATATAGAGTTTCTGTTTGG - Intergenic
1006874990 6:37287516-37287538 ATGGATACAGAGTTCCAGTTTGG - Intronic
1007102371 6:39258239-39258261 GTGAATACAGAGTTTCTGTTTGG - Intergenic
1007544499 6:42682275-42682297 ATGAGTACAGAGTTTCAGTTGGG + Intronic
1007650212 6:43414752-43414774 ATGTGTACAGAGTTTCAGTTTGG + Intergenic
1007859394 6:44891626-44891648 ATGGGTACAGAGTTTCTGTTTGG + Intronic
1007926550 6:45654195-45654217 AAGGATACAGAGCTTCTGTTGGG - Intronic
1008006140 6:46411354-46411376 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1008057294 6:46958394-46958416 GTGTGTACAGAGTTTCAGTTAGG + Intergenic
1008301489 6:49846012-49846034 ATGAGTACAGAGTTTCGGTTTGG + Intronic
1008608163 6:53160656-53160678 ATGCGTACAGAGTTTCAGTTTGG - Intergenic
1010475958 6:76287583-76287605 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
1011152844 6:84293381-84293403 ATAGGTACAGAGTTTCAGTTTGG - Intergenic
1011190515 6:84723113-84723135 ATGAGTACAGAGTTTGAGTTTGG - Intronic
1011567965 6:88699941-88699963 ATGGCTACAGAGTTTCTGTTTGG + Intronic
1011627240 6:89293323-89293345 ATGAATATAGAGTTTCTGTTTGG + Intronic
1011784005 6:90824012-90824034 ATGGATATAGAGTTTCTGTTTGG - Intergenic
1011867802 6:91852990-91853012 ATGTACTTAGAAATTCAGTTGGG - Intergenic
1012458017 6:99428660-99428682 ATGGGTACAGAGTTTCCGTTTGG + Intergenic
1012513193 6:100028366-100028388 ATTGGTACAGAGCTTCAGTTGGG + Intergenic
1012530222 6:100226765-100226787 AGTTATACAGAGTTTCAGTTTGG - Intergenic
1012871521 6:104678130-104678152 ATGTTTACAAAGAGTCAATTAGG - Intergenic
1013252860 6:108352076-108352098 ATGGACACAGAGTTTCAGTTTGG - Intronic
1014250536 6:119111388-119111410 ATGGATACAGAGTTTCAGTTGGG + Intronic
1014353178 6:120369266-120369288 ATGTATACTTAGTTTCTGTTTGG - Intergenic
1014797104 6:125738036-125738058 ATGGGTACAGAGTTTCTGTTTGG + Intergenic
1015037215 6:128670176-128670198 ATGGGTACAAAGTTTCAGTTAGG + Intergenic
1015168661 6:130227084-130227106 ATGGGTACAGAGTTTCATTTTGG - Intronic
1015607461 6:134973470-134973492 ATGGGTACAGATTTTCAGTTTGG + Intronic
1015618236 6:135101785-135101807 ATGGATACAGAGTTTCATTTTGG - Intronic
1015651116 6:135461350-135461372 ATGTATAGTGATATTCATTTTGG - Intronic
1016327620 6:142921049-142921071 AAGTATACAGAGCTACAGTAAGG + Intronic
1016415064 6:143823541-143823563 TTGTAAACAGTAATTCAGTTGGG + Intronic
1017144127 6:151218463-151218485 ATAGGTACAGAGATTTAGTTTGG - Intergenic
1017153502 6:151302513-151302535 ATGTTTAAAGAGACTCAGTTTGG + Intronic
1017646518 6:156544235-156544257 ATGAGTACAGAGTTTCAGTTTGG - Intergenic
1017846953 6:158266930-158266952 ATGGGCACAGAGTTTCAGTTTGG - Intronic
1018466122 6:164047121-164047143 AAGAATACAAAGATTCAGTTAGG - Intergenic
1018700207 6:166420371-166420393 ATGGGGACAGAGTTTCAGTTTGG - Intronic
1018745266 6:166756924-166756946 ATGGGAACAGAGCTTCAGTTTGG + Intronic
1019420976 7:950949-950971 ATGGGGACAGAGCTTCAGTTTGG + Intronic
