ID: 908247764

View in Genome Browser
Species Human (GRCh38)
Location 1:62241563-62241585
Sequence CCGACCAAATGCCAGGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 1, 2: 0, 3: 35, 4: 235}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908247764_908247770 27 Left 908247764 1:62241563-62241585 CCCAGGGCCTGGCATTTGGTCGG 0: 1
1: 1
2: 0
3: 35
4: 235
Right 908247770 1:62241613-62241635 AATGCTGCACAAGAACCTAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908247764 Original CRISPR CCGACCAAATGCCAGGCCCT GGG (reversed) Intronic
900411619 1:2515102-2515124 TGGAGCAAATGCCAGGCCCTGGG - Intronic
900558753 1:3293117-3293139 CCGGCCAAGTGCCAGGAGCTGGG - Intronic
901812690 1:11776804-11776826 CCCAGCCAATGTCAGGCCCTGGG + Intronic
903070982 1:20726903-20726925 CCGAGCTAAGGCCAGGACCTAGG + Intronic
904277315 1:29392838-29392860 CTGACTGAGTGCCAGGCCCTGGG - Intergenic
904310388 1:29625546-29625568 CTGACTACATGTCAGGCCCTGGG + Intergenic
904895290 1:33812759-33812781 TTGACCACATCCCAGGCCCTGGG - Intronic
905494795 1:38376391-38376413 CCAACCATGTGCCAGGCTCTGGG + Intergenic
906680136 1:47720592-47720614 CCTGCTATATGCCAGGCCCTGGG + Intergenic
907558205 1:55363926-55363948 CCTACCATGTTCCAGGCCCTAGG - Intergenic
907681719 1:56570085-56570107 CCTACTATATGCCAGGCCCCAGG - Intronic
908247764 1:62241563-62241585 CCGACCAAATGCCAGGCCCTGGG - Intronic
908789950 1:67771254-67771276 CTGACTAAGTGCCAGGCACTGGG + Intronic
910093441 1:83492674-83492696 CCCACGACATGCCAGGCACTGGG - Intergenic
911053594 1:93692834-93692856 CCTAGCAAGTGCCAGGCACTGGG - Intronic
911400096 1:97363788-97363810 CCCACCCCATGACAGGCCCTGGG - Intronic
912434922 1:109655019-109655041 CCTACCATATTCCAGGCACTGGG - Intergenic
912723740 1:112041409-112041431 CAGACCAAAGGCCAGGCCTGAGG - Intergenic
914785945 1:150830967-150830989 CCTGCCATATGCCAGGCACTGGG + Intronic
916744126 1:167671134-167671156 CCTACAACATGCCAGACCCTAGG - Intronic
918118289 1:181515822-181515844 CCAACTATATGCCAGGCACTGGG - Intronic
918397013 1:184123554-184123576 CCTACTAAATGACAGGCCCTGGG + Intergenic
920021388 1:202958751-202958773 CCTACCATGTGCCAGGCCCTGGG + Intergenic
920312123 1:205054648-205054670 CAGACCAGATCCCAGCCCCTTGG - Intronic
922594198 1:226801177-226801199 TCTACTACATGCCAGGCCCTTGG - Intergenic
1063142563 10:3268340-3268362 CCTACTACATGCCAGGCACTGGG - Intergenic
1065189789 10:23198828-23198850 CCGAACAAAGGCCAGGGCCGGGG + Intergenic
1068525746 10:58127537-58127559 CACACCAACTGCCAGGCTCTTGG + Intergenic
1068868980 10:61923483-61923505 CCGACTCTATGCCAGGCACTGGG - Intronic
1068957312 10:62829832-62829854 CCTACTGAGTGCCAGGCCCTGGG + Intronic
1069948099 10:72001158-72001180 CACACCACGTGCCAGGCCCTGGG - Intronic
1070365367 10:75731776-75731798 CCACCCATGTGCCAGGCCCTGGG - Intronic
