ID: 908238640

View in Genome Browser
Species Human (GRCh38)
Location 1:62170659-62170681
Sequence AGGAGGATCTTGAACCCGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908238636_908238640 0 Left 908238636 1:62170636-62170658 CCAGCTATTCGGGAAGCTGAGGC 0: 123
1: 6740
2: 118417
3: 282501
4: 290461
Right 908238640 1:62170659-62170681 AGGAGGATCTTGAACCCGGAAGG No data
908238632_908238640 10 Left 908238632 1:62170626-62170648 CCTGTAAATCCCAGCTATTCGGG 0: 5
1: 70
2: 414
3: 1264
4: 3013
Right 908238640 1:62170659-62170681 AGGAGGATCTTGAACCCGGAAGG No data
908238634_908238640 1 Left 908238634 1:62170635-62170657 CCCAGCTATTCGGGAAGCTGAGG 0: 135
1: 7531
2: 127828
3: 314582
4: 333562
Right 908238640 1:62170659-62170681 AGGAGGATCTTGAACCCGGAAGG No data
908238630_908238640 25 Left 908238630 1:62170611-62170633 CCGGGCTTGGGGGCGCCTGTAAA No data
Right 908238640 1:62170659-62170681 AGGAGGATCTTGAACCCGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908238640 Original CRISPR AGGAGGATCTTGAACCCGGA AGG Intergenic
No off target data available for this crispr