1019694261 7:2436256-2436278 ATGGGGACAGAGTTTCAGTTTGG - Intergenic
1019810351 7:3160623-3160645 ATGGGGACAGAGTTTCAGTTTGG + Intronic
1019894088 7:3969616-3969638 ATGTATTCAGAGATTTAATAGGG + Intronic
1019923318 7:4176610-4176632 ATGGGGACAGAGTTTCAGTTTGG - Intronic
1020115565 7:5474203-5474225 ATGGGGACAGAGTTTCAGTTGGG + Intronic
1020948374 7:14644185-14644207 ATGTATCTATAGAGTCAGTTAGG - Intronic
1021498402 7:21301980-21302002 ATGGGTACTGAGTTTCAGTTTGG + Intergenic
1021848638 7:24786682-24786704 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1021922767 7:25503249-25503271 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1022313236 7:29217603-29217625 ATGAATACAAATATTTAGTTGGG + Intronic
1022322755 7:29302721-29302743 ATCGGTACAGAGTTTCAGTTTGG - Intronic
1022378023 7:29833191-29833213 ATGGGTACAGAGTTTCTGTTTGG + Intronic
1022425414 7:30264264-30264286 ATGGATACAGAGTTTCTGTTTGG - Intergenic
1022697148 7:32718445-32718467 ATGCATACAAAGTTTCAGTTAGG + Intergenic
1022797121 7:33741020-33741042 ATGGATATAGAGTTTCAGTTTGG - Intergenic
1022933658 7:35149532-35149554 ATGTATACAAAGTTTCAGTTAGG + Intergenic
1022940121 7:35227831-35227853 ATGGGTACAGAGTTTCTGTTTGG + Intronic
1023055825 7:36289293-36289315 ATGGGTACCGAGCTTCAGTTTGG - Intronic
1023223980 7:37949988-37950010 ATGGAGACAGAGTTTCAGTTTGG + Intronic
1023341238 7:39222526-39222548 ATGGGTACAGAGTTTCAGCTGGG - Intronic
1023596768 7:41837704-41837726 ATGGATACAAAGTTTTAGTTTGG - Intergenic
1023877892 7:44299403-44299425 GTGGGTACAGAGTTTCAGTTGGG + Intronic
1023887664 7:44372344-44372366 ATGAATATGGAGTTTCAGTTTGG + Intergenic
1023963813 7:44950509-44950531 ATGGGGACAGAAATTCAGTTTGG - Intergenic
1024007393 7:45236735-45236757 ATGTATGCAGAGATGGACTTTGG + Intergenic
1024160667 7:46671780-46671802 AGGTATACATAGGTTCAGTCTGG - Intergenic
1024567831 7:50697165-50697187 ATGGGTACAGAGTTTCTGTTTGG + Intronic
1025968102 7:66294148-66294170 ATGGGTACAGAATTTCAGTTTGG - Intronic
1026333567 7:69374319-69374341 CTGCATACAGAGTTTCTGTTTGG + Intergenic
1027026978 7:74859966-74859988 ATGAATACAGAGTTTCTATTAGG + Intergenic
1027060774 7:75084138-75084160 ATGAATACAGAGTTTCTATTAGG - Intergenic
1027633134 7:80633745-80633767 ATGTATACATACATACATTTAGG - Intronic
1027938000 7:84633517-84633539 ATGTATACAAACATACAGTTAGG - Intergenic
1028190396 7:87843656-87843678 ATGTATATTGAGATCCACTTTGG - Intronic
1028193947 7:87883297-87883319 ATGGGTACAGACTTTCAGTTTGG + Intronic
1028283507 7:88964550-88964572 ATGCATACAGAGTTTCAATTGGG + Intronic
1028865991 7:95713002-95713024 ATATATTGATAGATTCAGTTAGG - Intergenic
1028924349 7:96341318-96341340 ATGGATACAGAGTTTCTGTTTGG - Intergenic
1029561534 7:101306199-101306221 ATGGTTATAGAGTTTCAGTTAGG + Intergenic
1029829589 7:103242302-103242324 ATGCATACAAAGTTTCAGTTAGG + Intergenic
1029962155 7:104699569-104699591 ATGGACATAGAGCTTCAGTTGGG + Intronic
1030199103 7:106884436-106884458 ATGGGTACAGAGTTTCAGCTGGG - Intronic
