ID: 908228393

View in Genome Browser
Species Human (GRCh38)
Location 1:62079405-62079427
Sequence ATGAATATCAAAAAGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 860
Summary {0: 1, 1: 0, 2: 4, 3: 67, 4: 788}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908228393_908228395 0 Left 908228393 1:62079405-62079427 CCTTTCTCCTTTTTGATATTCAT 0: 1
1: 0
2: 4
3: 67
4: 788
Right 908228395 1:62079428-62079450 CTAATTTTCCTTTCTTTTGTAGG 0: 1
1: 0
2: 11
3: 127
4: 1556

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908228393 Original CRISPR ATGAATATCAAAAAGGAGAA AGG (reversed) Intronic
900757317 1:4445338-4445360 ATGACTAGAAAGAAGGAGAAGGG - Intergenic
902476606 1:16691826-16691848 CTGAATATTACAGAGGAGAAAGG + Intergenic
902738458 1:18417186-18417208 CTGAATTTCAAAAGGGAGAGGGG + Intergenic
902849189 1:19140405-19140427 ATGAAGATAAAAAAGGTAAAAGG + Intronic
905271164 1:36788616-36788638 AAGAATATCAATAATGATAATGG - Intergenic
906267446 1:44443601-44443623 ATGAAAAGCTAAGAGGAGAATGG - Intronic
906337001 1:44941688-44941710 GTCAATATCATAAAGGACAATGG + Intronic
907555683 1:55342487-55342509 AAGAAAATCAAAAAGGATAATGG - Intergenic
908086362 1:60639065-60639087 ATCAAAATAAAGAAGGAGAAGGG + Intergenic
908129744 1:61063342-61063364 AGGTATATTAAAAAGGAAAACGG + Intronic
908222312 1:62019694-62019716 AAGAAAACCAAAAAGGAGACTGG - Intronic
908228393 1:62079405-62079427 ATGAATATCAAAAAGGAGAAAGG - Intronic
908379736 1:63585329-63585351 ATTAATATCAGAAATGAAAAAGG - Intronic
909197109 1:72641386-72641408 ATGAAAATCATTGAGGAGAAAGG + Intergenic
909283131 1:73782936-73782958 AGGACTTTCAAAAAGAAGAAGGG + Intergenic
910087386 1:83419662-83419684 AGGAATATCAAGAGGGAGAGAGG - Intergenic
910284618 1:85539807-85539829 AAGGATTTCAAAAAGAAGAAAGG - Intronic
910419979 1:87049239-87049261 ATTAATATCAGAAATGACAAAGG - Intronic
911012417 1:93295185-93295207 ATCAATATCAAAAATAAGACAGG + Intergenic
911231863 1:95370314-95370336 TTGATTATCAGAAAGGAGAATGG + Intergenic
911461378 1:98195455-98195477 TTGAAGAGCAAAGAGGAGAAAGG + Intergenic
911929182 1:103879405-103879427 ATAAATAACCAAAAGTAGAAAGG - Intergenic
912171368 1:107104164-107104186 ACAAATATTAAAAAAGAGAAAGG + Intergenic
912217316 1:107629551-107629573 ATGAATATAAAATAGGAAATTGG - Intronic
912329065 1:108800550-108800572 ATAATTATCAAAAAGGATTAAGG - Intronic
912407737 1:109454853-109454875 ATGAATATCAAGCAGAATAAGGG - Intergenic
912608428 1:111017424-111017446 AAGAACAACAAAAAGGAGCATGG - Intergenic
913533737 1:119751701-119751723 ATGAAAATAAAAATGGAGCAGGG - Intronic
914205403 1:145522901-145522923 AAGGATTTCAAAAAGAAGAAAGG + Intergenic
915775231 1:158476700-158476722 ATGAATATGAATAAGATGAAAGG + Intergenic
915852732 1:159343549-159343571 CTGAATTCCAAAAAGGAAAAAGG - Intergenic
916140279 1:161691259-161691281 AATAATATCAAAATGAAGAATGG - Intergenic
916828353 1:168465117-168465139 ATGAAAAACAAAAAAGAGCAGGG + Intergenic
916844891 1:168640448-168640470 ATGAATAGCATGAAAGAGAAGGG - Intergenic
916934468 1:169613366-169613388 ATAAATTTCAAAAAAGAAAAGGG - Intronic
917003050 1:170381956-170381978 ATGTAAATCAAAAATGAAAATGG - Intergenic
917038563 1:170777126-170777148 ATGATTTTCAGAAAGGACAAGGG - Intergenic
917071487 1:171156292-171156314 ATGAAAATCATTGAGGAGAAAGG + Intronic
917428453 1:174940186-174940208 ATGAAAATAAATCAGGAGAAAGG - Intronic
917998141 1:180462464-180462486 ATCAAGATCAAAAAAGATAAAGG + Intronic
918515839 1:185361645-185361667 ATGAAAAACAAAAAAGAGCAGGG + Intergenic
918565719 1:185929148-185929170 ATGAATATGGAAGAGGAAAAGGG - Intronic
918654754 1:187010560-187010582 ATGAATATGAGAAGGAAGAATGG + Intergenic
918732812 1:188019582-188019604 AGAAATATCAAAATGGAGAAAGG - Intergenic
918749246 1:188251522-188251544 TTGAATATCTAAAAGCTGAAAGG + Intergenic
919809921 1:201402539-201402561 TTGAATATAGAAAATGAGAAGGG + Intergenic
919974991 1:202604504-202604526 AAGAAGAACAAGAAGGAGAAGGG - Exonic
920646729 1:207809192-207809214 TTGCATATAAAAAAAGAGAAAGG - Intergenic
920708871 1:208276085-208276107 ATCAATAGCACAAAGGAGGAAGG + Intergenic
920764090 1:208814750-208814772 AAGAATAACAAGAAAGAGAAGGG + Intergenic
920844340 1:209581194-209581216 ATCAATTTAAAAAAGGAGACAGG + Intergenic
921492141 1:215790305-215790327 ATGAATATGAAATAGAAAAAGGG + Intronic
921774748 1:219083939-219083961 GTGAATCTCAAAAGGAAGAAAGG - Intergenic
921889507 1:220339710-220339732 ATGAATCTCAAAATGAAAAAGGG - Intergenic
922403139 1:225281702-225281724 ATGAATAGCACAAAAGAGGAGGG + Intronic
923153432 1:231255163-231255185 ATTAAACTCAAACAGGAGAAGGG - Intronic
923688883 1:236174286-236174308 ATAAAAATCAAGAAGGAGGAAGG + Intronic
924579419 1:245311061-245311083 ATGAAGCTGAAGAAGGAGAAAGG + Intronic
924604070 1:245517062-245517084 ATGAATATAAAAATGGGGATGGG + Intronic
924682999 1:246257469-246257491 ATGAATAACAAAAAAGAGCAGGG - Intronic
1063538132 10:6905406-6905428 ATGAAAATTAAAAAGAACAATGG - Intergenic
1063633120 10:7753432-7753454 AAGAATTTCAAAAAGGAGAATGG - Exonic
1063738006 10:8783590-8783612 AAGAAAATAAAAAATGAGAACGG - Intergenic
1063807126 10:9658335-9658357 ATAAATATGGAAAAGGAGAAAGG + Intergenic
1063844958 10:10117460-10117482 GTGAAAGTAAAAAAGGAGAAAGG + Intergenic
1064434061 10:15295437-15295459 ATAAATATGAGAAATGAGAAGGG - Intronic
1064770043 10:18713528-18713550 ATTAATATAAAAATGGAGAGTGG + Intergenic
1066394721 10:35008112-35008134 ATGAAAAGGAAAAAGGAGCAAGG - Intergenic
1066542079 10:36458294-36458316 AGGGACATCAAAAAGGAGCATGG + Intergenic
1066618043 10:37315849-37315871 ATGAATAGAAAAACAGAGAAAGG - Intronic
1066683931 10:37962698-37962720 AACAATATCAAAAATGAAAAGGG + Intronic
1067656449 10:48195724-48195746 CTAAATATCAAAAATGGGAAGGG + Intronic
1067802513 10:49368841-49368863 ATGAATGTTAAAAAGAAGGAAGG + Intronic
1068181902 10:53531685-53531707 ATGATTTTCAAAAAAAAGAAAGG + Intergenic
1068317961 10:55372124-55372146 ATGAAGATCAAATGGGAGCATGG - Intronic
1068372986 10:56143090-56143112 ATTAATATCAGAAATGAGATCGG - Intergenic
1069000338 10:63256068-63256090 ATGAAAATTTAAAAGGAGACTGG + Intronic
1069159431 10:65074474-65074496 ATAAATAAAAAAAAAGAGAAGGG - Intergenic
1070305949 10:75239342-75239364 ATGAGTAGCAAAAAGGGGAGGGG - Intergenic
1070391235 10:75972445-75972467 ATGAATTTTTAAAATGAGAAGGG - Intronic
1070395084 10:76005314-76005336 ATGAATTTCAACAAGTTGAAAGG - Intronic
1070410908 10:76139295-76139317 ATTAATATAATAAATGAGAAGGG - Intronic
1070421275 10:76239541-76239563 GAGAAGATGAAAAAGGAGAAGGG - Intronic
1071014156 10:80974948-80974970 AAGAAAATCATTAAGGAGAAAGG - Intergenic
1071031239 10:81184321-81184343 ATGAATAACAAAAATTAGCAAGG - Intergenic
1071199114 10:83197427-83197449 ATAAATAACAAACAGGACAAGGG - Intergenic
1071422399 10:85513697-85513719 ATACATAACAAAAAGTAGAAAGG + Intergenic
1072258056 10:93639723-93639745 TTGAGTATCAAAAATGAGTAAGG + Intronic
1073086298 10:100891580-100891602 ATTAAAACCAAAAAGGATAAAGG - Intergenic
1073527373 10:104196783-104196805 GTGAATATGAAAAAGTAGATTGG + Intronic
1074714753 10:116208013-116208035 GTGAATTTTAAACAGGAGAATGG - Intronic
1074759109 10:116652723-116652745 ATGGAAAACAAAAAAGAGAAGGG - Intergenic
1075186368 10:120262325-120262347 AAAGTTATCAAAAAGGAGAAGGG - Intergenic
1075548567 10:123375142-123375164 ATAAATATCAAGAGGGAAAAGGG - Intergenic
1075824051 10:125338343-125338365 GTTAAAACCAAAAAGGAGAAAGG - Intergenic
1076044983 10:127285165-127285187 ATGAATAGTAAAACAGAGAAGGG - Intronic
1076801276 10:132830652-132830674 ATCAATATCAAAAATGATAGAGG - Intronic
1077345218 11:2045150-2045172 TGGAATATGAAAAAGTAGAATGG - Intergenic
1077722608 11:4643544-4643566 ATCAAACTCAAACAGGAGAATGG - Exonic
1077937014 11:6798929-6798951 ATGCATGGCAAAAAGGAGAAAGG + Intergenic