1072660552 10:97361058-97361080 CCTACTAAGTGCCAGGCCCTGGG + Intronic
1072847316 10:98845989-98846011 CACACCACATGCCAGGCCCAAGG - Intronic
1074813704 10:117129129-117129151 CCTACCAAATGCCAGGCCCTGGG + Intronic
1076022435 10:127085089-127085111 CCCTCCAAATTCCAGGCCCAAGG - Intronic
1076381434 10:130026970-130026992 CCCACCTGCTGCCAGGCCCTGGG + Intergenic
1078531881 11:12142950-12142972 ACTTCCAAATGCCAGGTCCTGGG + Intronic
1079109169 11:17594466-17594488 CAGACCTAGTGCCAGGCACTGGG - Intronic
1080922628 11:36723953-36723975 ACTACCAAATCCCAGGCCATGGG + Intergenic
1081997537 11:47375043-47375065 CCTACCACATGCCAGGGCCATGG - Intronic
1082866916 11:57908435-57908457 CCCACCCACTGACAGGCCCTGGG + Intergenic
1082887857 11:58107267-58107289 CCCACCCAATGACAGGCTCTGGG + Intronic
1082908279 11:58337679-58337701 CTTACCAAATGTCAGCCCCTTGG + Intergenic
1083883581 11:65559710-65559732 CCGACCACCTGCCAGGCACAGGG + Intergenic
1085410700 11:76288741-76288763 CCCAGCAAATGCCTGGACCTAGG + Intergenic
1086324443 11:85683436-85683458 GCGACCAAGTGCCAGGTGCTGGG - Intergenic
1087297814 11:96398074-96398096 CTCACCAGATGCCAGGGCCTTGG + Intronic
1088575098 11:111263928-111263950 CCTACCATGTGCCAAGCCCTTGG - Intronic
1089139509 11:116274678-116274700 CCCAGTGAATGCCAGGCCCTGGG - Intergenic
1089390031 11:118095148-118095170 CCTGCCATGTGCCAGGCCCTAGG + Intronic
1089565520 11:119369210-119369232 CCAACAAAATGCCAGGCCAGGGG - Intronic
1089625354 11:119747771-119747793 CCTACTATGTGCCAGGCCCTAGG + Intergenic
1090227695 11:125081570-125081592 CCGACCCAGTGCTAGGCCCATGG + Intronic
1090426511 11:126610572-126610594 CTCAACAAATGCCAGGCACTGGG + Intronic
1091288481 11:134422793-134422815 CCTACTGAAGGCCAGGCCCTGGG - Intergenic
1091391046 12:126117-126139 CCCTCGCAATGCCAGGCCCTTGG + Intronic
1091674398 12:2478365-2478387 CCAACCAGCAGCCAGGCCCTAGG - Intronic
1095139769 12:38647282-38647304 CCTACTGAAAGCCAGGCCCTGGG + Intronic
1095627431 12:44333266-44333288 CAAACAATATGCCAGGCCCTGGG + Intronic
1096964049 12:55610783-55610805 ACTATCAAATGCCAGGCCCCAGG + Intergenic
1101082886 12:101207438-101207460 CTGAACACATGCCAGGCACTGGG - Intronic
1101173202 12:102120714-102120736 CCTACTAAATGCCTGGCACTAGG + Intronic
1102415131 12:112755057-112755079 CCTACTAAGTGCCAGGCACTAGG - Intronic
1103597290 12:122031451-122031473 CTGACCATCTGCCAGGCCCTGGG + Intronic
1103971418 12:124675218-124675240 CCTACTATATGCCAGGCCCTGGG + Intergenic
1104714560 12:131007659-131007681 CTGTCCAATTTCCAGGCCCTCGG - Intronic
1106317778 13:28610087-28610109 CCTCCCTAATCCCAGGCCCTGGG + Intergenic
1106585077 13:31050032-31050054 CTGTCCAAATGCCAGGACCCAGG - Intergenic
1112404980 13:99111437-99111459 CACACTATATGCCAGGCCCTGGG + Intergenic
1116539892 14:46088756-46088778 ATGACCATATGCCAAGCCCTAGG - Intergenic
1117282992 14:54258683-54258705 TCCACCAGGTGCCAGGCCCTGGG + Intergenic