1030211889 7:107005063-107005085 ATTTATTCAGCTATTCAGTTAGG - Intergenic
1030250342 7:107436474-107436496 ATGACTACAGAGTTTCAGGTTGG + Intronic
1030347559 7:108451819-108451841 ATGTGTACAGAGTTACAATTTGG + Intronic
1030619324 7:111772122-111772144 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1030789408 7:113705573-113705595 ATGTGTACAGAGTTTCAGTTTGG + Intergenic
1031048946 7:116925611-116925633 ATATATACAAAGATTGAGTCGGG + Intergenic
1031602861 7:123733416-123733438 ATTTATACAGAGATTTTTTTTGG - Intronic
1032004604 7:128290843-128290865 ATGGGTACAGAGCTTCAGTGTGG - Intergenic
1032059473 7:128712436-128712458 ATGGGTGCAGAGTTTCAGTTAGG - Intronic
1032122206 7:129165102-129165124 ATGGATACAGAGTTTCATCTGGG - Intronic
1032496020 7:132363305-132363327 ATGGATTCAGAGTTGCAGTTTGG - Intronic
1032518535 7:132525032-132525054 ATGGGTACAGGGTTTCAGTTTGG - Intronic
1032519295 7:132531095-132531117 ATGGCAACAGAGTTTCAGTTGGG + Intronic
1032596747 7:133248659-133248681 ATGGATACAGAGTTTCATTTTGG - Intergenic
1032680807 7:134180857-134180879 ATGGGTACAGAGTTTCTGTTTGG - Intronic
1032887147 7:136152873-136152895 GTGGATATAGAGTTTCAGTTAGG + Intergenic
1033349517 7:140550763-140550785 ATGGGTACAGAGTTTCTGTTGGG + Intronic
1033432572 7:141302522-141302544 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1034146517 7:148878232-148878254 ATGAATACAGAGTTTCTGTTTGG - Intronic
1034475396 7:151278640-151278662 ATGGATACAGAGCTCCAGTTTGG - Intergenic
1034527165 7:151672497-151672519 ACGGAGACAGAGTTTCAGTTTGG - Intronic
1034680985 7:152927151-152927173 AAGAATACAGAATTTCAGTTAGG + Intergenic
1035109058 7:156465047-156465069 ATGGGGACAGAGTTTCAGTTTGG + Intergenic
1035205344 7:157290868-157290890 ATGGGGACAGAGATTCAGCTTGG + Intergenic
1035440763 7:158896772-158896794 ATGTATACAAAGAATCACATAGG - Intronic
1035540179 8:428660-428682 ATGGGGACAGAGTTTCAGTTTGG - Intronic
1036461383 8:8956255-8956277 ATGAGTGCAGAGTTTCAGTTTGG - Intergenic
1036654261 8:10666049-10666071 ATGCATACAGAGTTTCAGTTTGG + Intronic
1036705995 8:11047647-11047669 ATGGAGACAGAGCTTCAGTTTGG + Intronic
1036729872 8:11253311-11253333 ATGAAAACAGAGTTTTAGTTTGG + Intergenic
1036769543 8:11569575-11569597 ATGGAGACAGAGTTTCAGTTTGG - Intergenic
1036772827 8:11590865-11590887 ATGGGTACAGAATTTCAGTTAGG + Intergenic
1036791465 8:11723935-11723957 ATGGGTACAGAGTTTCACTTGGG - Intronic
1036821806 8:11946071-11946093 ATGGGCACAGAGTTTCAGTTTGG + Intergenic
1038100031 8:24362895-24362917 ATGGATATAGAGTTTCTGTTTGG - Intergenic
1038155549 8:24985983-24986005 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
1038230845 8:25698124-25698146 ATGAGTACAGAGTTTCAGTTTGG + Intergenic
1038312938 8:26458987-26459009 ATGTTTACAGAGCTTTAGTTTGG + Intronic
1038444019 8:27590781-27590803 ATGGGTACAGAGCTTCAGTTAGG + Intergenic
1038763173 8:30403629-30403651 GTGTATACACAGATTTAGCTAGG - Intronic
