ID: 908249326

View in Genome Browser
Species Human (GRCh38)
Location 1:62252700-62252722
Sequence CAGGTGACCCACCTTGATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 171}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908249326_908249331 25 Left 908249326 1:62252700-62252722 CCAAGATCAAGGTGGGTCACCTG 0: 1
1: 0
2: 0
3: 14
4: 171
Right 908249331 1:62252748-62252770 TAGCAAATGCCTTCTCAAGATGG 0: 1
1: 0
2: 2
3: 17
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908249326 Original CRISPR CAGGTGACCCACCTTGATCT TGG (reversed) Intronic
900881515 1:5385048-5385070 CAGATGGCCCTCCTTGTTCTAGG + Intergenic
901788414 1:11639915-11639937 CAGGTGAATCACCTGAATCTGGG + Intergenic
903662439 1:24986530-24986552 CAGGTGACCCTCCATAATGTGGG + Intergenic
904116352 1:28164711-28164733 CAGGGGACACAGCTTGTTCTAGG - Intronic
904354265 1:29928431-29928453 CAGATGGCCCTCCTTGATGTAGG - Intergenic
906613932 1:47222343-47222365 GAGGTTACCCAGCTTGATCAAGG - Intronic
908249326 1:62252700-62252722 CAGGTGACCCACCTTGATCTTGG - Intronic
912894088 1:113567315-113567337 CAGGGGACCCACCTGGTCCTGGG - Intronic
913087106 1:115449220-115449242 CAAGTGACCCACCCTGACCAAGG - Intergenic
916073221 1:161184043-161184065 TAGGTGCCCCTCCTTGATCATGG + Intergenic
916623865 1:166532247-166532269 CAGGAGCCCCACGTTTATCTTGG + Intergenic
917894309 1:179473260-179473282 CAGGTGATCCACCCCCATCTTGG - Intronic
921480536 1:215659829-215659851 CAGCAGAGCCACCTTGAACTTGG + Intronic
921671827 1:217933618-217933640 CTGGTGAACAAACTTGATCTTGG + Intergenic
1063146424 10:3298820-3298842 GAGGTGACCCACGCTGCTCTAGG + Intergenic
1065905729 10:30249421-30249443 CAGATGACCCTCCATGATGTGGG + Intergenic
1066404546 10:35106247-35106269 CACCAGACACACCTTGATCTTGG + Intergenic
1066426674 10:35313553-35313575 CAGGTGGTTCACCTTGCTCTGGG + Intronic
1067226610 10:44380640-44380662 CAAGTGTCCAACCTTGAACTTGG - Intronic
1067715135 10:48684999-48685021 CAGGTAGGCCACCTTGCTCTTGG + Intronic
1067807412 10:49402652-49402674 TAGGAGACCCACATTGGTCTGGG + Intergenic
1070811366 10:79299719-79299741 CGTGTGACCCACTTTGATCTTGG + Intronic
1071366303 10:84903908-84903930 CAGGTGACCCACCTGGGGCTGGG + Intergenic
1074406532 10:113184402-113184424 CAGGCGACCCAGCTTGGACTTGG - Intergenic
1074499092 10:114006237-114006259 CAGGTGATCCACCTTGGCCTCGG + Intergenic
1075635947 10:124030318-124030340 CTGTTGACACACCTTGATATGGG - Intronic
1079965289 11:26972539-26972561 CAGATGTCCCCCCTTGACCTTGG - Intergenic
1084310142 11:68312319-68312341 CAGGTGACACACCTGGCTCCGGG + Intergenic
1084368957 11:68725378-68725400 CATTTATCCCACCTTGATCTAGG + Intronic
1084414460 11:69023244-69023266 CAGGTGATCCGCCTTGGCCTTGG + Intergenic
1084959657 11:72709850-72709872 CAGGTGACCCTCCATCTTCTTGG - Exonic