1120701844 14:87706671-87706693 CCTACCAAATTCTATGCCCTGGG - Intergenic
1121048479 14:90804712-90804734 TCGACCAGGTGCCAAGCCCTGGG - Intronic
1121182660 14:91941436-91941458 CCTAGAAAATGTCAGGCCCTGGG - Intronic
1121827261 14:97020623-97020645 CCCACCATGTGCCAGGCTCTGGG - Intergenic
1122174817 14:99909050-99909072 CCCACCCCATGCCTGGCCCTGGG + Intronic
1122642815 14:103170555-103170577 CAGACCAAACACCAGGCCATGGG - Intergenic
1124914367 15:33954638-33954660 CCCACCCCATGACAGGCCCTGGG - Intronic
1125282817 15:38060848-38060870 AGGATCACATGCCAGGCCCTGGG + Intergenic
1125471709 15:40010931-40010953 CCTAACAAAGGCCAGGCTCTGGG - Intronic
1126482035 15:49135347-49135369 CCTTCCACATGCCAGGCACTGGG + Intronic
1126820223 15:52495918-52495940 CCCACCCCACGCCAGGCCCTGGG - Intronic
1127384339 15:58454749-58454771 CTCACCAAACCCCAGGCCCTGGG - Intronic
1127654582 15:61044280-61044302 TAACCCAAATGCCAGGCCCTTGG + Intronic
1127862494 15:63005959-63005981 CCCACCCACTGACAGGCCCTGGG + Intergenic
1128453084 15:67818407-67818429 CCTACTAAGTGCCAGGCCCTGGG + Intergenic
1129162875 15:73756790-73756812 CCTACCAGGTGCCAGGCACTGGG - Intergenic
1129230234 15:74192990-74193012 CCTACCATATGTCAGGCCCCGGG - Intronic
1129464127 15:75714281-75714303 CCTACCGTATGCCAGGCCCTGGG - Intergenic
1129969993 15:79769686-79769708 CCTACCATGTGCCAGGCCCTTGG + Intergenic
1130126458 15:81098034-81098056 CAGGCTAAATGCCAGGCACTGGG + Intronic
1130299038 15:82666290-82666312 CAGTCCAAATCCCAGGCCCCAGG - Intronic
1132398534 15:101490613-101490635 CCTACCACACGGCAGGCCCTGGG - Intronic
1132915743 16:2342125-2342147 CCGACCTAATGCAACGCCCCGGG + Intergenic
1133219148 16:4311473-4311495 CTGACAACATGCCAGGCCCTGGG + Intergenic
1134630414 16:15752227-15752249 CTAACCATATGCCAGGCTCTGGG - Intronic
1135134654 16:19878695-19878717 CTGCCCAAGTGCCAGGCACTGGG - Intronic
1135152225 16:20018709-20018731 CCCACCCCATGACAGGCCCTGGG - Intergenic
1135231974 16:20716840-20716862 CAGACCCAATACCAGGCCGTGGG - Intronic
1140451653 16:75075638-75075660 CCCATCATATGCCAGGCTCTAGG + Intronic
1140732599 16:77870273-77870295 CCTACTAAATGCCAGGCACTCGG + Intronic
1144734470 17:17547306-17547328 GCTGCCAAGTGCCAGGCCCTGGG + Intronic
1144769406 17:17751234-17751256 CCGACCAAATGTCACCTCCTCGG - Intronic
1145780871 17:27562263-27562285 CCCACCACATGCCAGGCACTGGG - Intronic
1146912229 17:36656276-36656298 CCTACTATATGCCAGGCCCTGGG + Intergenic
1146950400 17:36901438-36901460 CCTGCCAGATGCCAGGCCCTCGG + Intergenic
1147170107 17:38613411-38613433 CTCCCCACATGCCAGGCCCTGGG + Intergenic
1147531406 17:41281592-41281614 CCCACCCCATGACAGGCCCTGGG - Intergenic
1147783080 17:42957824-42957846 CCTACCAAATGCAAGGCACAGGG + Intronic
1147899533 17:43774970-43774992 CCAACCAAATGGCAGCCCCAGGG + Intronic
1148237363 17:45977790-45977812 CCTACCATATGCCAGGCACCAGG + Intronic
