ID: 908225610

View in Genome Browser
Species Human (GRCh38)
Location 1:62053090-62053112
Sequence GCTTACTTGGGAACTGGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 213}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908225610_908225621 27 Left 908225610 1:62053090-62053112 CCACTCCCAGTTCCCAAGTAAGC 0: 1
1: 0
2: 0
3: 24
4: 213
Right 908225621 1:62053140-62053162 AAGACAGTTGAAGAGGCAGAGGG No data
908225610_908225616 -7 Left 908225610 1:62053090-62053112 CCACTCCCAGTTCCCAAGTAAGC 0: 1
1: 0
2: 0
3: 24
4: 213
Right 908225616 1:62053106-62053128 AGTAAGCAACACCAGTGACAGGG 0: 1
1: 0
2: 1
3: 11
4: 162
908225610_908225617 0 Left 908225610 1:62053090-62053112 CCACTCCCAGTTCCCAAGTAAGC 0: 1
1: 0
2: 0
3: 24
4: 213
Right 908225617 1:62053113-62053135 AACACCAGTGACAGGGCTGCAGG 0: 1
1: 0
2: 1
3: 18
4: 187
908225610_908225620 26 Left 908225610 1:62053090-62053112 CCACTCCCAGTTCCCAAGTAAGC 0: 1
1: 0
2: 0
3: 24
4: 213
Right 908225620 1:62053139-62053161 CAAGACAGTTGAAGAGGCAGAGG No data
908225610_908225619 20 Left 908225610 1:62053090-62053112 CCACTCCCAGTTCCCAAGTAAGC 0: 1
1: 0
2: 0
3: 24
4: 213
Right 908225619 1:62053133-62053155 AGGTGTCAAGACAGTTGAAGAGG No data
908225610_908225615 -8 Left 908225610 1:62053090-62053112 CCACTCCCAGTTCCCAAGTAAGC 0: 1
1: 0
2: 0
3: 24
4: 213
Right 908225615 1:62053105-62053127 AAGTAAGCAACACCAGTGACAGG 0: 1
1: 0
2: 0
3: 17
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908225610 Original CRISPR GCTTACTTGGGAACTGGGAG TGG (reversed) Intronic
900436626 1:2634115-2634137 CCTTTCTGGGGAGCTGGGAGTGG + Intergenic
903265685 1:22156635-22156657 GGTGACTTGGGACCTGGGTGGGG + Intergenic
904619345 1:31766026-31766048 CCTTACATGGGCACTGGGAGGGG + Intergenic
906366243 1:45212427-45212449 GCTTAATAGGGAACATGGAGAGG + Intronic
908225610 1:62053090-62053112 GCTTACTTGGGAACTGGGAGTGG - Intronic
912748609 1:112266931-112266953 GCTTAGTGGGAAACTGGGAAAGG + Intergenic
917678529 1:177342505-177342527 GCTGACTTGGCCACTGAGAGTGG - Intergenic
918072238 1:181141559-181141581 GCTGCCTTGAGTACTGGGAGAGG + Intergenic
918236799 1:182589052-182589074 GAGGACTTGGGAAGTGGGAGGGG - Intronic
919043780 1:192425251-192425273 GCTTGCTTAGGAACTGTCAGTGG - Intergenic
920504029 1:206504105-206504127 TCTTACTAGGGAACTTGGGGAGG + Intergenic
921068831 1:211642478-211642500 GCTTCCTTGGGAACAGGGGGAGG + Intergenic
921932576 1:220766780-220766802 GCTTTCTTGGGCAGTGAGAGTGG + Intronic
923374008 1:233341719-233341741 CCTTACTTGGGGTCTGGGTGTGG + Intronic
923739862 1:236645429-236645451 GCTTACCTGGCAACGGGAAGAGG + Intergenic