1079267289 11:18945545-18945567 ATGAAGATCAAAAAAGACAAAGG + Intergenic
1079706360 11:23624979-23625001 ATGAATACCAAAAAATACAAAGG - Intergenic
1079817176 11:25076470-25076492 ATGTATATGATAAAGAAGAAAGG + Intronic
1079946238 11:26745301-26745323 TTGAATATCAGAAAAGAAAAAGG - Intergenic
1080221113 11:29905678-29905700 AAGAAAATCATTAAGGAGAAAGG + Intergenic
1080324321 11:31052172-31052194 ATGAACACCAAAAGTGAGAAGGG + Intronic
1080423339 11:32132949-32132971 ATGAATAACAATGAGTAGAATGG - Intergenic
1081578715 11:44336627-44336649 AGAAAAATTAAAAAGGAGAATGG - Intergenic
1082244014 11:49899735-49899757 ATGAATGTCTAATAGTAGAAGGG - Intergenic
1082701268 11:56434128-56434150 ATTATTAGCAAAAAGGAGACAGG + Intergenic
1082921688 11:58502253-58502275 ATGAACATGAAAAAGGAGACTGG + Intergenic
1083534793 11:63457694-63457716 AGGAACATCAAGAAGGTGAAAGG - Intergenic
1083877125 11:65530191-65530213 CTGAAGATCAAAGAGGTGAAGGG - Intronic
1084025450 11:66445629-66445651 CTGAATTCCAAAAGGGAGAAGGG - Intronic
1084025850 11:66448879-66448901 CTGAATTCCAAAAGGGAGAAGGG - Intronic
1084098975 11:66932895-66932917 ATGAATATCAAGAAGTAGTTGGG + Intronic
1084389128 11:68863514-68863536 ATCATTACCAAAAAGCAGAAGGG - Intergenic
1085227304 11:74933575-74933597 ATTCATATCAAATAGGACAAGGG + Intronic
1085847742 11:80085128-80085150 ATGAATAAAAAGAAGGAAAAAGG - Intergenic
1085934993 11:81130575-81130597 ATGAGTACCAAACAGGATAAAGG + Intergenic
1086021114 11:82230978-82231000 AGGTAGATAAAAAAGGAGAATGG - Intergenic
1086026477 11:82298431-82298453 ATGAAAATCAAAATAAAGAAGGG + Intergenic
1086068326 11:82770177-82770199 ATGAATAACACAAAAGAGACAGG + Intergenic
1086459300 11:86989832-86989854 ATCAAGATTAAGAAGGAGAAAGG + Intergenic
1086939366 11:92779472-92779494 ATGAACATCAAAAAGAATAATGG + Intronic
1087375174 11:97330649-97330671 ATACATATCAAAAAGCAAAAAGG - Intergenic
1087594778 11:100238756-100238778 ATGAATACCATAAAGAACAATGG - Intronic
1087728221 11:101748377-101748399 AGGAACATCAAAAATGAGAGTGG - Intronic
1088392309 11:109328002-109328024 ATAAATAACAAATATGAGAATGG + Intergenic
1089083049 11:115793581-115793603 ATTAATAGCAAAAGTGAGAAAGG - Intergenic
1089186378 11:116618175-116618197 ATGAAAGTCATAAAAGAGAATGG + Intergenic
1089684899 11:120140383-120140405 ATGAATATGAATAAGGAAATGGG + Intronic
1089839521 11:121403203-121403225 GTGAATAGCAAAAAGAAAAATGG + Intergenic
1090544015 11:127741757-127741779 ATAAATATCTAAGAGTAGAATGG + Intergenic
1090582710 11:128177590-128177612 ATGAAAATAAACCAGGAGAATGG - Intergenic
1090607924 11:128442769-128442791 ACCAATATCAAAAATGAGAGAGG - Intergenic
1090703722 11:129317861-129317883 AGGAAAATAAACAAGGAGAAGGG - Intergenic
1090841567 11:130493338-130493360 ACTAATATAAAAAATGAGAAAGG - Intergenic
1091168850 11:133503008-133503030 ATCAATATTAATAAGGAGAAGGG - Intronic
1091211874 11:133867975-133867997 ATGACTATGAAAAAATAGAAAGG - Intergenic
1092023174 12:5219255-5219277 ATGAAAATGAAAAAAGAGGATGG + Intergenic
1092580939 12:9840632-9840654 ATTAATATTAAGAGGGAGAAAGG + Intronic
1093145990 12:15567479-15567501 AGGAATAGCAAACAGAAGAATGG - Intronic
1093834745 12:23814857-23814879 ATAAAAATAAAAAAGGAAAAAGG - Intronic
1093888475 12:24490736-24490758 ATAAATATCCAAAACCAGAATGG + Intergenic
1094137386 12:27142758-27142780 ATGAATATCACTAAGGACTAAGG + Intergenic
1094346890 12:29480244-29480266 ATTAATCTCAAAAAGGATGATGG - Intronic
1095121727 12:38426833-38426855 ACGAATATACAAAAGGACAATGG - Intergenic
1095261465 12:40104557-40104579 AGGAAAAACAAAGAGGAGAATGG + Intronic
1095303244 12:40612201-40612223 ACGAAGATCAAAAAAGACAAAGG - Intergenic
1095364012 12:41380161-41380183 ATGAAAATCAAAAGAGAGCAGGG - Intronic
1095641691 12:44493382-44493404 ATGAACATCAAAATGGACTAAGG - Intergenic
1095763854 12:45871960-45871982 ATTAATATCAGAAATGAAAAAGG - Intronic
1095888057 12:47209196-47209218 AGGAATATCAGAAAAGGGAAAGG - Intronic
1096452970 12:51760191-51760213 ATGCTTCTCAAAGAGGAGAAAGG - Intronic
1097477079 12:60071642-60071664 ATGACAATCTAAAAGGAGACTGG - Intergenic
1097929935 12:65171634-65171656 ATGAATATAAAAAAGCAGCAAGG + Intronic
1098506592 12:71258941-71258963 ATAAAAATCAAAAAGTACAATGG + Intronic
1099072750 12:78066472-78066494 ATGAATCTCAAAGGAGAGAAAGG + Intronic
1099174580 12:79406055-79406077 ATGGAAATGAAAGAGGAGAAAGG + Intronic
1099207335 12:79743696-79743718 GTGTATATCTGAAAGGAGAATGG - Intergenic
1100164092 12:91896348-91896370 GTGATTATAAGAAAGGAGAATGG + Intergenic
1100190106 12:92181158-92181180 ATGAAGATGAAAATGGAGATTGG + Intergenic
1100866195 12:98859539-98859561 ATGAATAACAACAAACAGAAAGG + Intronic
1101163472 12:102004387-102004409 AGTAATTCCAAAAAGGAGAAGGG - Intronic
1101713042 12:107286504-107286526 CTGAATTCCAAAAGGGAGAAGGG - Intergenic
1103145477 12:118591432-118591454 ATGAAGATCAGAGAGGTGAAGGG + Intergenic
1103279199 12:119741083-119741105 ATGTCTACCAACAAGGAGAATGG + Intronic
1104085180 12:125467760-125467782 GAGAATATGAGAAAGGAGAATGG - Intronic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1104466037 12:128991496-128991518 ATGAATACAAAAAAGGGGGAGGG + Intergenic
1104754208 12:131258703-131258725 ATGAATAAGTAAATGGAGAAGGG - Intergenic
1105812830 13:24009811-24009833 TTGAATTCCAAAAAGGAGGAGGG + Intronic
1105836269 13:24214808-24214830 TTGAATCTCAAAAAGGAAAGCGG - Intronic
1106100604 13:26692606-26692628 ATGAACATAAAAATGGAGACTGG - Intergenic
1106737061 13:32598422-32598444 ATAAATACCAAAAAGGAGAGAGG - Intronic
1106855623 13:33848595-33848617 ATGACTGTCAAAATGGAGAGAGG - Intronic
1107368799 13:39717958-39717980 AAGAATATCAATAAAGAGACAGG - Intronic
1108390969 13:49947335-49947357 CTGAATTCCAAAAAGGAGAAGGG - Intergenic
1108830077 13:54466600-54466622 ATTAATATCAAAAAGGACACCGG - Intergenic
1109082864 13:57929349-57929371 ATGAATAATAAAATGTAGAAAGG - Intergenic
1109093266 13:58075294-58075316 AAGAATATCTAAAAGTAGATTGG - Intergenic
1109226179 13:59698913-59698935 TTTAATACCAAAAAGGAGAGAGG - Intronic
1109318011 13:60774868-60774890 ATGAAAAACAAAAAAGAGCAGGG - Intergenic
1109331094 13:60931208-60931230 AGGAATATCAAAAAAGAAAAAGG - Intergenic
1109352514 13:61202791-61202813 ATGAAGATCACAAAGGAGAAAGG + Intergenic
1109406016 13:61901307-61901329 ATGAATGACAAAAAGGACCAAGG + Intergenic
1109814201 13:67558224-67558246 ATTAATATCACAAAGGAGATAGG + Intergenic
1110212137 13:72986298-72986320 ATGAATGTCAGAAAGCAGAGTGG + Intronic
1110645166 13:77874339-77874361 ATGAATGTCTATAAGGAGATAGG + Intergenic
1111033068 13:82632776-82632798 ATGAATAAGAAAAGGGAAAAAGG - Intergenic
1111251741 13:85609934-85609956 ATTATTATCAAATAGGAAAAGGG + Intergenic
1111304570 13:86390481-86390503 ATAAATAAAAATAAGGAGAAAGG + Intergenic
1111683431 13:91471936-91471958 AAGAATTTCAAATTGGAGAATGG - Intronic
1112096710 13:96140995-96141017 AAGAAAATCATCAAGGAGAAAGG + Intronic
1112940272 13:104853577-104853599 ATGTATATAGAATAGGAGAAAGG + Intergenic
1113315620 13:109176467-109176489 ATGAATAAAAAAAAAGAAAACGG - Intronic
1113394138 13:109929357-109929379 ATGTATATTAAAAATTAGAAAGG + Intergenic
1114136224 14:19854982-19855004 ATGTAGAGAAAAAAGGAGAAAGG - Intergenic
1114685124 14:24521916-24521938 AAGAATAACAGAAAGCAGAATGG - Intergenic
1114851047 14:26382856-26382878 ATGAATGTTAAAAAGGATGATGG + Intergenic
1114855009 14:26428090-26428112 ATGACTGGCAAAGAGGAGAAGGG - Intergenic
1114868180 14:26623388-26623410 ATGAAGATCCAAAAAGATAAAGG - Intergenic
1114970552 14:28022066-28022088 TTGTATATCTAAAATGAGAAAGG + Intergenic
1115009288 14:28524701-28524723 TTTAAAATAAAAAAGGAGAAGGG + Intergenic
1115056813 14:29137972-29137994 ACCAATATCAAGAATGAGAAAGG - Intergenic
1115303461 14:31910896-31910918 CTGAATTCCAAAAGGGAGAAGGG + Intergenic