1089630069 11:119778956-119778978 AAGGTGACCCAGCCAGATCTGGG - Intergenic
1089698580 11:120230689-120230711 CAGGTGACCCAACTTTCTCAAGG + Intergenic
1090090915 11:123696953-123696975 CATGCCACCCACCTTGATCTTGG + Intergenic
1095946649 12:47757764-47757786 CTGGTGGCCCAGCTTGCTCTGGG - Intronic
1097263751 12:57734327-57734349 CAGGTGCCCCAGCTTCCTCTCGG + Exonic
1097281841 12:57849681-57849703 CAGGTGATCCACCTGCCTCTTGG + Intergenic
1097990475 12:65826532-65826554 CAGTTTCCCCACCTTGCTCTCGG - Intronic
1098430667 12:70416258-70416280 TAGGTGCCCCTCCTTCATCTGGG - Intronic
1100620801 12:96270738-96270760 CAGGAGAATCACCTGGATCTGGG + Intergenic
1100786530 12:98084547-98084569 CAGGTCAACCACTTTGATTTTGG - Intergenic
1101043010 12:100776266-100776288 CAGGTTCCCCAGCCTGATCTGGG + Intronic
1102534753 12:113573055-113573077 CACGTGACTCACCTGGAACTGGG + Intergenic
1106282234 13:28285531-28285553 CAGGTGAACCCCTTTAATCTTGG + Intronic
1106758486 13:32845334-32845356 CAGGTGATACAGCTTGAGCTGGG - Intergenic
1107543331 13:41413615-41413637 CAGAAGCCCCACCTTGATTTGGG - Intergenic
1109129556 13:58564712-58564734 CAGATGCCACTCCTTGATCTTGG + Intergenic
1110242760 13:73287037-73287059 CAGGTGATCCGCCTTGGCCTTGG + Intergenic
1110253157 13:73403167-73403189 CAGGTGATCCCCCTTGGCCTTGG + Intergenic
1112251216 13:97782278-97782300 CAGGTGACCCATCCTGCTATGGG + Intergenic
1113365185 13:109669261-109669283 CAGGTGCCCAGCCTTGCTCTGGG + Intergenic
1115095595 14:29631892-29631914 CAGGAGAATCACCTTAATCTAGG - Intronic
1115163961 14:30427326-30427348 CAAGGGATCCACCTTCATCTGGG + Intergenic
1118761418 14:68882446-68882468 CATGGGACCCACCTCCATCTTGG + Exonic
1118787065 14:69054811-69054833 GAGGTCATCCACTTTGATCTGGG + Exonic
1119126522 14:72132375-72132397 CAGGTGATTCTCCTTGAACTCGG + Intronic
1120592066 14:86388218-86388240 CAGATAACCAAACTTGATCTTGG - Intergenic
1121346181 14:93137362-93137384 CTGTTGTCCCACCATGATCTCGG - Intergenic
1121981659 14:98459864-98459886 CAGATGACCCACCAAGGTCTTGG - Intergenic
1122713242 14:103676231-103676253 CAGGTGAGCCACCTGGACCCAGG - Intronic
1123691887 15:22845018-22845040 CAGGTGAACCACATGGAGCTTGG + Intronic
1124416041 15:29473950-29473972 CAGGAGGCCCAGCTTGATGTGGG - Intronic
1124888470 15:33709682-33709704 CAGATGCACCTCCTTGATCTTGG + Intronic
1126729734 15:51670631-51670653 CAGGTGTGACCCCTTGATCTTGG + Intergenic
1130929055 15:88408618-88408640 GATGTGCCCCACCTTGACCTTGG - Intergenic
1132957146 16:2600402-2600424 CAGGTGCCCCGCCTTTCTCTGGG + Exonic
1132969489 16:2678814-2678836 CAGGTGCCCCGCCTTTCTCTGGG + Intergenic
1134155943 16:11843505-11843527 CAGGTGACCCTCCTGGAGGTAGG - Intronic
1134762646 16:16727785-16727807 CTGCTGTCCTACCTTGATCTTGG + Intergenic