1149240682 17:54645178-54645200 CCCACCCCATGACAGGCCCTGGG - Intergenic
1151143140 17:72014656-72014678 CCCACCCCATGACAGGCCCTGGG - Intergenic
1151422850 17:74009796-74009818 CCCTCCAGATGCCAGGCTCTGGG + Intergenic
1152461541 17:80444702-80444724 CTGGCCAAAGGCCAGGCTCTGGG + Intergenic
1153381238 18:4441853-4441875 CCAACCAATTGTCAGGCACTGGG + Intronic
1153488639 18:5627696-5627718 CCTACTAAATGCCAGACTCTGGG + Intronic
1155170917 18:23266328-23266350 CCTACTGTATGCCAGGCCCTGGG - Intronic
1155384226 18:25259674-25259696 CCTACCATGTGCCAGGCACTGGG + Intronic
1155555917 18:27019198-27019220 CCTACCAAATGCAAAGCTCTAGG + Intronic
1156030278 18:32705087-32705109 CCTACTAAGTGCCAGGCCTTGGG + Intronic
1156353456 18:36321602-36321624 CCCACCAAATGCCAGTCACTGGG + Intronic
1157584408 18:48791947-48791969 CCTACCACGTGCCAGGCCCTGGG + Intronic
1161798440 19:6401422-6401444 CCCACCACATGCCAGGAACTGGG - Intergenic
1162101350 19:8341031-8341053 ACACCCAAATCCCAGGCCCTGGG + Intronic
1162126350 19:8501604-8501626 CCTACCATGTTCCAGGCCCTGGG - Intronic
1162373768 19:10293436-10293458 CCGCCCAAATACCACGCCCTAGG - Intronic
1164563248 19:29308510-29308532 CCTTCCACATGCCAGGTCCTGGG - Intergenic
1164678096 19:30115813-30115835 ACGTACAAGTGCCAGGCCCTGGG - Intergenic
1164696328 19:30247258-30247280 CCAAGCAAAGGCCAGGACCTGGG - Intronic
925756530 2:7138280-7138302 CCCACCCCATGACAGGCCCTAGG - Intergenic
929581366 2:43083464-43083486 CTGGCCAGATCCCAGGCCCTGGG - Intergenic
931581585 2:63781209-63781231 CAGTCCAAATGCCAGGACTTGGG + Intronic
932215242 2:69962057-69962079 CCTACCACATGCCAGGCACTGGG + Exonic
934539756 2:95164066-95164088 CCCACCCACTGGCAGGCCCTAGG - Intronic
934976263 2:98804969-98804991 CCCACTAGGTGCCAGGCCCTGGG + Intronic
937014107 2:118587838-118587860 CCCACCAAATGCTCGGGCCTAGG - Intergenic
938066621 2:128285118-128285140 CCGACCACCAGCCAAGCCCTGGG + Intronic
938937143 2:136137072-136137094 TCTACCAAGTGCCAGGCACTGGG + Intergenic
938992521 2:136643906-136643928 ACCACCAAAGGCCATGCCCTAGG - Intergenic
941924714 2:170883689-170883711 CTGACCATATCCCAGTCCCTGGG + Intergenic
948156699 2:235788919-235788941 CTGACCAACTGCCAGGCTCCAGG - Intronic
948787960 2:240362885-240362907 CCGACCACCTGCCCAGCCCTGGG + Intergenic
1169535322 20:6532737-6532759 CCCTCCAAATGCCCAGCCCTGGG - Intergenic
1170877221 20:20261698-20261720 CCCAAGAAATGCCAGGCCCTTGG - Intronic
1172004965 20:31812772-31812794 CCTACTGAATGTCAGGCCCTAGG + Intergenic
1172081509 20:32344760-32344782 CTCACCACATGCCAGGCACTAGG - Intergenic
1172128224 20:32638123-32638145 ACCCCCAAATGCCAGGTCCTTGG - Intergenic
1172205991 20:33163290-33163312 TCCACCAAAAGCCAGGCCCCAGG + Intronic
1172894656 20:38292121-38292143 CAGAGCAAAGCCCAGGCCCTTGG + Intronic
1173142707 20:40498366-40498388 CCAACCATGTACCAGGCCCTGGG + Intergenic
