ID: 908227215

View in Genome Browser
Species Human (GRCh38)
Location 1:62068036-62068058
Sequence CTGTGTAAGGCCGAGGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908227215_908227223 11 Left 908227215 1:62068036-62068058 CCACCCACCTCGGCCTTACACAG No data
Right 908227223 1:62068070-62068092 CAGGCGTGAGCCACCGCGCCTGG 0: 24697
1: 63253
2: 117985
3: 159199
4: 166585
908227215_908227222 -8 Left 908227215 1:62068036-62068058 CCACCCACCTCGGCCTTACACAG No data
Right 908227222 1:62068051-62068073 TTACACAGTGCTGGGATTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908227215 Original CRISPR CTGTGTAAGGCCGAGGTGGG TGG (reversed) Intronic
No off target data available for this crispr