923874668 1:238034601-238034623 GTTTGCTTGGGAGCTGGGTGAGG + Intergenic
924797552 1:247302959-247302981 TCTTACTTGTTAACTGGGCGAGG + Intronic
1063478987 10:6354652-6354674 GAATGCTTGGGAACTGGGACTGG + Intergenic
1063865406 10:10359528-10359550 TCTTTTTTGGGAACAGGGAGGGG + Intergenic
1063917810 10:10902580-10902602 GGTTACTTGGGGACAGGGAAGGG + Intergenic
1066037476 10:31508276-31508298 GCTTGCTTGGGTGCTGGTAGTGG + Intronic
1066056388 10:31685023-31685045 GCATACTTGGAAACTTTGAGGGG + Intergenic
1066557759 10:36633951-36633973 GCTTACATGGAAACTGCTAGAGG - Intergenic
1067364742 10:45615250-45615272 GCTAACTTAGGAGCTGTGAGGGG - Intergenic
1068096643 10:52499584-52499606 GATTGCGTGGGAACTGGGTGAGG - Intergenic
1068480759 10:57585619-57585641 GTTTGCATGGGAACTGGGTGAGG + Intergenic
1069220557 10:65878093-65878115 TCTTTGTTGGGAAATGGGAGAGG - Intergenic
1069229795 10:65995630-65995652 GCTTTCTTGGGTTCTGGCAGTGG + Intronic
1069347316 10:67485298-67485320 GCTTTCTTGGGGACTAGTAGAGG + Intronic
1069875680 10:71561649-71561671 GCTTAAATGGGAACTGGAAGAGG + Intronic
1070548220 10:77469559-77469581 GCTGACTGAGAAACTGGGAGTGG + Intronic
1073288065 10:102400205-102400227 GCCTACTGGGGAGGTGGGAGGGG + Intronic
1073492289 10:103860848-103860870 GCTAGCTTGGAAACGGGGAGGGG + Intergenic
1074885225 10:117688171-117688193 GCTAACTCAGGAAATGGGAGAGG + Intergenic
1076067834 10:127463394-127463416 GCTTTGGAGGGAACTGGGAGTGG - Intergenic
1077155813 11:1090345-1090367 GCTATCGTGGAAACTGGGAGTGG + Intergenic
1077845004 11:6013996-6014018 GCTTGTTTGGGTACTGGTAGTGG - Intergenic
1078756331 11:14214325-14214347 TCTTACTTGGGGCCAGGGAGTGG - Intronic
1080534457 11:33207902-33207924 GCTTAGTTGGGATATGGGAGGGG - Intergenic
1081382688 11:42435074-42435096 CCTCACTTGGGAAGTGCGAGGGG - Intergenic
1082112481 11:48292630-48292652 CCTCACTTGGGAAGTGGAAGGGG + Intergenic
1082567701 11:54700460-54700482 GTTTGCATGGGAACTGGGTGAGG - Intergenic
1082609222 11:55279221-55279243 GGATACTTTGGAACTGAGAGTGG - Intergenic
1089202768 11:116734479-116734501 GCTTTCTTGGAAACAGGGTGGGG - Intergenic
1089395998 11:118136577-118136599 GCTTCCTTTGGAGGTGGGAGTGG - Exonic
1092659324 12:10722403-10722425 CCTTGCTTGGGATCTGGGAAAGG - Intronic
1093502982 12:19833587-19833609 ATTTCCTTGGGAACTGGGAAAGG + Intergenic
1096418930 12:51439417-51439439 GCTTAGTTTGGAAGTCGGAGTGG + Intronic
1096620589 12:52862235-52862257 GCTGACTCAGGAGCTGGGAGAGG - Intergenic
1097316079 12:58172874-58172896 GCTGACTTGAGAACTGGCAGAGG - Intergenic
1097580467 12:61449581-61449603 GTTTACTTGGGAGCTGAGGGAGG + Intergenic
1098314839 12:69182274-69182296 GCCTACTTGGGCTTTGGGAGTGG - Intergenic