1173170996 20:40723754-40723776 CCTACTATGTGCCAGGCCCTGGG + Intergenic
1173821712 20:46023857-46023879 CCTACTAAGTGCCAGGCTCTGGG - Intronic
1174416426 20:50370142-50370164 CCTACTAGGTGCCAGGCCCTGGG - Intergenic
1174557726 20:51407713-51407735 CCTTCCAAATGCCAGGCACGCGG - Intronic
1174585107 20:51602339-51602361 CCTACTAAGTGCCAGGCCCAAGG + Intronic
1175175586 20:57109868-57109890 CCCACCAAGGGCCAGGCCCTGGG + Intergenic
1175325894 20:58128400-58128422 CCTACCATATGCCAAGCACTGGG - Intergenic
1175571766 20:60028415-60028437 CCTACTACATGTCAGGCCCTGGG - Intronic
1175640300 20:60623920-60623942 CCAATCCTATGCCAGGCCCTGGG + Intergenic
1175702192 20:61147634-61147656 CCCGCCACATGCCAGGCACTGGG + Intergenic
1178856990 21:36258609-36258631 ACGCCCAACGGCCAGGCCCTCGG - Intronic
1181456040 22:23060787-23060809 CCTGCCACGTGCCAGGCCCTGGG - Intronic
1181749207 22:24977107-24977129 CCGACAACATGCCCGGCACTGGG - Intronic
1182357388 22:29728449-29728471 TCTACCAAGTGCCAGGCTCTGGG - Intronic
1182764202 22:32746768-32746790 ACCTGCAAATGCCAGGCCCTGGG - Intronic
1183015886 22:34986227-34986249 CCCACAATATGCCAGGCCCTGGG + Intergenic
1183512625 22:38244983-38245005 CCGACCACAGGCCAGGAGCTGGG - Intronic
1183546563 22:38457223-38457245 CCCACCACATACCAGCCCCTGGG + Intergenic
1183734240 22:39635234-39635256 CCGACTAAGTGCCAGGCCCCAGG + Intronic
1184109350 22:42385742-42385764 CCCACCCTGTGCCAGGCCCTGGG - Intronic
1184429878 22:44436196-44436218 CCTACTAAGTGCCAGGCTCTGGG - Intergenic
1184566538 22:45295389-45295411 CTGACCCTGTGCCAGGCCCTGGG - Intronic
1184709460 22:46240047-46240069 CCCACCAAAGGCCAGGCTGTCGG - Exonic
949936509 3:9120174-9120196 CCTACCATGTGCCAGACCCTGGG - Intronic
950139679 3:10606823-10606845 CCTACTATGTGCCAGGCCCTGGG - Intronic
951730033 3:25800062-25800084 CTGACTAAAGGCCAGGCCTTTGG + Intergenic
953984015 3:47427604-47427626 CCGACCTGCTGCCAGGCCTTAGG - Exonic
954189896 3:48951548-48951570 CCCACCAAGTTCCAGGCCCAGGG - Intronic
954893613 3:53956072-53956094 CCTACCATGTGCCAGGCACTGGG - Intergenic
955217944 3:57000122-57000144 CTTACCATATGCCAGGCACTCGG - Intronic
955891639 3:63656302-63656324 CCTACAACATGCCAGGGCCTGGG + Intronic
955958819 3:64318124-64318146 CTGACCACATGCCAGGCACTGGG + Intronic
956074968 3:65495514-65495536 CCCAACACATGCCAGGCACTGGG + Intronic
956192443 3:66620692-66620714 CAGCCCAACTGCCAGGCCCTGGG - Intergenic
956587686 3:70881945-70881967 CCAACCCAAAGCAAGGCCCTTGG + Intergenic
956792749 3:72692848-72692870 CCCACCAAGTACCAGGCACTAGG - Intergenic
957642391 3:82872981-82873003 CCTACCAAATCCCAAGTCCTTGG + Intergenic
958493693 3:94813918-94813940 CAGATCAAATACCAGGTCCTAGG - Intergenic
959682105 3:109107467-109107489 CTTACTAAATGCCAGGCACTGGG - Intronic
960276219 3:115732313-115732335 CCCACCCCATGACAGGCCCTGGG + Intergenic