1115311782 14:31985609-31985631 AAGAATAGCACAAAGGATAAGGG - Intergenic
1116391464 14:44396257-44396279 ATGAATATCAATAATGCCAAGGG - Intergenic
1116454611 14:45105326-45105348 ATGAATATTAAAACTCAGAATGG - Intronic
1116743219 14:48783309-48783331 ATCAATATCAAAAAAGAGTAAGG + Intergenic
1117121327 14:52570727-52570749 ACAAAGATCAAAAAGGACAAGGG + Intronic
1117130187 14:52678718-52678740 TTGAACATCAAAAGGGATAATGG - Intronic
1117507501 14:56417719-56417741 ATGGATAGTAAAGAGGAGAATGG + Intergenic
1117838671 14:59834140-59834162 ATGAATATCCAAATGCAAAAAGG + Intronic
1117944346 14:61001757-61001779 ATGAATATTAGAAGGAAGAAGGG - Intronic
1118395258 14:65330754-65330776 ATGAAAATTCAAAGGGAGAATGG + Intergenic
1118499125 14:66341113-66341135 ATCAATATCAGAAATGAAAAGGG + Intergenic
1119313042 14:73666953-73666975 ATGAAAAAAAAAAAAGAGAAGGG - Intronic
1120248790 14:82037184-82037206 ATGAATATCCACTAGAAGAATGG + Intergenic
1120261868 14:82195936-82195958 ATGCTTATCAAATAGGAGACTGG - Intergenic
1120653802 14:87165550-87165572 ATAAACAGAAAAAAGGAGAAAGG - Intergenic
1120880420 14:89411491-89411513 CTGAATATGAACTAGGAGAAGGG - Intronic
1120922898 14:89771356-89771378 ATGAAAAACAAAAAAGAGCAAGG + Intergenic
1121192647 14:92043835-92043857 ATGAACATCAAGAAGGTGAAAGG + Exonic
1121251305 14:92501611-92501633 ATAAACTTCAAAAAGGATAAGGG + Intergenic
1122148307 14:99707249-99707271 ATGGATAGCAAAAATGATAAAGG - Intronic
1123472887 15:20568104-20568126 CTGAACATCTAAAAGGAGAGAGG + Intergenic
1123645118 15:22432249-22432271 CTGAACATCTAAAAGGAGAGAGG - Intergenic
1123666407 15:22612024-22612046 CTGAACATCTAAAAGGAGAGAGG - Intergenic
1123733192 15:23163095-23163117 CTGAACATCTAAAAGGAGAGAGG + Intergenic
1123751322 15:23360471-23360493 CTGAACATCTAAAAGGAGAGAGG + Exonic
1123894596 15:24816028-24816050 AAGAGTATAAAAAGGGAGAAAGG - Intergenic
1124283693 15:28384389-28384411 CTGAACATCTAAAAGGAGAGAGG + Exonic
1124299004 15:28527224-28527246 CTGAACATCTAAAAGGAGAGAGG - Exonic
1124320226 15:28706438-28706460 CTGAACATCTAAAAGGAGAGAGG - Exonic
1124454025 15:29823694-29823716 ATGAAGAACAAAAAGGAATAAGG - Intronic
1124482287 15:30088979-30089001 CTGAACATCTAAAAGGAGAGAGG + Exonic
1124488745 15:30141081-30141103 CTGAACATCTAAAAGGAGAGAGG + Exonic
1124543827 15:30610045-30610067 CTGAACATCTAAAAGGAGAGAGG + Exonic
1124754783 15:32397242-32397264 CTGAACATCTAAAAGGAGAGAGG - Exonic
1125247584 15:37659620-37659642 AAGATAAGCAAAAAGGAGAATGG - Intergenic
1126259919 15:46677263-46677285 GTTAAGATCATAAAGGAGAAGGG - Intergenic
1126430029 15:48573454-48573476 ATAAAAATAAAAAAGGACAATGG + Intronic
1126445325 15:48736702-48736724 ATGAGTATCAAAAAAGATTAAGG + Intronic
1126482759 15:49144272-49144294 TTGAAGGTGAAAAAGGAGAATGG - Exonic
1126645192 15:50868688-50868710 ATGAAAAGAGAAAAGGAGAATGG - Intergenic
1127039393 15:54956929-54956951 ATTATTACAAAAAAGGAGAAGGG + Intergenic
1127106173 15:55618835-55618857 ATGAATATTAAAAAGGTATAAGG + Exonic
1127283042 15:57508401-57508423 AGGCAAATCAAAAAGGAGGAAGG + Intronic
1127871041 15:63073919-63073941 ATTAATATAAAAAAGGAGAACGG + Intergenic
1127917786 15:63469635-63469657 ATGAAAAACAAAAAGGAGGCTGG + Intergenic
1127965593 15:63920593-63920615 ATGCATATAGAAAAGGAGACAGG + Intronic
1128913632 15:71539790-71539812 ATGAATGCCAAACAAGAGAACGG - Intronic
1129588648 15:76894435-76894457 ATGAAAAGAAAAAAAGAGAAAGG + Intronic
1129610827 15:77054822-77054844 ATGTATTGCAAAAAGGAGACAGG + Intronic
1129969499 15:79765464-79765486 ATGAAATTTAAAAAGGAAAAAGG - Intergenic
1130422399 15:83761384-83761406 ATGAAGAGCAAAAATAAGAATGG - Intronic
1130440569 15:83948947-83948969 AAGAATCACAAAATGGAGAATGG + Intronic
1130753326 15:86736675-86736697 ATGAATATTAAAAGGGATGATGG - Intronic
1131716340 15:95114522-95114544 ATGAACATCAAAAAGCATCAAGG + Intergenic
1132096233 15:98987201-98987223 ATGAATATCAAAAATTAAATTGG - Intronic
1133068839 16:3232051-3232073 TTGAACATCAAAAAGGGGAGGGG + Intronic
1133107943 16:3525868-3525890 ATTATTATCAAGAAAGAGAATGG - Intronic
1133669721 16:8006622-8006644 AAGAATCCCGAAAAGGAGAATGG - Intergenic
1134671246 16:16056742-16056764 GTGAATAAAACAAAGGAGAATGG - Intronic
1134873173 16:17670294-17670316 ACCAATATCAAAAATGAGACAGG - Intergenic
1134896930 16:17896673-17896695 AGGAAAAAGAAAAAGGAGAAAGG + Intergenic
1134915907 16:18070792-18070814 CTGAAAATCAAGAAGGAGATTGG - Intergenic
1135426709 16:22343598-22343620 ATTTATATCAAAAATGAGACAGG - Intergenic
1135598753 16:23763665-23763687 ATGTATCTCAAAGAGGAGACGGG + Intergenic
1137842030 16:51649654-51649676 CCGAATAGAAAAAAGGAGAATGG + Intergenic
1138058434 16:53861453-53861475 ATGAATAACAGAAAGAAGAATGG - Intronic
1138252691 16:55515707-55515729 AATAATAGCAAATAGGAGAAAGG + Intronic
1138748240 16:59388677-59388699 CTGAATTTCAAAATGGAGGAGGG + Intergenic
1138980062 16:62257341-62257363 ATGAAGCTCAAAAAGAAGAAAGG - Intergenic
1138997168 16:62470077-62470099 AAGCATATCAAAAAAGACAAAGG - Intergenic
1139160679 16:64504494-64504516 AATAAAATCAAAAAGGAAAAAGG - Intergenic
1139738999 16:69018583-69018605 ATGCATAGGAAAAAAGAGAAAGG - Intronic
1140669390 16:77260975-77260997 GTTCATATCAAAAAGAAGAAAGG - Intronic
1140806477 16:78536705-78536727 ATGACTATGAAAAGGGAAAATGG + Intronic
1142553845 17:758633-758655 ATGTATAAAAAAAAAGAGAAGGG + Intronic
1143263101 17:5614815-5614837 ATGAAGAACAAAGAAGAGAATGG - Intronic
1144021949 17:11245484-11245506 ATGAATGTCAAAAAGGACCCAGG - Intronic
1144195300 17:12889155-12889177 ATGAATACAAGAAAGAAGAAAGG - Intronic
1144377081 17:14654771-14654793 ATAAAAAACAAAAAGGAGCAGGG - Intergenic
1145038529 17:19558994-19559016 ATTAATATTAATAAGGAAAAAGG - Intronic
1146524776 17:33557175-33557197 ATGGAGACCAAAAAGGAAAAAGG - Intronic
1146691176 17:34877219-34877241 ACAAGTATCAGAAAGGAGAAAGG + Intergenic
1147525520 17:41218583-41218605 ACAAATATCAAAAAAGACAAAGG + Intronic
1148734010 17:49854378-49854400 ATGAGTCTCAAAGAGAAGAAAGG - Intergenic
1148877423 17:50698536-50698558 ATCAAGATCAAAAATGATAAAGG + Intronic
1149412922 17:56427553-56427575 ATGCATTTCAAGAAGGAGAGAGG - Intronic
1149462560 17:56842737-56842759 ATGAATATAAAAAAGAAAAGAGG - Intronic
1149559663 17:57599494-57599516 ATAAATATGAAACAGGAAAATGG - Intronic
1150008837 17:61486700-61486722 TGGAATAACAAAAGGGAGAAGGG + Intergenic
1150038433 17:61830471-61830493 ATGAATATCAGAAATGAAAGAGG + Intronic
1150619298 17:66797380-66797402 AGGAATATCAAAAACGACAAAGG + Intronic
1150761341 17:67965043-67965065 ATGAAAAACAAAAAGGGGACTGG + Intronic
1151143239 17:72015500-72015522 ATGTATTTTAAAAAGGAGATGGG + Intergenic
1152981128 18:278058-278080 ATCAATATCAGAAATGAAAAAGG + Intergenic
1153324614 18:3805291-3805313 AAGAAGATCTCAAAGGAGAATGG + Intronic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1154233855 18:12584126-12584148 AGAAATATCAAAAAGAAAAATGG + Intronic
1155018668 18:21873851-21873873 AATAATATCAGAAATGAGAAAGG + Intergenic
1155456814 18:26025508-26025530 ATTAATATCAGAAATGAGAGAGG + Intronic
1155514058 18:26606266-26606288 CTGAATTTCAAAAGGGAGGAGGG + Intronic
1155534626 18:26804330-26804352 ATGAATATAAAACACGAAAAAGG - Intergenic
1155587683 18:27386428-27386450 ATGAATGGAAAAAAGGAGGAAGG - Intergenic
1155590690 18:27423975-27423997 ATGAATCTCAAAAAAATGAAAGG + Intergenic
1155608563 18:27636188-27636210 AAAAATATCCGAAAGGAGAAGGG + Intergenic
1155715486 18:28937580-28937602 AAGAACATCAGAAAGGAGAGAGG - Intergenic
1155983957 18:32209996-32210018 GAGAATATGAAAAAGGAAAATGG - Intronic
1156380733 18:36558656-36558678 ATGTTTATCAAAAAGGAGAGGGG + Intronic
1156611939 18:38735112-38735134 ATAAATGTCAAAAATGAGAGTGG - Intergenic
1156811346 18:41256248-41256270 ATAAGTATCAAAAATGAAAAGGG + Intergenic