1038946044 8:32361389-32361411 ATGCATACAGGGCTTCTGTTTGG - Intronic
1039109411 8:34025312-34025334 ATGGACAAAGAGATCCAGTTTGG - Intergenic
1039294557 8:36135782-36135804 ATGGATATAGAGTTTCAGTTTGG + Intergenic
1039677946 8:39690652-39690674 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1039953995 8:42193515-42193537 ATGGCTACAGAGTTTCAGTTAGG - Intronic
1040525191 8:48216605-48216627 ATGGGCACAGAGAGTCAGTTTGG + Intergenic
1040727834 8:50404770-50404792 ATGCGTACAGAGTTTCAGTATGG - Intronic
1040740392 8:50567952-50567974 ATGAATACAGAGATACAGGAAGG - Intronic
1040856188 8:51950449-51950471 ATGAGTCCAGAGTTTCAGTTTGG + Intergenic
1041093782 8:54329197-54329219 ATGGGTACAGAGAGTCAGCTTGG - Intergenic
1041206294 8:55501417-55501439 ATGGGTACAGAATTTCAGTTTGG - Intronic
1041339325 8:56825580-56825602 CTGGGTACAGAGTTTCAGTTTGG + Intergenic
1041666336 8:60448501-60448523 AGGAATACAGAGAGGCAGTTTGG - Intergenic
1041687564 8:60658329-60658351 ATGGGTACAAAGTTTCAGTTTGG + Intergenic
1041815979 8:61971671-61971693 AAGTGTAATGAGATTCAGTTAGG + Intergenic
1041855322 8:62446580-62446602 ATGGACATAGAGTTTCAGTTTGG - Intronic
1042118340 8:65457039-65457061 ATGGGTTCAGAGTTTCAGTTTGG + Intergenic
1042262065 8:66869915-66869937 ATGTGTATGGAGTTTCAGTTTGG + Intergenic
1042285867 8:67109559-67109581 AATTATACAGGGATTCAGCTGGG + Intronic
1042665785 8:71203955-71203977 TTGTATTCAGACATTCAGATGGG + Intronic
1042952235 8:74212788-74212810 ATGGGTACAAAGCTTCAGTTTGG - Intergenic
1043404105 8:79913318-79913340 ATGGATACAGAGTTTCAGTTTGG + Intergenic
1043865793 8:85373954-85373976 ATGAATATGGAGTTTCAGTTTGG + Intronic
1044648082 8:94466032-94466054 ATGGGTACAGAGTTTCTGTTTGG + Intronic
1044661822 8:94599091-94599113 ATGGGTACAGAGTTTCTGTTTGG - Intergenic
1044667384 8:94643539-94643561 ATGAGTACAGAATTTCAGTTTGG + Intronic
1045014013 8:97983011-97983033 ATGGGTACAGCGTTTCAGTTTGG - Intronic
1045119446 8:99019600-99019622 ATGGATACAGAATTTCAGTTTGG - Intronic
1045157609 8:99494267-99494289 ACGGATACAGAATTTCAGTTGGG - Intronic
1045246545 8:100446252-100446274 ATGGTTACAGAGATTCTGTTTGG - Intergenic
1045485088 8:102624849-102624871 ATAGATACAGAGTTTCAGTTTGG - Intergenic
1045622822 8:104002624-104002646 ATGTATTAATAGCTTCAGTTGGG + Intronic
1046121726 8:109855904-109855926 AGGTATACATTGGTTCAGTTTGG - Intergenic
1046662504 8:116963401-116963423 ATGGATACAGCGTTTCATTTGGG - Intronic
1046873851 8:119231943-119231965 AAGGATACAGAATTTCAGTTAGG + Intronic
1047244037 8:123122559-123122581 ATGGATACAGAGTTTCTATTTGG + Intronic
1047297073 8:123580535-123580557 ATGTAAACAGGGCTTCTGTTGGG - Intergenic
1047742098 8:127814798-127814820 ATGAGTGCAGAGTTTCAGTTTGG - Intergenic
1049067362 8:140327782-140327804 ATGCGTACAGAGATTCTGTTTGG + Intronic
1049916582 9:323625-323647 ACGGGTACAGAGTTTCAGTTTGG - Intronic
1049986481 9:956297-956319 ATGGGTACAGAATTTCAGTTTGG + Intronic
1050256023 9:3793017-3793039 ATGGATACAGAGTTTCAGGTGGG + Intergenic