1101090956 12:101284768-101284790 GCTTCCTTGGGAATTAGGGGTGG - Intronic
1105209843 13:18251209-18251231 GCTTACTTGAGATTAGGGAGTGG - Intergenic
1105646024 13:22318389-22318411 TCTTAATTGGAAAGTGGGAGAGG - Intergenic
1106938170 13:34747370-34747392 GCTTGCATGGGAGCTGGGTGAGG - Intergenic
1106961219 13:35000315-35000337 ATTTACATGGGAATTGGGAGAGG + Intronic
1108817073 13:54305243-54305265 GTTTACATGGGAGCTGGGTGAGG + Intergenic
1110204437 13:72895965-72895987 GTTTTCGTGGGAACTGGGTGAGG + Intronic
1110475941 13:75913549-75913571 GCATTCTTGGGGACTGGGAAAGG + Intergenic
1114325001 14:21580011-21580033 GCTTCCTTATGAACTGGGGGAGG + Intergenic
1116686065 14:48040342-48040364 GCTTACTTGGTTACTGGCAGTGG + Intergenic
1117874188 14:60234407-60234429 GCATACCATGGAACTGGGAGAGG + Intergenic
1119134147 14:72201651-72201673 GTTTATTTGGGAAGTGGGATTGG - Intronic
1121633750 14:95439876-95439898 GCTTCTTTGGGAAGTGGGTGAGG + Intronic
1121983694 14:98478006-98478028 GATTCCTTGGGAATTGGTAGGGG - Intergenic
1124493771 15:30174094-30174116 CCGTACTTGGGTAATGGGAGGGG + Intergenic
1127410201 15:58697717-58697739 GCTTACTTGGGTGTTGGTAGGGG - Intronic
1127947331 15:63768503-63768525 GCTAACTAGGGAATTTGGAGAGG - Intronic
1128736642 15:70057417-70057439 CCTTTCTTGGGGACTGGGCGTGG - Intronic
1129700294 15:77763812-77763834 GCTGCCTGGGGAAGTGGGAGGGG - Intronic
1129756828 15:78103800-78103822 GCTTATCTGGGAAATGGGGGTGG - Exonic
1131014826 15:89049703-89049725 CCTTACTTGGGAAGTGCAAGGGG - Intergenic
1131145367 15:90007809-90007831 GCTTACTTGTAAAGTGGGGGTGG - Intronic
1131189376 15:90301483-90301505 CATTACTAGGGTACTGGGAGCGG - Intronic
1131326867 15:91456318-91456340 GCTTGCATGGGAGCTGGGTGAGG - Intergenic
1132558412 16:582730-582752 GCCTCCTTGGGAACTGGGACTGG + Intronic
1134097584 16:11428918-11428940 TCTTGCATGGGAAATGGGAGGGG + Intronic
1135891317 16:26359845-26359867 GCTTCCAAGGGAACTGGGTGAGG - Intergenic
1138074684 16:54030065-54030087 TCTCACTTGAGAACTGGGAGAGG - Intronic
1139244806 16:65431362-65431384 GCTGACTTGGGAACTGGGCAGGG - Intergenic
1139523170 16:67496984-67497006 GCTTACTAGGAACCTGGGGGTGG + Intergenic
1140506765 16:75478504-75478526 GCCTACTTGGGGAGGGGGAGGGG + Exonic
1141891234 16:86928034-86928056 GCTTATGGGGGAACAGGGAGGGG + Intergenic
1143432091 17:6894818-6894840 GGTTTCTTGGGATCTGGTAGGGG - Intronic
1143473302 17:7189852-7189874 GGTTATTTGGGACCTGGGTGTGG - Intergenic
1146161674 17:30563159-30563181 GCTACCGTGGGAAGTGGGAGGGG - Intronic
1147546453 17:41405776-41405798 GCTTACTGGGGAGCTTGGACGGG + Intergenic
1147742233 17:42675997-42676019 CCGCACTTGCGAACTGGGAGCGG + Intronic