1134983406 16:18631363-18631385 CTGCTGTCCTACCTTGATCTTGG - Intergenic
1135732443 16:24906384-24906406 TAGGTGTCCCAGCTTCATCTGGG + Intronic
1137552274 16:49445844-49445866 CAGGTTTCCCACCTTGATTTTGG - Intergenic
1138094729 16:54202781-54202803 CAGCTGACCCAAGTAGATCTGGG - Intergenic
1139428053 16:66895449-66895471 CAGGAGACCCAGCTTGGGCTGGG - Intronic
1139514634 16:67445946-67445968 TAGGTGCCTCACCTTGACCTTGG - Intronic
1140459526 16:75128214-75128236 CAGGAGCCCCACGTTTATCTTGG + Intergenic
1142638830 17:1273244-1273266 CAGGTGATCCACCTGCCTCTGGG - Intergenic
1142957186 17:3530015-3530037 CAGGAGACCCACGTCGATGTTGG + Exonic
1144901695 17:18599453-18599475 CAAGTGGCCCACATTGATATTGG - Intergenic
1144929377 17:18846607-18846629 CAAGTGGCCCACATTGATATTGG + Intronic
1146890982 17:36506444-36506466 CATCAGACCCACCTTGAACTTGG + Exonic
1146989793 17:37259340-37259362 CAGGTGAGTCTCCCTGATCTGGG - Exonic
1150515907 17:65809017-65809039 CAGATGTAGCACCTTGATCTTGG + Intronic
1152396232 17:80035562-80035584 CAGGTGCCCCTCCGTGATCCAGG + Intronic
1155026321 18:21943982-21944004 CAGGGTTCACACCTTGATCTGGG + Intergenic
1157188208 18:45558639-45558661 CAGGTGACCCAACCTGACTTTGG - Intronic
1158893239 18:61892775-61892797 CAGGTAACCCCCCACGATCTGGG - Exonic
1161673773 19:5630518-5630540 CAGGTGATCCACCTGCATCGTGG - Intronic
1166327933 19:42062627-42062649 CTCGGGACCCACCTTGATGTGGG + Exonic
926845498 2:17133223-17133245 CAAGTGGCCCACCTTTATCACGG + Intergenic
926860009 2:17299794-17299816 AAGGGAACTCACCTTGATCTAGG + Intergenic
927507347 2:23623113-23623135 AAGCTGTCCCACCCTGATCTCGG + Intronic
927952647 2:27183375-27183397 CAGGTGATCCTCCATGACCTCGG - Intergenic
929759207 2:44792099-44792121 CAGGTGAACCTCCTGGACCTGGG + Intergenic
930197132 2:48521263-48521285 CAGGAGAACCACCTGAATCTGGG + Intergenic
931766131 2:65458218-65458240 CAGGGGGCCCACCTTAATCGAGG + Intergenic
937774350 2:125758108-125758130 CATGTGACACACCTTGGTCGTGG + Intergenic
938049100 2:128150941-128150963 CAGGTGAATCACCTGAATCTGGG - Intronic
941394213 2:164955119-164955141 CAGGTCACCTACCTTCACCTGGG - Intronic
941836567 2:170027571-170027593 AAGATGATCCACCTTCATCTTGG + Intronic
942958873 2:181806011-181806033 CAGGAGACCCACTTTATTCTAGG + Intergenic
948148122 2:235723862-235723884 CAGATGGCCCACCTTCCTCTCGG - Intronic
1168896807 20:1329215-1329237 CAGCTGACTCACCTTGGACTGGG + Intronic
1169479919 20:5970405-5970427 CAGGTGACCCACTAGCATCTGGG + Intronic
1170058751 20:12237383-12237405 CAGGAGGCCCACTTTAATCTGGG + Intergenic
1172446974 20:34998344-34998366 CAGCTCCTCCACCTTGATCTTGG - Exonic
1174358173 20:50011864-50011886 CAGGTGACCCTCCAGGATATGGG + Intergenic
1176337817 21:5615363-5615385 CAGGAGACTCACCTTGGTGTTGG - Intergenic