1051071457 9:13173142-13173164 ATGGATACAGCGTTTCAATTGGG + Intronic
1051330106 9:16015741-16015763 ATAGGTACAGAGTTTCAGTTGGG - Intronic
1051376068 9:16404231-16404253 ATGGGTACAGAGTTTCATTTGGG + Intergenic
1051566316 9:18503167-18503189 ATGGATGCAGAATTTCAGTTAGG - Intronic
1052816418 9:33105583-33105605 ATGAGTACAGAGTTTTAGTTGGG - Intronic
1052846573 9:33341447-33341469 ATATATACACTGATACAGTTTGG - Intronic
1053030729 9:34775412-34775434 ATGTGTACAGCGTTCCAGTTGGG + Intergenic
1053317360 9:37063337-37063359 CTGGGTACAGAGTTTCAGTTTGG + Intergenic
1053420801 9:37976443-37976465 ATGGGTACAGGGTTTCAGTTTGG - Intronic
1053704669 9:40738712-40738734 ATGAGTACAGAGTTTCAGTTTGG + Intergenic
1054414749 9:64862319-64862341 ATGAGTACAGAGTTTCAGTTTGG + Intergenic
1054948435 9:70822576-70822598 ATGAGTACAGAGTTACAGTTTGG + Intronic
1055245598 9:74238878-74238900 ATGGGTACAAAGTTTCAGTTTGG + Intergenic
1055356204 9:75439405-75439427 ATGGGTGCAGAGTTTCAGTTTGG + Intergenic
1055362318 9:75506111-75506133 CTGGATATAGAGCTTCAGTTTGG - Intergenic
1055536557 9:77252604-77252626 TTGAGTACAGAGTTTCAGTTTGG - Intronic
1055637443 9:78292899-78292921 ATGTGTACAGAGTTTCAGTGTGG + Intergenic
1056083719 9:83123926-83123948 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
1056409974 9:86315815-86315837 AAGTATACAGAAATTGGGTTAGG - Intronic
1056538692 9:87553008-87553030 ATGGATACACAGTTTCAGCTTGG - Intronic
1056647215 9:88424112-88424134 ATGTATACAGAGAAAAAGTATGG + Intronic
1056837244 9:89966460-89966482 ATGGATACATAGTTTCTGTTTGG + Intergenic
1057149121 9:92780607-92780629 ATTTATACAGAGCTTGAGTTGGG - Intergenic
1057203311 9:93155405-93155427 ATGGGGACAGAGTTTCAGTTTGG - Intergenic
1057539507 9:95953099-95953121 ATGAGTACAGAGTTTCAGTTTGG + Intronic
1057673425 9:97116508-97116530 ATGGATACAGAATTTCAGTTTGG + Intergenic
1058558338 9:106195761-106195783 TTGTACAGAGAGATTCTGTTTGG - Intergenic
1058592014 9:106575397-106575419 ATCAGTACAGAGTTTCAGTTTGG + Intergenic
1058677365 9:107411872-107411894 ATGGGTACAGAGTATCAGTTGGG + Intergenic
1058846284 9:108962878-108962900 AAGCATAGAGAGATTAAGTTAGG + Intronic
1058905485 9:109479151-109479173 ATGGGTACAGAGTTTCTGTTTGG - Intronic
1058957833 9:109965602-109965624 ATGGGTACAGAATTTCAGTTTGG + Intronic
1058970989 9:110082819-110082841 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1059109910 9:111546802-111546824 AGGAGTACAGAGTTTCAGTTTGG - Intronic
1059182053 9:112225433-112225455 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1059794341 9:117675714-117675736 ATATATACAGTGATATAGTTTGG + Intergenic
1060099035 9:120821627-120821649 ATGGATACAGAGTTTCAGTTTGG - Intronic
1060257543 9:122045920-122045942 ATGGGTACAGAGTGTCAGTTTGG + Intronic
1060298440 9:122359313-122359335 ATGAATGCAAAGTTTCAGTTAGG - Intergenic
1060430680 9:123548936-123548958 CTGGATACAGAGGTTCTGTTGGG + Intronic
