ID: 908244285

View in Genome Browser
Species Human (GRCh38)
Location 1:62215393-62215415
Sequence CTCAATATACAAACATACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908244285_908244286 -6 Left 908244285 1:62215393-62215415 CCATTGTATGTTTGTATATTGAG No data
Right 908244286 1:62215410-62215432 ATTGAGTCTCTTCCACCTGAAGG No data
908244285_908244287 0 Left 908244285 1:62215393-62215415 CCATTGTATGTTTGTATATTGAG No data
Right 908244287 1:62215416-62215438 TCTCTTCCACCTGAAGGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908244285 Original CRISPR CTCAATATACAAACATACAA TGG (reversed) Intergenic
No off target data available for this crispr