1148159312 17:45441149-45441171 GTTTACATGGGTACTGGGGGTGG + Intronic
1148681707 17:49477840-49477862 GCTGTCAGGGGAACTGGGAGGGG + Intergenic
1150191605 17:63246483-63246505 GGTTGCCTGGGAACTGGGAGAGG - Intronic
1150390649 17:64788233-64788255 GTTTACATGGGTACTGGGGGTGG + Intergenic
1152104767 17:78322594-78322616 GCTTGCTTGGGAACTGACGGGGG + Intergenic
1153524691 18:5983750-5983772 GGCTATTTGGGAAGTGGGAGGGG - Intronic
1153965161 18:10173753-10173775 GATTACTTGGAAACAGGGTGGGG - Intergenic
1156667474 18:39425426-39425448 GGTTGCATGGGAACTGGGTGAGG + Intergenic
1156793808 18:41014969-41014991 GCTGACTTGGGGGCTGGGAGTGG + Intergenic
1157433129 18:47646502-47646524 GCTTCCTTTGCATCTGGGAGTGG - Intergenic
1161115729 19:2495558-2495580 CCTGACCCGGGAACTGGGAGGGG - Intergenic
1166120312 19:40682542-40682564 GATTATTTGGGAACTGGCATAGG - Intronic
1166347372 19:42175154-42175176 GCTCACTGGGGCTCTGGGAGGGG - Intronic
1166866004 19:45837841-45837863 TCTGGTTTGGGAACTGGGAGGGG + Intronic
925838513 2:7968723-7968745 GCTTACTTGGGAAGTGGTGCTGG - Intergenic
926828553 2:16934604-16934626 GCTTACTTGGGAGGGGGGAATGG + Intergenic
926916025 2:17893219-17893241 GTTTGCATGGGAACTGGGTGAGG - Intronic
927743700 2:25595885-25595907 TCTTACGGGGGAACTGGGGGTGG - Intronic
928052448 2:28013360-28013382 GCTTACCTAGCAACTGGGTGAGG + Intronic
928067057 2:28175420-28175442 GCATGCTTGGGTACTGGGAGGGG - Intronic
929812335 2:45201057-45201079 GCATGCTTGGGCACTGAGAGGGG - Intergenic
929902227 2:46015153-46015175 GGGAACCTGGGAACTGGGAGAGG - Intronic
932022722 2:68104042-68104064 GATTACTTGTGAGGTGGGAGTGG + Intronic
934557764 2:95296459-95296481 CCTGACTTGGGAGCTGGGAGGGG + Intergenic
934650616 2:96089475-96089497 ACTTACCTGGGCACTGGCAGTGG + Intergenic
941674521 2:168329249-168329271 GCTTACTTGGATGCTGGTAGTGG - Intergenic
945678929 2:212889520-212889542 GATTACTGGGGAAGTGAGAGAGG - Intergenic
946782482 2:223205644-223205666 GCACACTTGGGCACTGGCAGTGG - Intergenic
947616128 2:231557899-231557921 GCTGACTTGGGAACTCGGGCTGG - Intergenic
948032900 2:234834116-234834138 TCCTACCTGGGAACTTGGAGAGG + Intergenic
948263395 2:236620893-236620915 GCTTATTTGGGAGGTGGGAAAGG + Intergenic
1170192257 20:13655965-13655987 GCTAACTTTGAAAATGGGAGAGG + Intergenic
1171290999 20:23982896-23982918 GCTTACTTGAGATTAGGGAGTGG - Intergenic
1172331390 20:34078316-34078338 GCTGGCTTGGGAACTTGGAAGGG - Intronic
1174199785 20:48799314-48799336 TCTCACTTGGGGACTGTGAGGGG - Intronic
1174798139 20:53539736-53539758 GCATACTTGGCACCTAGGAGGGG - Intergenic
1177730666 21:25024300-25024322 GCTTGCTTGGGTACTAGTAGTGG + Intergenic
1178894975 21:36550633-36550655 CCTAAGATGGGAACTGGGAGGGG - Intronic