1156821358 18:41376845-41376867 ATGAATGTAAACAGGGAGAATGG + Intergenic
1156881921 18:42091021-42091043 ATTAATATGAAATAAGAGAAAGG + Intergenic
1156973614 18:43189275-43189297 ATGAATGTAAAAAAGTACAAAGG - Intergenic
1157130363 18:45001717-45001739 CTGCAAAGCAAAAAGGAGAAGGG - Intronic
1157417627 18:47519251-47519273 ATGAATATAAAAGACAAGAAAGG + Intergenic
1157443885 18:47730562-47730584 ATGAAAATAAAGCAGGAGAAGGG + Intergenic
1157647841 18:49295286-49295308 ATTTTTATCAAAAAGAAGAAAGG - Intronic
1157894677 18:51454433-51454455 ATGAATATCATAAAGAAGCTGGG + Intergenic
1158025448 18:52891514-52891536 CTGAATCTCAAAAATGAAAAAGG - Intronic
1158049222 18:53195126-53195148 ACTAATATCAAGTAGGAGAAGGG + Intronic
1158223414 18:55173808-55173830 ATCAATATCAGAAATGAAAAAGG + Intergenic
1158614682 18:58975659-58975681 ATGAAAGTCAAAAATGAGACGGG + Intronic
1159205602 18:65247396-65247418 ATGTATATCAGATGGGAGAAAGG + Intergenic
1159205607 18:65247445-65247467 ATGTATATCAGATGGGAGAAAGG + Intergenic
1159502172 18:69287887-69287909 ATATTTATCAAAAAGAAGAATGG + Intergenic
1159561396 18:69999040-69999062 ATGGACATCAGGAAGGAGAAAGG - Intergenic
1160138773 18:76299097-76299119 ATAAAAATAAAAAAGAAGAAAGG + Intergenic
1160490128 18:79330364-79330386 CTCAATTTCATAAAGGAGAAAGG + Intronic
1160536095 18:79593603-79593625 ATGAATATCAGAAATGAAAGAGG + Intergenic
1161839988 19:6674251-6674273 ATGAATCCCAAACAGGAGAAAGG + Intergenic
1162069199 19:8143472-8143494 AAGAAAAGAAAAAAGGAGAACGG - Intronic
1162658318 19:12149355-12149377 ATGAATAACAAAAATGTGATAGG + Intronic
1163865936 19:19773395-19773417 ATAAATAAAATAAAGGAGAAGGG - Intergenic
1165183536 19:33995184-33995206 ATGAATGTCAAAAGAGAGGATGG + Intergenic
1165587835 19:36935991-36936013 ATGGAAAACAAAAAGGAAAATGG - Intronic
1166622964 19:44320352-44320374 ATCAATAACAAAAAGGACATTGG - Intergenic
1166682456 19:44777421-44777443 TTGATTCTCAAAAAGGAGCAGGG - Intergenic
1166727664 19:45038554-45038576 ATGAAAATAAAAAATGAGACCGG + Intergenic
1166922884 19:46243027-46243049 ATCAATATCAATAATGAGACAGG - Intergenic
1167986399 19:53321007-53321029 TCCAATATAAAAAAGGAGAAAGG - Intergenic
1168014955 19:53565508-53565530 ATAAAAATAAAAAAGGATAAAGG - Intronic
1168620490 19:57875705-57875727 ATGAAGATTAGATAGGAGAATGG + Intronic
1202710627 1_KI270714v1_random:17667-17689 CTGAATATTACAGAGGAGAAAGG + Intergenic
924973042 2:148431-148453 ATGGAAACCAAAAAGGAGCAAGG - Intergenic
925083259 2:1086786-1086808 ATAAATATGAAAAAGGAACAAGG + Intronic
925511039 2:4625805-4625827 AGGAAATTCAAAAAGGAAAAGGG - Intergenic
926657627 2:15425977-15425999 ATGAATACCAGAAAGGACACAGG + Intronic
926838550 2:17051981-17052003 ATGAACATGAAAAAGGACCAGGG + Intergenic
926998455 2:18765858-18765880 ATGAAAGTCAAAAAGAAGGAGGG + Intergenic
927104299 2:19810551-19810573 ATGAGGCTCAAAAAGCAGAAAGG + Intergenic
927617260 2:24611738-24611760 ATGAAAAATAAAAAGGAGCAGGG - Intronic
927642552 2:24854610-24854632 ATGAAATTCAAAAAGGATAGAGG + Intronic
927838018 2:26416753-26416775 ATAGATACCAAAAAAGAGAATGG - Intronic
928432996 2:31235461-31235483 ATTAAGATCAAATAAGAGAAAGG - Intronic
929421191 2:41791555-41791577 CTGAAAATGAAAAAGGAGAATGG + Intergenic
930298135 2:49580576-49580598 ATGAATATAATGAGGGAGAAAGG + Intergenic
930666275 2:54101746-54101768 ACTAATTTTAAAAAGGAGAAAGG - Intronic
931137780 2:59423448-59423470 ATAAATGACAAAAAGGAGGAAGG - Intergenic
931433075 2:62225143-62225165 ATGAAGCTCAAAAAACAGAAGGG + Intergenic
931593362 2:63911161-63911183 CTGTATATCAAAAAGGAAACTGG + Intronic
931892291 2:66686637-66686659 ATGAATTACAAAAAGGACACTGG - Intergenic
932256204 2:70289367-70289389 ATAAATCTGAAAAAGGAAAAGGG + Exonic
933143383 2:78821463-78821485 GGGAATTTCAATAAGGAGAATGG - Intergenic
933196229 2:79393242-79393264 ATCAATATCAAAAAGCACCATGG + Intronic
933405001 2:81846749-81846771 ATGAAAAGGAAAAAGGAGAATGG - Intergenic
933583439 2:84153277-84153299 CTGACTATCAAAAATAAGAATGG + Intergenic
934112256 2:88754965-88754987 TTGAGTTTCAAATAGGAGAATGG + Intergenic
935609609 2:105007498-105007520 ATCAGTATCAGGAAGGAGAAAGG + Intergenic
935632744 2:105225364-105225386 ATGAAATGCAAAAAAGAGAAAGG - Intergenic
935782981 2:106524270-106524292 ATGAATATACAAAGGGACAATGG - Intergenic
936481198 2:112886375-112886397 CTGAATTCCAAAAGGGAGAAGGG - Intergenic
936547876 2:113408083-113408105 ATGAATAAAAAAAAGGAAAAGGG - Intergenic
936592751 2:113819685-113819707 ATTAATATTCAAAAGGAGAAGGG + Intergenic
936721942 2:115262031-115262053 TGGAATCTCAAAAATGAGAATGG - Intronic
936822912 2:116544782-116544804 ATGAATCTAAATAAGGTGAAAGG + Intergenic
937286881 2:120759511-120759533 AAGAATATTACAAAGGATAAAGG + Intronic
937504350 2:122519860-122519882 GTGAATATGAGAGAGGAGAAAGG + Intergenic
937533096 2:122853872-122853894 ATGAAAATCAAAGATGAAAATGG + Intergenic
937558062 2:123184370-123184392 GTGAATATTAAAAATGTGAAAGG + Intergenic
937575259 2:123412857-123412879 ATGAATATCAGAAATAAAAAAGG + Intergenic
937703247 2:124888104-124888126 AGGACTATTAAAAGGGAGAAAGG - Intronic
938131227 2:128717224-128717246 AAGAAATTCAAAAAGGAAAATGG - Intergenic
938734008 2:134169627-134169649 GTGAAAATCAGGAAGGAGAAAGG + Intronic
939393138 2:141593989-141594011 ATAAATATAAAAAAGGTGAAGGG - Intronic
939486212 2:142814412-142814434 AGGAATATCAAAAGGGGGAAAGG - Intergenic
939966846 2:148618731-148618753 AAGATTATGAAACAGGAGAAAGG - Intergenic
940016093 2:149106631-149106653 ATCAATATCAAAAAGGAGGAAGG - Intronic
940546127 2:155088347-155088369 ATTAAAACCAAAAAGGAGCAAGG - Intergenic
940984451 2:160038672-160038694 ATGAGAATCAGAAAGGAGATTGG + Intronic
941713786 2:168742943-168742965 ATAAATATCAAAAGAGAGCAGGG - Intronic
942015649 2:171811871-171811893 AAGTATACCAAAGAGGAGAAAGG + Intronic
942037445 2:172024316-172024338 ATTAATACCAAAAAGGGGAAGGG + Intronic
942433820 2:175948188-175948210 AGCAATACCATAAAGGAGAATGG - Intronic
942700359 2:178700807-178700829 ATGTATAACAAAAAGAATAATGG - Intronic
942832778 2:180256286-180256308 CTGAATGTCAAAAAGGACATGGG - Intergenic
943188736 2:184648609-184648631 ATGAAAAACAAAAAAGAGCAAGG + Intronic
943295185 2:186129314-186129336 ATGAAAATAAAAAAAGGGAAGGG - Intergenic
943352721 2:186814233-186814255 ACAAAGATCAAAAAAGAGAAAGG + Intergenic
943552710 2:189360155-189360177 ACCTATATCAAAAAGTAGAAAGG - Intergenic
944032518 2:195252718-195252740 ATGAATGTAAGAAAGGAGTATGG - Intergenic
945268556 2:207915219-207915241 ATGAAAATTAAAAAGGAAAAAGG + Intronic
945393518 2:209294350-209294372 CAGAAAATCAAAAAGGAGTATGG + Intergenic
945853913 2:215044435-215044457 GTGAATCTGTAAAAGGAGAAGGG - Intronic
947018593 2:225648789-225648811 CTCAAAATCAAAAAGGAGCATGG + Intronic
947299071 2:228667748-228667770 ACGGATAACAAAAAGGTGAATGG - Intergenic
947457236 2:230265903-230265925 AGGATTATGATAAAGGAGAAAGG + Intronic
947883109 2:233538468-233538490 ATCAATATCAGAAATGAAAAAGG + Intronic
947883245 2:233540213-233540235 ATTAATATCAGAAATGAAAATGG + Intronic
948206507 2:236165252-236165274 GTGAATAATAAAAAGGAGAGAGG - Exonic
948563604 2:238869785-238869807 ATGAAAATAAAAAAGTAGCAGGG + Intronic
1169847870 20:10015328-10015350 AGGAATAACAAAATGGAAAAGGG - Intronic
1169965822 20:11216130-11216152 AAGAATATTAAAACAGAGAAGGG - Intergenic
1169997390 20:11573642-11573664 AAGAACATCAAAGGGGAGAAAGG - Intergenic
1170335059 20:15260846-15260868 ATTAATATCAAAGAGAAAAATGG - Intronic
1170520723 20:17182052-17182074 ATGGAAATCAAAAAGAAGCAGGG + Intergenic
1170687370 20:18581634-18581656 GTGTGTATCAAAAAGGAAAATGG + Intronic
1171450337 20:25231377-25231399 ATGAATATCTAAAGGCAGAATGG + Intergenic
1171450851 20:25235268-25235290 ATGAATATCTAAAGGCAGAATGG + Intergenic