960961228 3:123071825-123071847 CTGACGACATGCCAGGCCCTGGG - Intronic
961001637 3:123378201-123378223 CTGGCCAAATCCCAGTCCCTGGG + Intronic
961005962 3:123405548-123405570 CATACCAAATGCAAGGCCCGTGG + Intronic
961083442 3:124045673-124045695 CCTACTAAGTGCCAGGCACTGGG + Intergenic
961359014 3:126356122-126356144 CTGACCCAATGGCAAGCCCTTGG - Intronic
962056230 3:131874421-131874443 CCTACCACATACCAGGCACTGGG + Intronic
963752728 3:149199847-149199869 CTGCCCAAATGACAGGACCTGGG + Exonic
966778142 3:183560971-183560993 CTCATCAAATGCCTGGCCCTGGG + Intergenic
966834522 3:184038770-184038792 CAGGGCAGATGCCAGGCCCTGGG + Exonic
966993650 3:185258972-185258994 CCTACCACCTGACAGGCCCTGGG + Intronic
970421951 4:15913229-15913251 CCTACTAAACGCCAGGCCCCAGG - Intergenic
971474985 4:27064465-27064487 CCAACCAACTGCCAGGAGCTAGG - Intergenic
971529186 4:27662770-27662792 CAGACCCAATACCAGGCCGTGGG - Intergenic
974077657 4:57182382-57182404 CTGACAAAGGGCCAGGCCCTGGG - Intergenic
976549993 4:86382562-86382584 CCGACTTTATGCCAGGCACTGGG - Intronic
986043195 5:4012688-4012710 CCCACCAAATACCAGGCAATGGG + Intergenic
986740624 5:10702164-10702186 CAGACCATGTGCCAGGCGCTGGG - Intronic
987150516 5:15034818-15034840 CTCACCAGATGCCAGCCCCTCGG - Intergenic
987419819 5:17706102-17706124 CCTACCATATGCCAGGCACTGGG - Intergenic
990078273 5:51878967-51878989 CCTACCAAGTGCCAAGCACTGGG - Intergenic
992382817 5:76255614-76255636 CCTACCAAATCCCAGTCCGTGGG + Intronic
996563563 5:124856401-124856423 TCTACTAAATGCCAGGCCCTGGG - Intergenic
997602493 5:135150098-135150120 CCATCCAAAGGCCAGGCCGTGGG + Intronic
998339289 5:141402962-141402984 CCAACCAAATGCCAGCTCCGCGG + Exonic
998504197 5:142658896-142658918 CCTACCACATGCCAGGCACTGGG - Intronic
999253319 5:150195470-150195492 CCTACCACCTGTCAGGCCCTGGG + Intronic
1000957367 5:167559026-167559048 CCCACTATGTGCCAGGCCCTGGG - Intronic
1001434973 5:171693245-171693267 CCTACCATATGCCAGGCTCTGGG - Intergenic
1001454696 5:171851790-171851812 CCAACCAAGTGCCAGGCATTGGG + Intergenic
1001949697 5:175807739-175807761 CCTGCTAAATGCCAGGCTCTGGG + Intronic
1002053732 5:176586524-176586546 CCGACCTAATGTCTGGCCCTGGG + Intronic
1002574150 5:180161953-180161975 CCCAGCACATCCCAGGCCCTGGG - Intronic
1003049671 6:2767765-2767787 CCTACCAAATGCCAGGCAAGAGG + Intronic
1004282168 6:14289505-14289527 CCCACCCCATGACAGGCCCTGGG - Intergenic
1005008474 6:21313392-21313414 CCGGCGATGTGCCAGGCCCTGGG + Intergenic
1007152940 6:39712788-39712810 CCAACCACATGACAGGCTCTGGG - Intronic
1007225387 6:40310021-40310043 CCCACTGATTGCCAGGCCCTGGG + Intergenic
1007753582 6:44084445-44084467 CAGACCAGCTGCCAGGGCCTGGG + Intergenic
1007965675 6:46001608-46001630 CCTACCAGGTGCCAGGCCCTGGG - Intronic
1009571056 6:65385507-65385529 CCCACCATATGCCAGTCACTAGG + Intronic
