ID: 908242894

View in Genome Browser
Species Human (GRCh38)
Location 1:62202842-62202864
Sequence CTACAAATACAGATTTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908242894_908242899 7 Left 908242894 1:62202842-62202864 CCCAGCTAAATCTGTATTTGTAG No data
Right 908242899 1:62202872-62202894 AGGGTTTCACCATGTTGGCCAGG 0: 29630
1: 119747
2: 180457
3: 189702
4: 141729
908242894_908242900 8 Left 908242894 1:62202842-62202864 CCCAGCTAAATCTGTATTTGTAG No data
Right 908242900 1:62202873-62202895 GGGTTTCACCATGTTGGCCAGGG 0: 1776
1: 3305
2: 3986
3: 3422
4: 2764
908242894_908242898 2 Left 908242894 1:62202842-62202864 CCCAGCTAAATCTGTATTTGTAG No data
Right 908242898 1:62202867-62202889 GAGACAGGGTTTCACCATGTTGG 0: 31762
1: 84237
2: 130975
3: 115475
4: 69762

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908242894 Original CRISPR CTACAAATACAGATTTAGCT GGG (reversed) Intronic
No off target data available for this crispr