1172528286 20:35614224-35614246 ATGAATGTTAAGAAGGAGCAGGG - Intergenic
1172551969 20:35808111-35808133 ATGAACATGAAAATGGAGAAAGG - Intronic
1172781243 20:37438061-37438083 ATGATTTTCCAAAAGGAGATGGG - Intergenic
1173141860 20:40491695-40491717 ATGAATATCACAAAGGACATGGG - Intergenic
1173169531 20:40712911-40712933 ATAAATAAATAAAAGGAGAAGGG - Intergenic
1173858323 20:46265775-46265797 AAGAAGAAGAAAAAGGAGAATGG - Intronic
1174091435 20:48051815-48051837 ATGTCTACCAAGAAGGAGAATGG + Intergenic
1174150246 20:48481338-48481360 ATGGATGTCATACAGGAGAAAGG - Intergenic
1174888591 20:54364034-54364056 CTGAATTTCAAAAGGGAGGAGGG - Intergenic
1175066372 20:56292016-56292038 ATAAATATGAAAGAGGAGAGAGG - Intergenic
1176813611 21:13572840-13572862 ATGTAGAGAAAAAAGGAGAAAGG + Intergenic
1177498155 21:21915508-21915530 ATTATTTTCAAAAGGGAGAATGG + Intergenic
1178018731 21:28384073-28384095 CTGAATACAAAAGAGGAGAAGGG - Intergenic
1178249184 21:30985662-30985684 ATGAATATCCAAAAGAAAACTGG + Intergenic
1178316500 21:31570781-31570803 ATTCGTATCAAAAAAGAGAAGGG + Intergenic
1180114620 21:45692421-45692443 ATGAATATCAAGAATGAAAGAGG + Intronic
1181379403 22:22488508-22488530 ATGGACAGCATAAAGGAGAAGGG - Exonic
1181424672 22:22826486-22826508 CTGAATTCCAAAAAGGAAAAGGG - Intronic
1181537018 22:23551621-23551643 ATGGAGAACAAAAGGGAGAATGG - Intergenic
1182142912 22:27978047-27978069 CTGAAAATCACAAAGGAGGAAGG + Exonic
1182309572 22:29395028-29395050 CTGAGTATCAGAAAGGGGAAGGG - Intronic
1183819307 22:40332167-40332189 AGAAATATTAAAAAGGAGAGAGG - Exonic
1184297048 22:43531563-43531585 TTGAATATCACAAAGGTGAACGG + Intronic
949346112 3:3078426-3078448 ATGAATATTTGAAAGCAGAAGGG - Intronic
949524622 3:4891094-4891116 ATTAATAATAAAAAGTAGAAAGG - Intergenic
950500518 3:13360606-13360628 ATGAGTTTCAAACAGGAGATGGG - Intronic
950853857 3:16087527-16087549 ATGAATGTTATAAAGGAGATGGG + Intergenic
950900939 3:16496928-16496950 ATGAATCTCAAAAATCAAAAAGG + Intronic
951127646 3:19002627-19002649 ATGAACACAAGAAAGGAGAACGG + Intergenic
951331946 3:21379468-21379490 AGGAACATCAAGAAGGTGAAAGG + Intergenic
951364778 3:21768179-21768201 TTGATTATGAAAAAGGACAAAGG + Intronic
951656159 3:25010840-25010862 ATGAATATCAAAAAGAGTCACGG - Intergenic
951762157 3:26159422-26159444 AGGAACATCAAGAAGGTGAAAGG + Intergenic
952136259 3:30424917-30424939 ATGAATATCCATAAGATGAATGG - Intergenic
952212288 3:31240308-31240330 ATGAATATCAAATATGCGGAGGG - Intergenic
952623155 3:35369993-35370015 ATGAAATATAAAAAGGAGAAGGG + Intergenic
952688004 3:36171956-36171978 CTGAATTACAAAAAGGAGGAGGG + Intergenic
952713504 3:36454618-36454640 ATGACTATTAAGAATGAGAAAGG + Intronic
953272681 3:41460705-41460727 ATGAACAGCAACAAGAAGAAAGG - Intronic
953473627 3:43187246-43187268 ATGATTTTAAGAAAGGAGAAAGG + Intergenic
953593695 3:44286229-44286251 CTTAATGACAAAAAGGAGAAAGG + Intronic
954000151 3:47550124-47550146 ATGAAGAAGAAGAAGGAGAAGGG - Intergenic
954423513 3:50431211-50431233 ACAAATGTGAAAAAGGAGAAAGG + Intronic
954605194 3:51904154-51904176 ATGAATATAAAGAAGAAAAAAGG + Intergenic
954772153 3:52981323-52981345 AAGAAAATCATTAAGGAGAAAGG + Intronic
955315002 3:57931096-57931118 ATGAAAATCATAAAGGTGGAAGG - Intergenic
955342208 3:58133635-58133657 ATTAATATCAACAAGGAACAAGG - Intronic
955376596 3:58402273-58402295 AAGACTCTCAAAAAGAAGAAGGG - Intronic
955432192 3:58858031-58858053 ATGATAAACTAAAAGGAGAAAGG - Intronic
955738458 3:62064518-62064540 ATGCATAATAAATAGGAGAATGG - Intronic
955886741 3:63607548-63607570 ATGAAAAGTAAAAAGAAGAAAGG + Intronic
956274634 3:67484740-67484762 ATGAAAAAGAAAAAGGAGATAGG + Intronic
956317472 3:67954377-67954399 ATAAATATGAAAATGGAGGAAGG + Intergenic
956995463 3:74822453-74822475 ATGGAGACCAAAAATGAGAAGGG - Intergenic
957550971 3:81704198-81704220 AACAATATTAAAAAGGTGAAAGG - Intronic
957563778 3:81859065-81859087 TTGAAAATTAAAAAGGAAAAGGG + Intergenic
957610746 3:82462170-82462192 ATGAAAATCAACAATGAAAATGG + Intergenic
957719438 3:83974292-83974314 ATGAATATCAGAAAGAGGCAAGG + Intergenic
957756690 3:84498067-84498089 ATGAAAATCATAAAGTATAATGG + Intergenic
957908805 3:86593918-86593940 ATCAAAATCAAAAAAGAGGAGGG - Intergenic
958009207 3:87854250-87854272 AAAAATATAAAAAAAGAGAAAGG - Intergenic
958147540 3:89645885-89645907 ATCAAAATCAAATAGCAGAAGGG - Intergenic
958727568 3:97924397-97924419 ATGAATAAGAAAAAGGTGAAAGG + Intronic
958744676 3:98118424-98118446 ATTAAAATCTTAAAGGAGAAGGG + Intergenic
959330921 3:105003663-105003685 TGGAAAATCAAAAAAGAGAAAGG + Intergenic
959562847 3:107802234-107802256 CTGGATGTCAAAAAGGAGCATGG - Intronic
959722272 3:109505440-109505462 AAGAAAAAAAAAAAGGAGAAGGG - Intergenic
959937964 3:112049320-112049342 ATGAAACACAAAAATGAGAAAGG - Intronic
959969745 3:112396291-112396313 ATGCATGTCAAGAAGTAGAAGGG - Intergenic
960475661 3:118123170-118123192 ATAAATAACTAAAAGTAGAAAGG + Intergenic
960538238 3:118836856-118836878 TTGAATAACACAAAAGAGAAGGG + Intergenic
960622399 3:119649336-119649358 ATGAATAAACAAATGGAGAATGG - Intronic
960824146 3:121765800-121765822 ATGAAAAACCAAAAGGAGCAGGG - Intergenic
961595014 3:128009156-128009178 ATTAATAACTAAAAGGAGAGAGG + Intergenic
961663887 3:128484693-128484715 ATGCAAAACAAACAGGAGAAAGG + Intronic
961852027 3:129830076-129830098 ATGAATAACAACCATGAGAATGG + Intronic
961957441 3:130818564-130818586 CTGAATTCCAAAAGGGAGAAGGG - Intergenic
962298914 3:134219547-134219569 ATGTATTTCAAAATGGTGAAAGG - Intronic
962763142 3:138535830-138535852 AGGAAGAACAAAAAGGAGAGAGG - Intronic
963114607 3:141715860-141715882 ATCAATATCAAGAATGAAAAAGG - Intergenic
963372566 3:144419927-144419949 ATGTATCTCAAAAGGGACAAAGG + Intergenic
963532245 3:146485180-146485202 ACAAAGATCAAAAAGGACAAAGG + Intronic
963609810 3:147452949-147452971 ATATATATCAAAAAGTGGAAAGG - Intronic
963627553 3:147692033-147692055 AGTAATATTAAATAGGAGAAAGG - Intergenic
963830676 3:150005407-150005429 ATGAATATCATAGAGGGGAGAGG + Intronic
964333516 3:155629910-155629932 CTGAATATAAAAAAGGAGTAAGG - Intronic
964380894 3:156098167-156098189 GTGAAAATCAAATAAGAGAATGG - Intronic
964551411 3:157888963-157888985 AAGATTATTAAAAAGGAGGAAGG - Intergenic
965091764 3:164172207-164172229 GTTAATATCAAACATGAGAATGG - Intergenic
965234203 3:166094006-166094028 ATCAATATCAAATACAAGAAGGG + Intergenic
965335743 3:167429401-167429423 AGGAACATCAAGAAGGTGAAAGG - Intergenic
965749549 3:171961648-171961670 ATGCATAATGAAAAGGAGAAAGG + Intergenic
965810332 3:172585167-172585189 GTGAATACCAAAAAGAAGAATGG - Intergenic
966214104 3:177483555-177483577 ATAAGAATCAAAAAGGAAAAAGG - Intergenic
966643259 3:182214319-182214341 ATAAAAATGAAAAAAGAGAAAGG - Intergenic
966646841 3:182255454-182255476 CTGAATAACACAAAAGAGAAAGG - Intergenic
967178117 3:186879212-186879234 ATCAGTATCATAAAGGAGGAAGG - Intergenic
967383967 3:188892196-188892218 ATGAATATCAACAAGGCAACAGG + Intergenic
967704040 3:192629681-192629703 ATGAATACAAAAAAGTACAAAGG + Intronic
969649580 4:8457062-8457084 AAGAAAATCATCAAGGAGAAAGG + Intronic
970200068 4:13595330-13595352 CTCAATATCAGAAAGGATAAAGG - Intronic
970714859 4:18909115-18909137 ATGGAAACCAAAAAAGAGAATGG + Intergenic
970882032 4:20943921-20943943 ATGAATGTCAGAGAGAAGAATGG + Intronic
971084923 4:23262818-23262840 ATTAATATCAGAAATGAGAGAGG - Intergenic
971446088 4:26750396-26750418 AGGACTTTCAAAAAGTAGAATGG + Intronic
971817620 4:31509099-31509121 ATGTATTCCAAAAAGGAAAAGGG - Intergenic
971822379 4:31574768-31574790 AGGGATATTAAAAAAGAGAAAGG + Intergenic
972024739 4:34362655-34362677 ATAAATAAAAAAAAGGAGATGGG + Intergenic
972109002 4:35531500-35531522 ATAAATATAAAAAATAAGAAGGG + Intergenic
972122104 4:35716307-35716329 ATCTATATCAAAAAGTAGAAAGG + Intergenic