1010190148 6:73186946-73186968 CCTACCCCATGACAGGCCCTGGG + Intronic
1011194376 6:84766610-84766632 CCGCCCCAATCCCAGGCTCTCGG + Intergenic
1011606229 6:89109043-89109065 CCTACCATGTGCCAGGCTCTAGG + Intronic
1013231057 6:108162889-108162911 CCCACTATATGCCAGACCCTGGG - Intronic
1015125998 6:129755461-129755483 CCCACCAACTCCTAGGCCCTTGG + Intergenic
1015585545 6:134772579-134772601 CAGCCCAACTGCCAGGCCCAGGG - Intergenic
1015675753 6:135746483-135746505 CCGACCCACCGACAGGCCCTGGG - Intergenic
1019491087 7:1314002-1314024 AAGACCAAAAGCCAGGGCCTTGG + Intergenic
1020016744 7:4835840-4835862 CCGAGCAAATGCCAGGCGCAGGG - Intronic
1021497634 7:21293652-21293674 CAGACCAAATGACAGATCCTGGG + Intergenic
1021631992 7:22656647-22656669 CTCACCATATGCCAGGCCCTGGG + Intergenic
1022473708 7:30697236-30697258 CCCACCAGAAGCCAGGACCTGGG + Intronic
1023668732 7:42554134-42554156 ACTACCATATGCCAGGCTCTGGG + Intergenic
1023861149 7:44218343-44218365 CCGACCAAACCCCAAGCCCCAGG + Exonic
1024822368 7:53347897-53347919 CCCACCCCATGACAGGCCCTGGG - Intergenic
1025254210 7:57372613-57372635 CCTACTATGTGCCAGGCCCTGGG + Intergenic
1032475542 7:132209163-132209185 TCAACCAAAGGCCAGGCCATGGG + Intronic
1037662687 8:20941021-20941043 ACGACCAGAGGCCAGGCCCCTGG - Intergenic
1038003675 8:23411956-23411978 CCTTCCAAGTGCCATGCCCTTGG - Intronic
1039634525 8:39148588-39148610 CAGACCAAAAGCCCTGCCCTCGG - Intronic
1042654652 8:71082731-71082753 CTGACTACATGCCAGGCACTGGG - Intergenic
1044366056 8:91347091-91347113 CCTACCACATGCCAGGTCCTGGG - Intronic
1047293646 8:123551923-123551945 CCCACCCCATGACAGGCCCTGGG - Intergenic
1047933350 8:129751741-129751763 ATGACCAAACGCCAGGCCCTAGG + Intronic
1048768511 8:137869697-137869719 TTGACCAAATGCTAGCCCCTGGG - Intergenic
1048920544 8:139225979-139226001 CCGTCCACAGGCCAGGTCCTTGG - Intergenic
1049075469 8:140392614-140392636 CACACCAAAGGCCAGGCACTCGG - Intronic
1052882172 9:33608282-33608304 AAGAGCAAATGCCAAGCCCTGGG - Intergenic
1053494146 9:38537475-38537497 AAGAGCAAATGCCAAGCCCTGGG + Intergenic
1054953385 9:70879614-70879636 TCTACCAGATGCCAGGCACTGGG - Intronic
1055317376 9:75047701-75047723 CCCACCAGGTGCCAGGCACTTGG + Intergenic
1059732801 9:117073564-117073586 CCAACCTAATTCCTGGCCCTAGG - Intronic
1060437244 9:123604534-123604556 CCCACCACATGCCAGACACTGGG + Intronic
1060518989 9:124283223-124283245 CCTACTATGTGCCAGGCCCTGGG - Intronic
1062037976 9:134391137-134391159 CCGGCCCCATGCCAGGCCCCAGG + Intronic
1062439326 9:136562678-136562700 CTGACCACAAGCCAGGCCCAGGG - Intergenic
1186586985 X:10885704-10885726 CTCACCACATGCCAGGCACTGGG + Intergenic
1190753856 X:53383791-53383813 CCTACCAAGTGCCAGACACTGGG + Intronic
1199428308 X:147729249-147729271 TCAAACAAATGCCAGGCACTGGG + Intergenic
1200165516 X:154032638-154032660 CCCACCACATGCAAGGCCCCAGG + Intronic