1060917551 9:127400064-127400086 GTGTAAACAGAGGTTCAGTGAGG + Intronic
1061503356 9:131016276-131016298 ATGGGGACAGAGTTTCAGTTTGG + Intronic
1061560749 9:131401301-131401323 ATGGGAACAGAGTTTCAGTTTGG - Intronic
1061782870 9:133006080-133006102 ATGGGTACAGAGCTTCAGTTTGG + Intergenic
1062383993 9:136301443-136301465 ATGGGGACAGAGCTTCAGTTTGG + Intronic
1062473369 9:136715925-136715947 ATGCAGACAGAGCTTCAGTTTGG - Intronic
1062667676 9:137685220-137685242 ATGGATACAGAGTTTCTGCTTGG - Intronic
1062674955 9:137736905-137736927 ATATATACAGAGATTTGGCTGGG + Intronic
1062728521 9:138094287-138094309 ATGGATACAGAGTTTCAGTTTGG + Intronic
1062742202 9:138182120-138182142 GTGGATACAGAGTTTCACTTTGG - Intergenic
1185857849 X:3552452-3552474 ATATATACATAGACACAGTTAGG + Intergenic
1185871135 X:3665874-3665896 ATGAGGACAGAGTTTCAGTTGGG + Intronic
1185925450 X:4140823-4140845 ATGAGGACAGAGTTTCAGTTTGG - Intergenic
1186031449 X:5373570-5373592 ATGGATACAGAGTTTCAGCTGGG - Intergenic
1186541092 X:10401145-10401167 ATGAATACAGAGTTTCAGTTTGG - Intergenic
1186754144 X:12652487-12652509 ATGGGTACAGAGTTTCTGTTTGG - Intronic
1187557073 X:20362316-20362338 ATGGGTACAGAGTTTCTGTTTGG - Intergenic
1187671274 X:21668134-21668156 ATGGATACAGAGTTTCTGTTTGG - Intergenic
1187867794 X:23739887-23739909 ATGAATACAGAGAAACACTTGGG + Intronic
1188225265 X:27589950-27589972 ATTTTTACAGTGATTCAGTCTGG - Intergenic
1188308044 X:28582767-28582789 ATGTACACAGTGTTTCATTTGGG + Intergenic
1188435842 X:30157596-30157618 ATGGGTACAGAATTTCAGTTTGG + Intergenic
1188511441 X:30940577-30940599 ATGGGTACAGAGTTTCTGTTTGG - Intronic
1188726353 X:33588339-33588361 CTGAATACATAGATTAAGTTTGG + Intergenic
1188868085 X:35339523-35339545 ATAGGTACAGAGATTCAGTTTGG + Intergenic
1189015755 X:37094868-37094890 GTGTATACACAGATTTAGCTAGG - Intergenic
1189393600 X:40600117-40600139 AGGAGTACAGAGTTTCAGTTGGG - Intronic
1189418984 X:40839333-40839355 ACGGATACAGAGTTTCAATTTGG - Intergenic
1189504766 X:41601125-41601147 ATGGGTACAGACATTTAGTTGGG + Intronic
1189815996 X:44824441-44824463 ATGGGGACAGAGTTTCAGTTTGG + Intergenic
1189938523 X:46095820-46095842 ATGAGTACAGAGATTCATTACGG + Intergenic
1190001921 X:46697197-46697219 AAGGATACAAAGTTTCAGTTAGG + Intronic
1190294800 X:49019724-49019746 ATGGGTACAGAGTTTCTGTTTGG - Intergenic
1190372932 X:49760468-49760490 ATGGATACAGAGTTTCTTTTAGG - Intergenic
1191854279 X:65610220-65610242 ATGGTTACAGAGTTTCCGTTTGG - Intronic
1192268073 X:69554030-69554052 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1192288814 X:69769221-69769243 AAGTAGACAGAAAATCAGTTAGG - Intronic
1192331710 X:70180660-70180682 ATGGATACAGAGTTTCAGTTTGG - Intronic
1192378537 X:70589045-70589067 ATGGATACAGAGTTTCTGTTTGG + Intronic
1192413608 X:70957153-70957175 ATGGATACAAAGTTTCAGTTGGG + Intergenic
1192572309 X:72216535-72216557 ATGGGTACAGAGTTTCTGTTTGG - Intronic
1192801731 X:74471772-74471794 ATAGACACAGAGTTTCAGTTTGG - Intronic