972500687 4:39675247-39675269 ATGAATTACAGAAAGCAGAAGGG + Intergenic
972722945 4:41719052-41719074 AGGAATTTGAAAAAGGAGGAAGG + Intergenic
972775080 4:42232908-42232930 TTAAATTTCAAAAAGGAGACAGG + Intergenic
973291706 4:48477522-48477544 ATGAATGTCAAAATGGAGGAGGG - Intergenic
973741149 4:53920533-53920555 ATGAAGATCAAACAGGTCAAAGG + Intronic
973894493 4:55397669-55397691 ATGGAAAGGAAAAAGGAGAAAGG - Intronic
973969544 4:56198283-56198305 ATGAACTTCAAAAAGAAGAGAGG + Intronic
974200357 4:58630350-58630372 CTGAATATCATAAAGGAAAGTGG + Intergenic
974242554 4:59268984-59269006 ATGAAAATCATTGAGGAGAAAGG - Intergenic
974463590 4:62223217-62223239 AGGAATTTCAAGAAGGAAAAGGG - Intergenic
974631103 4:64490117-64490139 ATGAATATGAAGAGGGACAATGG - Intergenic
974810197 4:66936380-66936402 GAGAATATCAAAAAATAGAATGG + Intergenic
974833984 4:67224566-67224588 GTGAATATAAAGAAGGAGAGTGG + Intergenic
974932033 4:68370453-68370475 ATTAATTTCAAACAGGTGAATGG - Intergenic
975299031 4:72767678-72767700 ATAAATATGAAAAGGGAAAAAGG + Intergenic
975695843 4:77011948-77011970 AAGAAGATCTAAAAGGAGAGTGG - Intronic
976030334 4:80744560-80744582 ATGAAAATCAAAAAAGGTAAAGG - Intronic
976355370 4:84110920-84110942 ATAAAGAGAAAAAAGGAGAAAGG - Intergenic
976463683 4:85343318-85343340 GTTAATATTCAAAAGGAGAAAGG - Intergenic
976951043 4:90830933-90830955 ATTAACATGAAAAAGGACAATGG - Intronic
976976416 4:91170022-91170044 ATGAAAGTCAAAAAGGACACAGG - Intronic
977338179 4:95724209-95724231 ATGAAAAAAAAAAAAGAGAAAGG - Intergenic
977761012 4:100737001-100737023 ATGAAGATGAAAGAGCAGAATGG + Intronic
978396322 4:108284309-108284331 AAGAAAAGAAAAAAGGAGAAAGG + Intergenic
978435840 4:108683532-108683554 AGGAATATCAAATAGGAAAGGGG - Intergenic
979481321 4:121221332-121221354 ATAAATATTAAAAAAGAAAAAGG + Intronic
979521666 4:121674328-121674350 AAGAAAAGGAAAAAGGAGAAAGG + Intronic
979633515 4:122930530-122930552 ATGAACAATAAAAAGCAGAAGGG + Intronic
980199347 4:129635530-129635552 GTGAATATCAAGCAGGAGAATGG - Intergenic
980492023 4:133540737-133540759 CTGAATTCCAAAAGGGAGAAGGG + Intergenic
980664845 4:135918148-135918170 ATGAATATCATAAATGTGAAGGG - Intergenic
980734360 4:136866167-136866189 TTGAATATAAAAATGAAGAAAGG - Intergenic
980843879 4:138300712-138300734 ATGAAGATGAAAAGGAAGAAGGG - Intergenic
981322982 4:143414245-143414267 AAGAATTTCAAAGAGGAGTAAGG + Intronic
981413286 4:144458338-144458360 AAGAACACCAAAAAGTAGAAGGG - Intergenic
981523501 4:145689748-145689770 ACAAAAATAAAAAAGGAGAAAGG + Intronic
981542601 4:145861180-145861202 ATGAATATGTTAAAGGTGAAAGG + Intronic
982752624 4:159180145-159180167 ATAAACAACAAAAAGGAAAACGG - Intronic
983021226 4:162677473-162677495 ATGAACACCAAAAAAGAGCAGGG + Intergenic
983547936 4:168982236-168982258 ATGGAAAACAAAAAGGAGCAGGG + Intronic
983860672 4:172702390-172702412 AAGAATATTAAAAATGACAATGG - Intronic
984384815 4:179042685-179042707 ATCAATATCAAGAATGAAAAAGG - Intergenic
984514246 4:180719027-180719049 ATGAATATTAAAAGGGATGAAGG - Intergenic
984780482 4:183521527-183521549 ATGGTTATGAAAAGGGAGAAGGG - Intergenic
985281983 4:188296374-188296396 ATTAATATAAAACAGGATAAAGG - Intergenic
985381099 4:189395990-189396012 ATGAATATGACACATGAGAAAGG + Intergenic
986014366 5:3745027-3745049 ATGAAGATCAAAAAGCAGCAAGG + Intergenic
986252705 5:6075351-6075373 ATGAAGATAAAAAAGGAACATGG + Intergenic
986344362 5:6820822-6820844 AAGAATGGCAAAAAGGAAAAGGG + Intergenic
986452771 5:7882540-7882562 AGGAATATAGAAAAGGAGTAGGG + Intronic
986515004 5:8551974-8551996 TTGTGTTTCAAAAAGGAGAAGGG - Intergenic
987249704 5:16086286-16086308 ATAAACATCAAAATGCAGAAAGG + Intronic
987404217 5:17508616-17508638 ATGGATGTCAAAGAGAAGAAAGG - Intergenic
987774399 5:22345799-22345821 AATTATGTCAAAAAGGAGAATGG + Intronic
988212971 5:28230181-28230203 ATGAATATCAAAACTGAAATGGG - Intergenic
988357266 5:30194186-30194208 TTGAATATTAATAAGAAGAATGG - Intergenic
988832218 5:34999033-34999055 ATGTATGACAAAAAGGAAAAGGG - Intronic
988932606 5:36051420-36051442 ATGAATATATATAAGAAGAAGGG + Intronic
989237819 5:39169891-39169913 GTGGAAATCAAAAAGGAAAAAGG - Intronic
989278416 5:39615153-39615175 ATGACTAACTAAAAGGAGTATGG + Intergenic
989346354 5:40434294-40434316 ATGAATATCATCAATGAAAAGGG - Intergenic
990073986 5:51819867-51819889 ATAAATATAAAAAAAGACAATGG - Intergenic
990077578 5:51869506-51869528 ATGAATAGCCAAAAATAGAAAGG - Intergenic
990098262 5:52147480-52147502 ATGAATATTTCATAGGAGAAAGG + Intergenic
990153675 5:52849464-52849486 ATGAAAATGAAGAAGGAAAATGG + Exonic
990659921 5:58001938-58001960 GTGAATTTCAAAAAAGAGGAGGG - Intergenic
990723184 5:58721963-58721985 ATCAAAATCAAAAAAGAGAGAGG - Intronic
991030687 5:62079290-62079312 TTGACTTACAAAAAGGAGAATGG - Intergenic
991212956 5:64128586-64128608 TTGAATATCAAAATGTAGAATGG + Intergenic
991287637 5:64996333-64996355 ATGAATACCAGAAAGTAGAAGGG - Intronic
991312853 5:65263851-65263873 ATGAATAACAATAAGGAACATGG + Intronic
992491888 5:77252647-77252669 AGGAGTATCAAAAAGGGAAATGG - Intronic
993197799 5:84771885-84771907 TTAAATATTTAAAAGGAGAAAGG - Intergenic
993916768 5:93753642-93753664 ATGTATTTTAAAAAGAAGAAAGG - Intronic
994009152 5:94879463-94879485 ATGATTATCAATTAGGAGGAGGG - Intronic
994219789 5:97182567-97182589 ATGAAAATGATAAAGGATAATGG - Intronic
994572562 5:101532909-101532931 ATGGAGAACAAAAAGAAGAAAGG - Intergenic
994708687 5:103238584-103238606 AAAAATATCAGAAAGGAGAAAGG + Intergenic
994741146 5:103620915-103620937 AAGAATATTAAGAAGGAGAGTGG - Intergenic
994750300 5:103728937-103728959 ATGAATACCAAAAGGGAGCAAGG - Intergenic
994754272 5:103776062-103776084 AAAAATGTCAAAAAGGAGAGGGG + Intergenic
995124789 5:108569416-108569438 AGGAATATCAAGAAGGTGAAAGG + Intergenic
995129032 5:108610240-108610262 TTGAAAAACAAAAAGTAGAAAGG + Intergenic
995319022 5:110810183-110810205 ATGATTATGAAAATAGAGAAAGG + Intergenic
995838119 5:116418196-116418218 ATGGATGGCTAAAAGGAGAAGGG + Intergenic
996307702 5:122068816-122068838 ATGAATAAATAAATGGAGAATGG + Intronic
996328595 5:122305227-122305249 ATTATTATCAAAATGAAGAAAGG + Intergenic
996358100 5:122618706-122618728 AGGAACATCAAGAAGGTGAAAGG + Intergenic
996626743 5:125579428-125579450 ATGAATGTAAAGTAGGAGAATGG + Intergenic
996933386 5:128918367-128918389 TTGAATATCAAGAAGTTGAATGG + Intronic
997334302 5:133094448-133094470 AGTAATATTAAAAAGGAAAATGG + Intronic
997835682 5:137191332-137191354 AAGATTATGAAAAAAGAGAATGG - Intronic
998097506 5:139404573-139404595 ACGAAGATAAAAAATGAGAATGG + Intergenic
998694136 5:144618883-144618905 ATGAATGTCAAAAAAGACATGGG + Intergenic
998808773 5:145944518-145944540 ATGAATAAATAGAAGGAGAAAGG - Intronic
999015312 5:148097060-148097082 AAGAAAAAGAAAAAGGAGAAAGG - Intronic
999078879 5:148824883-148824905 ATGAAAAGCAAATAGCAGAATGG + Intergenic
1000222823 5:159230533-159230555 AGGAAAATCAAAAAGAAGAGTGG + Intergenic
1000657121 5:163892987-163893009 ATGAATTTCAAAAGGGAAAAGGG - Intergenic
1001097651 5:168788206-168788228 CTGAAGATCACAGAGGAGAAGGG - Intronic
1001417966 5:171561402-171561424 ATGAAAAACAAAAAGGGAAAAGG - Intergenic
1001796161 5:174504069-174504091 ATCAAAATGAAAAGGGAGAAGGG + Intergenic
1001815690 5:174667554-174667576 GGGAACATCAAAAAGTAGAACGG - Intergenic
1003829441 6:9990917-9990939 ATGAATTTCAAAAAGGTACAAGG + Intronic
1004242694 6:13940462-13940484 GTAAATATCAAAAATGAAAAGGG - Intronic
1004682090 6:17905999-17906021 ATGAATTATAAAAAGTAGAAGGG + Intronic
1004794947 6:19071004-19071026 ATTAATATATAAATGGAGAAAGG + Intergenic
1004824774 6:19407089-19407111 CTGAACATCAAATAGGAGCATGG - Intergenic
1005019336 6:21402492-21402514 GTGATTTTCAAAAAAGAGAAAGG + Intergenic