1179324911 21:40333026-40333048 GCTTCCTTGGGAAGTGGAAGTGG - Intronic
1179672845 21:42961824-42961846 GCTGACTTGGTTCCTGGGAGGGG + Intergenic
1179951935 21:44713143-44713165 GCTCACTTGGGTGCTGGAAGAGG - Intergenic
1180766417 22:18348191-18348213 GCTTACTTGAGATTAGGGAGTGG + Intergenic
1180779898 22:18514187-18514209 GCTTACTTGAGATTAGGGAGTGG - Intergenic
1180812612 22:18771508-18771530 GCTTACTTGAGATTAGGGAGTGG - Intergenic
1181006779 22:20017176-20017198 GGATACCTGTGAACTGGGAGTGG - Intronic
1181198771 22:21205756-21205778 GCTTACTTGAGATTAGGGAGTGG - Intergenic
1181400966 22:22650043-22650065 GCTTACTTGAGATTAGGGAGTGG + Intergenic
1181534856 22:23536316-23536338 GCTTACTTGAGATTAGGGAGTGG - Intergenic
1181579004 22:23816615-23816637 GCCTTCCTGGAAACTGGGAGTGG - Intronic
1181702945 22:24631135-24631157 GCTTACTTGAGATTAGGGAGTGG + Intergenic
1182718184 22:32376705-32376727 CCTTACCTGGGAAGTGAGAGAGG - Intronic
1183302596 22:37065634-37065656 TCTAACTTGGGATCTGGGAATGG - Exonic
1183778659 22:39984620-39984642 ATCTACTTGGGAGCTGGGAGAGG + Intergenic
1184143717 22:42595799-42595821 GCGTATTTGGGAGATGGGAGAGG - Intronic
1203228034 22_KI270731v1_random:89081-89103 GCTTACTTGAGATTAGGGAGTGG + Intergenic
950179233 3:10899457-10899479 TCCTACTTGGGAACTTTGAGTGG + Intronic
950689040 3:14641186-14641208 AGATACTTGGGAACTGGGAAGGG - Intergenic
951155207 3:19344137-19344159 GCTGACTTGGTAACTGAAAGGGG - Intronic
953667228 3:44934087-44934109 GCTTCCTTGGGCACTGCCAGGGG + Intronic
954036199 3:47852570-47852592 GCTAAGTTGGGATCTAGGAGAGG - Exonic
956380255 3:68657438-68657460 GGTAACCTGGGCACTGGGAGAGG + Intergenic
959449664 3:106483313-106483335 GGTTTCTTGTGAAATGGGAGAGG - Intergenic
962377806 3:134873347-134873369 TCTTACTTGGGGAATGGGTGGGG - Intronic
963826082 3:149955468-149955490 GATTTCTTGGGAACTGGTACAGG + Intronic
963829746 3:149993554-149993576 GCTTACTTGGGAGCCAGTAGTGG - Intronic
963999606 3:151753964-151753986 GGGCACTTGGGAAATGGGAGAGG + Intronic
967493318 3:190117736-190117758 GCTTTCTTGGGGGCTGGGGGAGG + Intronic
967844169 3:194031346-194031368 GCTTTCTTGGGTAGGGGGAGTGG + Intergenic
968423508 4:505064-505086 TCTTAATTGGGACCTGGCAGAGG + Intronic
971273812 4:25176299-25176321 GTTTTCTTGGGAACTTTGAGTGG + Intronic
972198934 4:36689291-36689313 GTTTCCTTGGGAACTGGAAGAGG - Intergenic
972607931 4:40630717-40630739 GGTTTCTTGGGAATTGGGATGGG - Intronic
972856412 4:43113293-43113315 GCTTACCTGTGAGCTGGGGGCGG + Intergenic
978726715 4:111977760-111977782 GTTTACTTTGGAGCTGGGTGAGG - Intergenic
978930606 4:114306797-114306819 GGTTACCTGGTTACTGGGAGAGG - Intergenic