1193108879 X:77707237-77707259 ATGGGTACAGAGTTTCACTTGGG + Intronic
1193131015 X:77919889-77919911 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1193132899 X:77936535-77936557 ATGGGTATAGAGTTTCAGTTTGG - Intronic
1193183028 X:78481109-78481131 ATGAATACAGAGTTTCTGTTTGG + Intergenic
1193220113 X:78914175-78914197 ATGGATACAGAATTTCAGTTTGG - Intergenic
1193242517 X:79187820-79187842 ATGGATACAAAGTTTCAGTTTGG - Intergenic
1193571038 X:83143770-83143792 ATGGGTACAGAGTTTCTGTTTGG + Intergenic
1193730960 X:85102330-85102352 ATGATTACAGAGTTTCAGCTGGG + Intronic
1195635607 X:107111901-107111923 ATAAGTACAGAGTTTCAGTTTGG + Intronic
1195677588 X:107519097-107519119 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1195927653 X:110042153-110042175 ATGTGTACAGAGCTGCTGTTTGG - Intronic
1195946451 X:110218494-110218516 ATGGGTGCAGAGTTTCAGTTTGG - Intronic
1195972165 X:110484802-110484824 ATGGCTACAGAATTTCAGTTTGG - Intergenic
1195997822 X:110748831-110748853 ATGGGTATAGAGATTCAGTTTGG + Intronic
1196136361 X:112213755-112213777 ATTGGTACAGAGTTTCAGTTTGG - Intergenic
1196211422 X:112999924-112999946 ATGGGTACAGAGATTCAGTTTGG - Intergenic
1196507545 X:116465245-116465267 ATAAATATAGAGTTTCAGTTGGG - Intergenic
1196548335 X:116992122-116992144 ATGGATACAGAGTTTCTTTTTGG - Intergenic
1197021867 X:121700281-121700303 ATGGGTACAAAGATACAGTTAGG - Intergenic
1197185701 X:123584759-123584781 ATGAATACAGAGTTTTACTTTGG + Intergenic
1197230333 X:123997424-123997446 ATGGGTCCAGAGTTTCAGTTTGG - Intronic
1197663607 X:129199714-129199736 ATGTGTACAGAGTTTTAGTTGGG + Intergenic
1197711040 X:129667841-129667863 ATGGGTACAGTGTTTCAGTTTGG - Intergenic
1198231055 X:134689984-134690006 ATGAAGACAGAGTTTCAGTTGGG - Intronic
1198327740 X:135590856-135590878 ATGGATACAGAGTTTCCTTTTGG + Intergenic
1198590517 X:138175317-138175339 ATGGGTGCAGAGTTTCAGTTTGG + Intergenic
1198835189 X:140796942-140796964 ATGTATGCAGTGATATAGTTTGG - Intergenic
1198931065 X:141860823-141860845 ATGGATAAAGAGTGTCAGTTTGG + Intronic
1198992807 X:142535572-142535594 ATGGGCACAGAGCTTCAGTTTGG - Intergenic
1199268501 X:145855772-145855794 ATGAGTACAGAGATTCAGTTTGG + Intergenic
1199287879 X:146074096-146074118 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
1199387390 X:147238746-147238768 ATGGTTACAGAGGTTTAGTTTGG + Intergenic
1199440446 X:147862077-147862099 ATGGGTACAGAGTTTCAGTTGGG + Intergenic
1200289009 X:154854038-154854060 ATGAGTACAGAGTTTCTGTTTGG - Intronic
1200456060 Y:3394809-3394831 ATGGGTAGAGAGTTTCAGTTTGG + Intergenic
1200657344 Y:5919286-5919308 ATGAATACAAAAATACAGTTAGG + Intergenic
1200792919 Y:7315408-7315430 ATGAGGACAGAGTTTCAGTTGGG - Intergenic
1201335609 Y:12877930-12877952 ATGTGTACAGAGTTTCAGTTTGG + Intergenic
1202298601 Y:23386519-23386541 ATGGATACAGAGTTTCAGTTTGG - Intergenic
1202572207 Y:26284080-26284102 ATGGATACAGAGTTTCAGTTTGG + Intergenic