1005374487 6:25168553-25168575 TTGGAAATCAAAAAAGAGAAAGG - Intergenic
1005678148 6:28177745-28177767 ATAAAACTCAAAAAGCAGAATGG - Intergenic
1005896483 6:30183529-30183551 ATGAATATAAAAAATAAAAAGGG + Intergenic
1007007308 6:38377738-38377760 ATGATTATGAAAAAGAAGATAGG - Intronic
1007081852 6:39111867-39111889 TTCAATATCAAAAAGTAGAATGG + Intronic
1007216474 6:40243956-40243978 ATAAAACTCAAAGAGGAGAAGGG - Intergenic
1007542814 6:42665285-42665307 ATTAAAAACAAAAAGGATAAGGG - Intronic
1007808228 6:44466939-44466961 ATGATTATCATAAAGATGAAAGG + Intergenic
1007909745 6:45501755-45501777 GTGACTATCAGAAAGCAGAATGG - Intronic
1008112791 6:47511226-47511248 AAGAATACCACAAAGGTGAAGGG - Intronic
1008818581 6:55602293-55602315 ATGAATATCCAAAACTATAAGGG + Intergenic
1009042186 6:58191797-58191819 ATGAATACCTAAAAGGAGCAAGG - Intergenic
1009208657 6:60834856-60834878 GTGATGATCAAAAAGGACAAAGG + Intergenic
1009218023 6:60946031-60946053 ATGAATACCTAAAAGGAGCAAGG - Intergenic
1009334919 6:62475075-62475097 ATTACTAGAAAAAAGGAGAAAGG + Intergenic
1009367628 6:62868163-62868185 TGTAATATCAAAAAGGTGAAAGG - Intergenic
1009369463 6:62881738-62881760 CCTAATATCAAAAAGGAGAGAGG + Intergenic
1009446107 6:63744270-63744292 ATGCATTTTAAAAAGGAAAAAGG + Intronic
1009858679 6:69296176-69296198 ATGAATATCCAAAGTGAGATAGG + Intronic
1009861250 6:69335880-69335902 CTGATTATAAAAAAGAAGAAAGG - Intronic
1010118358 6:72342217-72342239 ATGAATGACAAAATGGAGAGTGG - Intronic
1010329319 6:74604134-74604156 ATGAATACCAAGAAAAAGAATGG + Intergenic
1010708766 6:79146872-79146894 ATGAAGATGGAAAAGGAGAGTGG + Intergenic
1010751610 6:79621746-79621768 GTGTATATCAAGAAGGAGAATGG - Intergenic
1010851636 6:80783970-80783992 AGGAAAATTAACAAGGAGAAAGG + Intergenic
1011315857 6:86030398-86030420 AAGAACATAAAACAGGAGAATGG - Intergenic
1011321337 6:86096606-86096628 ATGAAGATCAAAAAAGACAAGGG + Intergenic
1011393849 6:86884741-86884763 ATGAAAAGCAAAAAAGAGCAGGG - Intergenic
1011584655 6:88911303-88911325 ATGAAAAACAAAAAAGAGCAGGG + Intronic
1011807677 6:91090965-91090987 AGAAAGATCGAAAAGGAGAAAGG - Intergenic
1011847455 6:91584167-91584189 ATGAAGAACAAAAAGTTGAAAGG + Intergenic
1012020909 6:93917962-93917984 ATGAAGATTAAAAAGTACAAGGG + Intergenic
1012390106 6:98728695-98728717 ATGAACACCAGAAAAGAGAACGG - Intergenic
1012538110 6:100324372-100324394 ATGGAAAACAAAAAGGAGCAGGG - Intergenic
1012680768 6:102176062-102176084 AAGGAAAACAAAAAGGAGAAAGG - Intergenic
1013033928 6:106361685-106361707 ATAAAAATCAAAAAGCACAATGG - Intergenic
1013830639 6:114268470-114268492 ATGAAAATTAAAAAGGAAACAGG - Intronic
1013859117 6:114612749-114612771 ATGAATTTCCAAAAGGAGATGGG - Intergenic
1014429779 6:121354480-121354502 ATAAATAAAAAGAAGGAGAAAGG + Intergenic
1014901882 6:126975805-126975827 ATGAATAACAAAATGCAAAAGGG - Intergenic
1014916429 6:127155081-127155103 TTAAATATAAAACAGGAGAATGG - Intronic
1015083900 6:129264107-129264129 ATGAATAATAGGAAGGAGAAGGG + Intronic
1015380972 6:132568605-132568627 ATGAATATCAGAATGATGAAGGG + Intergenic
1016048724 6:139507156-139507178 ATGAAAAAGAAAAAGGAGAATGG - Intergenic
1016077205 6:139810420-139810442 AATAATAGCAAAAAGGAGAAGGG - Intergenic
1016247847 6:142008112-142008134 GTGAAACTCAAAAAGGAAAAAGG + Intergenic
1016385689 6:143528701-143528723 ATGAAAATGAAATAAGAGAAAGG - Intergenic
1016462496 6:144291722-144291744 ATCAATACCTAAAAGGAAAAGGG - Intronic
1016542948 6:145187308-145187330 ATTAATAGGAAAAAGCAGAAAGG + Intergenic
1016644165 6:146385219-146385241 ATTAATATCCAAAATAAGAAAGG + Intronic
1017332055 6:153210848-153210870 AGGAAAATGAAAAAGGAGAATGG - Intergenic
1017396042 6:154001454-154001476 AGGAATAGCACAAAGGAGAGAGG + Intergenic
1017482731 6:154873546-154873568 ATGAATATTAACAACAAGAAGGG - Intronic
1020559662 7:9715098-9715120 ATGGATAACAAAGAGGACAATGG + Intergenic
1020605228 7:10328477-10328499 TTGAATGTCAAAAAGGACAAGGG + Intergenic
1020732449 7:11898685-11898707 ATGAATATAAGAAGGGGGAATGG + Intergenic
1021347432 7:19546009-19546031 ACAAATATCAAAAAAGACAAAGG - Intergenic
1021377422 7:19925014-19925036 TTTTATATTAAAAAGGAGAATGG + Intergenic
1021918660 7:25461297-25461319 ATCAATATCAGGAATGAGAAAGG - Intergenic
1023761882 7:43471795-43471817 ATGAATAAATAAAATGAGAAGGG + Intronic
1024341402 7:48266552-48266574 ATGAATATCAACTATGAGAAAGG - Intronic
1024381306 7:48699397-48699419 ATTAATATCAAATAAGATAAAGG + Intergenic
1024888628 7:54175907-54175929 ATGTATATAAAAAAAGAGAGAGG + Intergenic
1025738128 7:64172815-64172837 ACAAATGTCAAAAAGTAGAAGGG - Intronic
1026509345 7:71015586-71015608 ATGGATATTAAGAAGCAGAAGGG + Intergenic
1026774275 7:73221339-73221361 AAAAATAACAAAAAAGAGAAAGG - Intergenic
1027015132 7:74774725-74774747 AAAAATAACAAAAAAGAGAAAGG - Intronic
1027072899 7:75171228-75171250 AAAAATAACAAAAAAGAGAAAGG + Intergenic
1027146402 7:75698180-75698202 ATGAATAGAAAATAGGAAAAAGG - Intronic
1027304267 7:76876143-76876165 AGGAATATCAAGAGGGAGAGAGG - Intergenic
1027443924 7:78250124-78250146 ATGAATATTAAAAAACAGCAAGG + Intronic
1027971309 7:85085280-85085302 ATGAGTCTTAAAAAGGATAAAGG + Intronic
1028364925 7:90017475-90017497 ATGCATATCATTAAGGAAAAAGG - Intergenic
1028505996 7:91570698-91570720 GTGCATTTCAAAAAGGAAAATGG - Intergenic
1028966114 7:96803530-96803552 ATGCATAACAAAAATGACAAAGG - Intergenic
1029873176 7:103717055-103717077 TTGAATATCTCAAAAGAGAAAGG + Intronic
1030566293 7:111162555-111162577 ATCAATTTTAAAATGGAGAATGG - Intronic
1030786235 7:113666255-113666277 ATGAAAAACAAACAGGAAAATGG + Intergenic
1031046050 7:116888940-116888962 ATGAATAGCCAAAAGAAAAAGGG + Intronic
1031057507 7:117009719-117009741 ATGACTATAAAAAAGGACATTGG - Intronic
1031395467 7:121268491-121268513 AAGAATAGAAAAAAGGAAAAGGG + Intronic
1032386385 7:131528333-131528355 ATAGATAGAAAAAAGGAGAAGGG + Intronic
1032549929 7:132775529-132775551 ATTAATAAATAAAAGGAGAAAGG - Intergenic
1032750889 7:134840247-134840269 ATGAATATCTATATGGAAAAAGG - Intronic
1033977408 7:147118737-147118759 TTGCATATCAAAAAATAGAATGG + Intronic
1034030240 7:147754144-147754166 TTGAAAATCAAAAAGAATAATGG + Intronic
1034786871 7:153934332-153934354 ATGGAAAAAAAAAAGGAGAAGGG - Intronic
1035333820 7:158113132-158113154 AAGAATTCCAAGAAGGAGAAGGG + Intronic
1035932971 8:3804865-3804887 ATGATTATAAAAAAGTAGCATGG + Intronic
1035959739 8:4124373-4124395 CTCCATATCAAAAAGGAGACAGG + Intronic
1036663027 8:10720599-10720621 AAGAAAATGAAAAAAGAGAAAGG + Intergenic
1037073957 8:14689163-14689185 ATGAATATCAAAAGAAAAAAGGG + Intronic
1037374636 8:18214240-18214262 ATGAAAACCAAAAAGTAGAGAGG - Intronic
1038061517 8:23919033-23919055 ATGCATAGGAAAAAGGAGTAAGG - Intergenic
1038186275 8:25277923-25277945 ATGATTAGCAAAAAGAAAAAAGG - Intronic
1038846151 8:31231212-31231234 ATGAAAATAAAAAAGGTCAAAGG - Intergenic
1039377853 8:37054652-37054674 GTGCATATCAAAAAGTAAAAAGG - Intergenic
1039595306 8:38786399-38786421 GAAAATCTCAAAAAGGAGAATGG + Intronic
1039716327 8:40113480-40113502 ATGAATATCTAACAGAAAAAGGG - Intergenic
1040020884 8:42739904-42739926 CTGAATTCCAAAAAGGAGGAGGG + Intergenic
1040752180 8:50723785-50723807 ATGGAAAAAAAAAAGGAGAAAGG + Intronic
1040985386 8:53288403-53288425 AGGAATATGCAGAAGGAGAAAGG - Intergenic
1041235950 8:55802483-55802505 AAGAAGAACAAAAAGGTGAATGG + Exonic
1041567742 8:59299625-59299647 CTGAATAATAAAAAGTAGAATGG + Intergenic
1042100564 8:65271510-65271532 GTGAAGATGAAAAAGGAGGACGG + Intergenic
1042133412 8:65611275-65611297 ATCAATATCAGAAATGAGAGAGG - Intronic
1042235408 8:66607351-66607373 ATAAACATTAAAAAGAAGAAAGG - Intronic
1042684884 8:71427184-71427206 ATCAATATCCAAAAAGAGAAGGG - Intronic
1042818466 8:72904071-72904093 ATAAAAATAAAAAACGAGAAAGG - Intronic