1176339225 21:5678436-5678458 CAGGAGACTCACCTTGGTGTTGG - Intergenic
1176471479 21:7110589-7110611 CAGGAGACTCACCTTGGTGTTGG - Intergenic
1176495040 21:7492367-7492389 CAGGAGACTCACCTTGGTGTTGG - Intergenic
1176505602 21:7646020-7646042 CAGGAGACTCACCTTGGTGTTGG + Intergenic
1178337728 21:31758732-31758754 CAAGTCACCCCCCTTAATCTTGG + Intergenic
1179438690 21:41378969-41378991 CAGCAGCCCCACCTTGCTCTGGG - Intronic
1180938730 22:19642979-19643001 CAGGAGCCCCTCCTTGATCCAGG - Intergenic
1181494307 22:23279398-23279420 CTGGTGACCCTCCTTGCTCCTGG + Intronic
1182230286 22:28832583-28832605 CAGGTGATCCACCTGCCTCTCGG - Intergenic
1184303721 22:43580032-43580054 CAGGTGACTCCCCTTGCTCCTGG + Intronic
1184820741 22:46907741-46907763 CCAGGGACCCACCTTGAACTGGG + Intronic
1185119137 22:48955356-48955378 CAGGAGACCCACCTGGAGCCTGG - Intergenic
950026027 3:9820495-9820517 CAGGTTACCTGCCTTGATATGGG + Intronic
951337753 3:21444923-21444945 CAGGTCACACACCTTGACTTGGG + Intronic
951429824 3:22593564-22593586 CAGGTTATCCACCCTGATTTGGG + Intergenic
957192022 3:77021883-77021905 CAGATGAAGCCCCTTGATCTTGG + Intronic
960286430 3:115834945-115834967 CAGGTGATACATCTTGGTCTTGG + Intronic
960450911 3:117806908-117806930 CAGGTGTATCCCCTTGATCTTGG - Intergenic
962551415 3:136496049-136496071 CAGGAGAACCACTTGGATCTGGG + Intronic
968451847 4:679608-679630 CAAGTGACCCACCTTCCTCTCGG + Intronic
969271399 4:6105767-6105789 CAGCTCGCCCTCCTTGATCTTGG + Exonic
970644211 4:18100858-18100880 CAGGTGACCCATTTTAAACTTGG - Intergenic
976129789 4:81871723-81871745 CAGGTGCACCAGCTAGATCTGGG - Intronic
976442561 4:85092263-85092285 CATGTTGCCCACGTTGATCTTGG + Intergenic
978651012 4:111005172-111005194 AAGGTGACCCAGCTTGAACACGG - Intergenic
980946254 4:139323290-139323312 CAGGTGATGCACCTTGGCCTTGG + Intronic
982458794 4:155641906-155641928 CAGGTGACTCACCTGAATCTGGG + Intergenic
982742729 4:159074619-159074641 TAAGTGACCCACCATGATCCTGG + Intergenic
984908689 4:184652033-184652055 GAGGTGACAGAACTTGATCTGGG + Exonic
986560430 5:9055097-9055119 CAGGTGGCCCACCTGAATCTGGG + Intronic
989202045 5:38773437-38773459 AAGGGCACCTACCTTGATCTTGG + Intergenic
992214187 5:74509076-74509098 CAGGTGTCCCTCCTTGACCTTGG + Intergenic
999440780 5:151599029-151599051 GAGGTGCCCCAGCTGGATCTTGG - Intergenic
1003030913 6:2599789-2599811 CAGATGACCCTCCATGATGTGGG - Intergenic
1006390728 6:33756837-33756859 CAGGGGACACGCCTTGAACTGGG - Intergenic
1006730344 6:36231389-36231411 GAGGGGACCCGCCTTGATCCAGG - Exonic
1006937682 6:37729751-37729773 CTGCTGACACACCTTGATTTTGG - Intergenic
1015095675 6:129412311-129412333 CAGGTCACCCTCCATGATGTTGG - Intronic
1019017754 6:168892144-168892166 CAGGTTTTCCACCTGGATCTTGG + Intergenic