979856919 4:125644952-125644974 GCTTACTTGGAAAAAAGGAGAGG - Intergenic
980195095 4:129578260-129578282 GATTGCATGGGAACTGGGTGAGG - Intergenic
981111722 4:140942477-140942499 TCTTATTTGGGAACAGGGGGAGG - Intronic
983070750 4:163265112-163265134 GCTGACTTGGGAATTTAGAGAGG - Intergenic
984361674 4:178742661-178742683 GGTTGCATGGGAGCTGGGAGAGG - Intergenic
990550987 5:56878255-56878277 GCTCTCTTGGGCACAGGGAGGGG + Intronic
990553560 5:56908821-56908843 GGTTGCTTGGGGACTGGGGGAGG + Intergenic
990884470 5:60575899-60575921 CCTTACTTGGGAAGTGGAAGGGG - Intergenic
991167562 5:63581985-63582007 CCTTACTCGGGAACTGCAAGGGG + Intergenic
993964749 5:94346999-94347021 GTTTATTTGGGAGCTGGGTGAGG + Intronic
994687075 5:102969041-102969063 GAACACTTGGGAACAGGGAGGGG + Intronic
997627649 5:135341896-135341918 CCTTCCTTGGGTGCTGGGAGGGG + Intronic
999458616 5:151738881-151738903 GCTTACTTGGGGGCAAGGAGAGG + Intergenic
1000757930 5:165184265-165184287 GCTTGCCTGGGAGCTGGGTGAGG - Intergenic
1000779625 5:165464870-165464892 GTTTACGTGGGAGCTGGGTGAGG + Intergenic
1004343673 6:14829070-14829092 TCTTACTTGGGATGTGGGTGGGG + Intergenic
1006346181 6:33485236-33485258 GGTTACTTGGGTTCAGGGAGTGG + Intergenic
1009505101 6:64468032-64468054 GCTTGCTTGGGTGCTGGCAGTGG - Intronic
1010203014 6:73299431-73299453 GCTGACTGCGGAGCTGGGAGGGG + Intronic
1010333014 6:74646574-74646596 GCTTTCTTGAGCACTGGAAGTGG - Intergenic
1010706317 6:79115718-79115740 GCTTACTTAGTAACTGGGTGTGG - Intergenic
1011183745 6:84651274-84651296 GTTTCCTTGAGAACTGGGACTGG + Intergenic
1014387296 6:120818119-120818141 CCTCACTTGGGAACTGCAAGGGG + Intergenic
1014709855 6:124794147-124794169 GCTTACTTGGAAACAGCTAGTGG + Intronic
1015838072 6:137444092-137444114 GCTGACTTGGGTACTGGGAATGG + Intergenic
1019625539 7:2014025-2014047 GCTCCCTGTGGAACTGGGAGAGG - Intronic
1020520090 7:9174167-9174189 GCATCCCTGGGCACTGGGAGAGG - Intergenic
1022446326 7:30473644-30473666 GCTTACTTAGGAAGTGAAAGTGG - Intronic
1022894877 7:34740205-34740227 GGTTGCTTGGGAGCTGGGTGAGG - Intronic
1026511016 7:71027439-71027461 GCAGCCATGGGAACTGGGAGGGG + Intergenic
1030116789 7:106068010-106068032 GCTTACTTTGGACTTGGAAGGGG + Intergenic
1032095688 7:128937659-128937681 GCTCAGTTGGGCCCTGGGAGAGG - Intronic
1032436057 7:131901136-131901158 GGTAACATGGGAACTGGGAGAGG + Intergenic
1034210090 7:149355923-149355945 ACTTACTCAGGAACTGAGAGTGG - Intergenic
1034705505 7:153139603-153139625 GTTTGCTTGGGAACTGGGTGAGG - Intergenic
1035616884 8:1008805-1008827 GTGTGCATGGGAACTGGGAGAGG + Intergenic
1036286499 8:7448043-7448065 TCTTATTTGGGAACAGGGACAGG - Intronic
