ID: 908247931

View in Genome Browser
Species Human (GRCh38)
Location 1:62242733-62242755
Sequence TGGGAATGTCTTTGGAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908247931_908247935 13 Left 908247931 1:62242733-62242755 CCAGTTTTCCAAAGACATTCCCA No data
Right 908247935 1:62242769-62242791 GCTAACATCTAAGCCTCCATAGG No data
908247931_908247937 27 Left 908247931 1:62242733-62242755 CCAGTTTTCCAAAGACATTCCCA No data
Right 908247937 1:62242783-62242805 CTCCATAGGAAAGATGAATACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908247931 Original CRISPR TGGGAATGTCTTTGGAAAAC TGG (reversed) Intronic
No off target data available for this crispr