ID: 908246439

View in Genome Browser
Species Human (GRCh38)
Location 1:62230974-62230996
Sequence GGGCTGGATGACTCCACTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908246436_908246439 -7 Left 908246436 1:62230958-62230980 CCTTCTGCAAGGCTGTGGGCTGG No data
Right 908246439 1:62230974-62230996 GGGCTGGATGACTCCACTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908246439 Original CRISPR GGGCTGGATGACTCCACTGT GGG Intergenic
No off target data available for this crispr