1036334978 8:7863485-7863507 TCTTATTTGGGAACAGGGACAGG + Exonic
1036976065 8:13413919-13413941 GCTGAATGTGGAACTGGGAGAGG + Intronic
1037717574 8:21412884-21412906 GCTTACTTGAGAAAGGGAAGGGG - Intergenic
1039435407 8:37556368-37556390 GCTTACTGGGGGTCAGGGAGAGG - Intergenic
1039869131 8:41530397-41530419 GCTTACTTTAGAACAGGGACTGG + Intronic
1040105563 8:43539679-43539701 GCTTCCCTGGGAATTGGGAGAGG + Intergenic
1040453501 8:47572876-47572898 GCTTCCTTGGGGACAGGCAGCGG - Intronic
1040933193 8:52756532-52756554 GCATGCTTGGACACTGGGAGAGG - Intergenic
1041293774 8:56333576-56333598 GTTTGCATGGGAACTGGGTGAGG - Intergenic
1042182177 8:66101854-66101876 GCTTCCTGGGGAACTAGGAGTGG - Intergenic
1043751610 8:83943306-83943328 ACTTGCTTGGGTTCTGGGAGTGG + Intergenic
1045383822 8:101652104-101652126 GTTTATTTGGGATCTGGGTGGGG + Intronic
1046394603 8:113625474-113625496 GGTTGCGTGGGAACTGGGTGAGG + Intergenic
1048586824 8:135781878-135781900 GGTTACTTGGGGATAGGGAGGGG - Intergenic
1049570834 8:143369578-143369600 GCTGACTGGGCAAGTGGGAGGGG + Intronic
1049992325 9:1001698-1001720 GCTTACATGTGACCTGGGACAGG + Intergenic
1052042481 9:23754887-23754909 GCTTACTTCTGAACTGGTACAGG - Intronic
1055431605 9:76249628-76249650 GCTGATTTGGGGACTGGGACAGG + Intronic
1055922820 9:81479413-81479435 GCTTACATGGGAATGGGAAGTGG + Intergenic
1056474663 9:86942267-86942289 GCTAACTGGGGAAATGGGAAAGG + Intergenic
1057119521 9:92558933-92558955 GTTTGCGTGGGAACTGGGTGAGG - Intronic
1058070763 9:100598736-100598758 GCCTACCTGGGGACTGGGCGGGG - Intergenic
1058925598 9:109660384-109660406 GATTACTTGGACACTGGGTGGGG - Intronic
1060806143 9:126578468-126578490 GCATACTTGTGACCTCGGAGTGG - Intergenic
1062457171 9:136645275-136645297 GCTTCCTTGGGGGGTGGGAGAGG - Intergenic
1187580930 X:20606522-20606544 GGTTGCCTGGGCACTGGGAGAGG + Intergenic
1188040901 X:25369217-25369239 GCTTGCTTGGGTGCTGGGAATGG + Intergenic
1192495658 X:71615335-71615357 GCTTACTAGGGAAATGGCTGTGG - Intergenic
1192881133 X:75285100-75285122 GTTTACATGGGAGCTGGGTGAGG - Intronic
1193033480 X:76924551-76924573 CCTTACTTGGGAAGTGCAAGGGG + Intergenic
1195736650 X:108019006-108019028 GCTTAATTGGGTGCTGGAAGTGG + Intergenic
1196267879 X:113674044-113674066 GGTTACTGGTGAGCTGGGAGAGG - Intergenic
1197986630 X:132272642-132272664 GCTTATTTGGGAGCAGGGAGAGG - Intergenic
1199290912 X:146104354-146104376 ACTTAGTGGGGGACTGGGAGAGG + Intergenic
1199825370 X:151493421-151493443 GTTTACCTGGGAACTGGGGGTGG - Intergenic
1200886576 Y:8278068-8278090 GCTTCCATGGGAACAGGGTGGGG - Intergenic
1201398823 Y:13580349-13580371 GGTTACTTTGTAACTGGGACTGG + Intergenic