1043007449 8:74837169-74837191 ATGTATATCAAAAAATATAAAGG - Intronic
1043158282 8:76814343-76814365 ATCAATATGATAAAAGAGAATGG + Intronic
1043304750 8:78780987-78781009 ATAAAGATCAAAAAAGATAAAGG - Intronic
1043524044 8:81076945-81076967 ATGATTATGAAGAATGAGAATGG + Intronic
1043706881 8:83361204-83361226 AGAAACATCAAAAAGGAGCAGGG + Intergenic
1043716040 8:83488109-83488131 CTGAATTTCAAAAGGGAAAAGGG + Intergenic
1043911830 8:85873464-85873486 AGGAAAATCAACAAAGAGAAAGG - Intergenic
1044020014 8:87094489-87094511 AAAAATATCAAAAAGGAAGAAGG + Intronic
1044022336 8:87120421-87120443 AACAATATCAGAAAGGAAAAAGG - Intronic
1044690656 8:94874245-94874267 ATGCATATCAAAAAAAAAAACGG - Intronic
1045731497 8:105247138-105247160 ACAAATATCAAAAAGTAAAATGG + Intronic
1045837923 8:106545475-106545497 GTGGATATTATAAAGGAGAAAGG + Intronic
1045892138 8:107169853-107169875 AGGATTCTCAAAAATGAGAAGGG - Intergenic
1046113082 8:109750753-109750775 ATGAATATCAAAAAAAAGAGTGG - Intergenic
1046560773 8:115834506-115834528 ATGAAAAAAAAAAAGAAGAAGGG - Intergenic
1046699713 8:117386388-117386410 ATGCTTATTAACAAGGAGAAGGG - Intergenic
1046973889 8:120251889-120251911 AAGAGTAGCAAAAAGGAAAAAGG - Intronic
1047089561 8:121558623-121558645 ATGAAAACCAACAAGGAGTATGG + Intergenic
1048279275 8:133093052-133093074 CTGAATAGCAAACAGCAGAAGGG - Intronic
1048298669 8:133235378-133235400 ATGAATATGGAAAAGTGGAAAGG + Intergenic
1048600318 8:135913043-135913065 ATCAATATTAAAAAAGAGAGAGG + Intergenic
1048725905 8:137383807-137383829 ATGAAAATCAAACAGAAGAGTGG - Intergenic
1049485773 8:142859344-142859366 AGGAATTTCAAAACGGAGGACGG - Intronic
1050202862 9:3165955-3165977 ATGAAGAATAAAAGGGAGAAAGG - Intergenic
1050574464 9:6978924-6978946 ATGAATATTAATAAGGTCAAAGG + Intronic
1050637997 9:7633007-7633029 ATGAATATCAAACATCAAAAAGG - Intergenic
1051589780 9:18765957-18765979 ATGAAGATCTAAGAGAAGAATGG + Intronic
1051712401 9:19945470-19945492 ATGAACATGGAAAAGGGGAAAGG - Intergenic
1051937589 9:22462043-22462065 ATGGATCTGAGAAAGGAGAAGGG + Intergenic
1051954540 9:22675221-22675243 ATGAATATAAAACATGAAAAAGG - Intergenic
1052099422 9:24426382-24426404 TAGAATATGAAAAAGGAGAGAGG - Intergenic
1052659372 9:31408346-31408368 AAGTGTTTCAAAAAGGAGAATGG - Intergenic
1052882296 9:33609565-33609587 AAGAATATCAACAAAGAGATTGG + Intergenic
1053058540 9:35009375-35009397 ATGCAAAGCAAAAAAGAGAATGG + Intergenic
1053286444 9:36852376-36852398 CTGAGTCTCAGAAAGGAGAAGGG + Intronic
1053458066 9:38246452-38246474 ATGAATTTGAAAAAAGAAAATGG - Intergenic
1053494024 9:38536176-38536198 AAGAATATCAACAAAGAGATTGG - Intergenic
1055041255 9:71875645-71875667 ATAAATGTCAAAAATGATAAAGG + Intronic
1055218875 9:73903554-73903576 ATGAATATAAAATAGGAGCATGG - Intergenic
1055312574 9:74998312-74998334 ATGAATACCAAAAAAATGAAAGG - Intronic
1055372434 9:75614436-75614458 CTAAATATCATCAAGGAGAAGGG - Intergenic
1055387763 9:75781856-75781878 ATGAAAATCATGAAAGAGAACGG + Intergenic
1055841215 9:80506497-80506519 AAGAATATTAAAAAGAAGAAGGG - Intergenic
1055960842 9:81818779-81818801 AGGAATCTAAAAATGGAGAAGGG - Intergenic
1056922166 9:90801092-90801114 AGGAATGTCCAAAAGGAAAAGGG + Intergenic
1057527587 9:95816476-95816498 ATCTATTTCAAAAAGGACAAGGG + Intergenic
1057905447 9:98979522-98979544 ATGAATACCCAAAAGAAAAATGG - Intronic
1058291563 9:103247996-103248018 ATTAATATAACAAGGGAGAAAGG + Intergenic
1058922086 9:109626892-109626914 ATGAATATGAAAAATTAAAAGGG + Intergenic
1059884097 9:118726317-118726339 ATAATGATCAAAAAGGACAAAGG - Intergenic
1059912108 9:119056004-119056026 ATGCACATAAAAAAGTAGAAAGG - Intergenic
1059941760 9:119366881-119366903 AGGAATATTAAAGAGCAGAAAGG - Intronic
1060704383 9:125784707-125784729 AGGAAAAACAAAAAGAAGAAAGG + Intronic
1061469476 9:130812570-130812592 ATGAATGTCACCAAGGATAAAGG + Intronic
1061756306 9:132814887-132814909 GTAAATATCAAAAAGGAGCCGGG + Intronic
1062330399 9:136040434-136040456 ATTAAAATAAAATAGGAGAACGG + Intronic
1062672328 9:137718649-137718671 ATGAACAGCAAGAAGGGGAAGGG - Intronic
1185745206 X:2567057-2567079 ATGACTGTCAATAAGGATAAAGG - Intergenic
1185817358 X:3168727-3168749 CTGAATTCCAAAAAGGAGGAGGG + Intergenic
1186026196 X:5315858-5315880 ATGAAAGACAAAAAAGAGAATGG + Intergenic
1186428716 X:9486057-9486079 ATGAATTCCAAAAGGGAGGAGGG - Intronic
1186651894 X:11570066-11570088 ATCAAGAGGAAAAAGGAGAAGGG + Intronic
1186973947 X:14879386-14879408 ATGAAGGTGAAAAAGGAAAATGG - Intronic
1187591856 X:20725508-20725530 TTCAATCTCAAAAAGGTGAAGGG - Intergenic
1187642000 X:21301855-21301877 GTAAATATCAAGAAGGAGTAAGG + Intergenic
1187705755 X:22007778-22007800 ATTAATGTCAAAAAAGACAAAGG + Intergenic
1187837648 X:23451349-23451371 ATAAAAATCAAAAAGTAAAATGG - Intergenic
1187897163 X:23993028-23993050 ATGGAAATCAAACAGGAGTAGGG - Intronic
1188055670 X:25538290-25538312 AGGAATATTAAATAGGAGAAAGG - Intergenic
1188399436 X:29726823-29726845 ATAAAAATAAAAAAAGAGAAGGG + Intronic
1188646055 X:32568663-32568685 ATGAGTATCAAAAATGATGATGG + Intronic
1188757417 X:33979838-33979860 CTACATACCAAAAAGGAGAATGG + Intergenic
1188863266 X:35284317-35284339 ATGAATATGAAATATGAAAAGGG + Intergenic
1189064924 X:37797127-37797149 ATGACTGTGAAAAAGGGGAAGGG + Intronic
1189188081 X:39071140-39071162 CTGAATTCCAAAAGGGAGAAGGG + Intergenic
1189555414 X:42139843-42139865 AATAATATCACAAAGGAGGAGGG - Intergenic
1189727690 X:43985115-43985137 AAGAAAATCCAAAAGGATAAGGG + Intergenic
1190237431 X:48627503-48627525 ATAAATTCCAAAAAGTAGAATGG + Intergenic
1190421299 X:50287308-50287330 ATGAATATTTTAAAGCAGAAGGG - Intronic
1190549998 X:51570282-51570304 ATCAATAAGAAAAAGGGGAAGGG - Intergenic
1190821402 X:53976755-53976777 ACCAATATCAAGAATGAGAAGGG + Intronic
1191071804 X:56408865-56408887 ATGGAAATCAAAAAGTAGCAGGG - Intergenic
1192907279 X:75565097-75565119 ATGAAAAACAAAAAGAAGCAGGG - Intergenic
1193370035 X:80684637-80684659 TTTAAAATCAAGAAGGAGAAAGG - Intronic
1193459185 X:81769984-81770006 TTATATATAAAAAAGGAGAAAGG + Intergenic
1193789987 X:85806104-85806126 ACAAAGATCAAAAAGGACAAAGG - Intergenic
1194063756 X:89237282-89237304 ATGAAGGTCAAAAGTGAGAAAGG + Intergenic
1194511865 X:94806548-94806570 AGGAATATGAAAAAGGTGGATGG - Intergenic
1194662683 X:96644190-96644212 AGGAATATAAAAAATGAGACTGG + Intergenic
1195696351 X:107670471-107670493 AAGACTATCAACAGGGAGAAGGG + Intergenic
1195946778 X:110222650-110222672 AGGAATATGTAAAAAGAGAAAGG + Intronic
1196153335 X:112399151-112399173 ATCAATATCAGAAATGAGAGTGG - Intergenic
1196406621 X:115369391-115369413 ATGAATATGAAAAAAAAGCATGG - Intergenic
1196567121 X:117221436-117221458 ATGAATAAGAAAAAGGAGAGGGG - Intergenic
1197261517 X:124324547-124324569 ATCTATATTAAAAAGAAGAATGG + Intronic
1197457142 X:126691115-126691137 AAGAACATGAAGAAGGAGAAGGG + Intergenic
1198331666 X:135628189-135628211 AAAAATATCAAAAAAGAAAAAGG - Intergenic
1198429628 X:136552699-136552721 CTGGATCTCAAAAAGGTGAAAGG + Intronic
1198740579 X:139837918-139837940 AACAAAAACAAAAAGGAGAAGGG + Intronic
1199316576 X:146385545-146385567 ATGAAAAAGAAAAAGGAGAGTGG + Intergenic
1199321417 X:146443799-146443821 ACTAATATCAAAAATGAAAAAGG + Intergenic
1199378471 X:147139976-147139998 ACGAATGCAAAAAAGGAGAAAGG - Intergenic
1199431390 X:147764292-147764314 ATTAATAAAAAAGAGGAGAATGG - Intergenic
1200663946 Y:5997451-5997473 ATCAATAACAAAAAGGAAAGTGG + Intergenic
1200717928 Y:6571388-6571410 ATGAAGGTCAAAAGTGAGAAAGG + Intergenic
1201233667 Y:11890192-11890214 AGGAACATCAAGAAGGTGAAAGG + Intergenic
1202341937 Y:23878760-23878782 ATTCATATCAAAAAGTAGGAAGG - Intergenic
1202528831 Y:25791325-25791347 ATTCATATCAAAAAGTAGGAAGG + Intergenic