1019017798 6:168892380-168892402 CAGGTTTTCCACCTGGATCTGGG + Intergenic
1019017811 6:168892459-168892481 CAGGTTTTCCACCTGGATCTCGG + Intergenic
1019017840 6:168892618-168892640 CAGGTTTTCCACCTGGATCTGGG + Intergenic
1019017880 6:168892856-168892878 CAGGTTTTCCACCTGGATCTGGG + Intergenic
1019488365 7:1299723-1299745 CAGATGCCCCACCCTGACCTGGG - Intergenic
1021147824 7:17110762-17110784 CAGGAGACCCAAGTTTATCTTGG + Intergenic
1022603437 7:31784350-31784372 TAGGTGACTCACCTTGCTTTGGG + Intronic
1022732061 7:33036371-33036393 CTGGTGACCCATCTTGCTTTCGG + Intronic
1023336628 7:39177330-39177352 CAGGTGCCCCCACTTGATCACGG - Intronic
1025665908 7:63583117-63583139 CAGATGACCCTCCCTGACCTGGG + Intergenic
1027878982 7:83808222-83808244 CAGGGGTGACACCTTGATCTTGG + Intergenic
1028928015 7:96381446-96381468 CAGGTGAGCCACCTTTACCTTGG + Intergenic
1034068987 7:148164422-148164444 TAGGTGACCCACCCTGACCTTGG - Intronic
1034192378 7:149222273-149222295 CACCTGACCCACCTGGACCTTGG - Intronic
1036946782 8:13101576-13101598 TTGATGACCCACCTTGATCCAGG - Intronic
1037650916 8:20837863-20837885 CAGGAGACAAACCTTGATCTGGG + Intergenic
1040639742 8:49319482-49319504 CAGCTGGCTCACCTTGTTCTTGG - Intergenic
1044345212 8:91096936-91096958 CAGATGGCCCACCTCTATCTTGG - Intergenic
1049241666 8:141540481-141540503 CAGGAGGGACACCTTGATCTGGG - Intergenic
1049729488 8:144168585-144168607 CAGGTTACCCACCCTGACATAGG - Intronic
1049740964 8:144240667-144240689 CAGGTGCCCCACCTTCTCCTGGG - Exonic
1052373122 9:27688427-27688449 CAGATGACCCATGTTCATCTTGG - Intergenic
1052636044 9:31105810-31105832 CAGGTGATCCACCCTCACCTTGG + Intergenic
1055589089 9:77791027-77791049 CAGGGAATCCACCTTGATCAAGG + Intronic
1056814593 9:89792154-89792176 CAGGGGTCTCACCTTGACCTGGG + Intergenic
1062326468 9:136014857-136014879 CAGGTGTCCCACCAGGGTCTGGG + Intronic
1062428463 9:136516743-136516765 CAGGAGATCCTCCTTGATCTGGG - Intronic
1062640169 9:137514771-137514793 CAGGTGACCCACCTGCAGCCCGG - Intronic
1203423851 Un_GL000195v1:19553-19575 CAGGAGACTCACCTTGGTGTTGG + Intergenic
1186510087 X:10124318-10124340 CAGGAGTCCCACGTGGATCTGGG - Exonic
1194196610 X:90902654-90902676 CTGCTGAGCCACCTTGAACTGGG + Intergenic
1197647378 X:129032816-129032838 CAGCTGCCCCACCTTGAGCGTGG - Intergenic
1199706124 X:150426966-150426988 CTGCTGACACACCTTGATCTTGG - Intronic
1199952986 X:152719956-152719978 CAGGTGAACCACCTGGCTCCGGG - Intergenic
1199956697 X:152748490-152748512 CAGGTGAACCACCTGGCTCCGGG + Intergenic
1199988683 X:152971160-152971182 CAGAAGACACACCTTGAGCTAGG + Intronic
1201236707 Y:11918959-11918981 AATGTGCCCCACCTTGAGCTTGG - Intergenic
1202328004 Y:23712913-23712935 CAGGAGAACCACCTGAATCTGGG + Intergenic
1202542766 Y:25957139-25957161 CAGGAGAACCACCTGAATCTGGG - Intergenic