ID: 908256034

View in Genome Browser
Species Human (GRCh38)
Location 1:62304480-62304502
Sequence CTGGATTGGAAGCAGGTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 195}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908256034_908256041 5 Left 908256034 1:62304480-62304502 CCCTGGACCTGCTTCCAATCCAG 0: 1
1: 0
2: 0
3: 18
4: 195
Right 908256041 1:62304508-62304530 TCCCCTTCTAGCTCTGCACTGGG 0: 1
1: 0
2: 1
3: 15
4: 189
908256034_908256040 4 Left 908256034 1:62304480-62304502 CCCTGGACCTGCTTCCAATCCAG 0: 1
1: 0
2: 0
3: 18
4: 195
Right 908256040 1:62304507-62304529 CTCCCCTTCTAGCTCTGCACTGG 0: 1
1: 0
2: 1
3: 23
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908256034 Original CRISPR CTGGATTGGAAGCAGGTCCA GGG (reversed) Intronic
900548216 1:3240572-3240594 CTGGTATGGAAGCAGCTCCGTGG + Intronic
901533422 1:9867475-9867497 CTGGAGGGGAAGCATGTGCAGGG + Intronic
901671017 1:10856526-10856548 CTGGCTTGGAGGCAGGTCTGGGG - Intergenic
902080772 1:13819122-13819144 CTGGGGTGGAAGCAAGTCCCGGG - Intronic
902243991 1:15107287-15107309 CTGGAGTGGAAGCAGGCCCTGGG - Intronic
902514312 1:16981471-16981493 CTGGATTAGATGCAGGGCTAAGG - Intergenic
904208511 1:28870746-28870768 CTGGAAAGGAAGAAGGTCCCGGG + Intergenic
904368927 1:30036146-30036168 CTGGGTGGGAAGCAGGACCCAGG - Intergenic
904988716 1:34573998-34574020 CTGGTTGGGGAGCAAGTCCAGGG - Intergenic
905655426 1:39683689-39683711 CTGGATTGGAATCAGGAACCCGG + Intronic
906295402 1:44646252-44646274 GTGGATTGGAGGCCGGTGCAGGG + Intronic
906329726 1:44875291-44875313 CTGGATTGGTTACAGATCCAAGG + Intronic
906713555 1:47950932-47950954 CTCTACTGGAAGCAGGCCCAAGG - Intronic
907329629 1:53662590-53662612 CTGGTTTGGAGGCAGCTACAGGG + Intronic
908256034 1:62304480-62304502 CTGGATTGGAAGCAGGTCCAGGG - Intronic
911058954 1:93731532-93731554 CTGGAAAGGAAGAAGGTACAAGG + Intronic
915403984 1:155645137-155645159 TGGGATTGGAAGGAGGTCCTAGG - Intergenic
917336048 1:173925358-173925380 CTGAACTGGAAGCAGGGCTAGGG - Intergenic
918334730 1:183497443-183497465 CAGGATTGGTAGGAGTTCCAGGG + Intronic
918391955 1:184074638-184074660 GTTGATTGGAAGCAGGTCATAGG + Intergenic
1071430235 10:85601394-85601416 TTGGTCTGGAAGAAGGTCCATGG - Exonic
1071876774 10:89851066-89851088 GTGGGTGGGAAGCAGATCCAGGG + Intergenic
1071947411 10:90661462-90661484 CTGTATAGGAAGCATGTCTAGGG + Intergenic
1073522444 10:104146190-104146212 CTGGATTGGAGGAAGGTTAAAGG - Intronic
1074528567 10:114281248-114281270 CTGGGTTGGCAGCAGCTCCTGGG - Intronic
1076176344 10:128371013-128371035 CTGTATGGGAAGCAGGGCTATGG + Intergenic
1077015272 11:396494-396516 CTGGATTGGAGGCTGCTCCTAGG + Intronic
1078991339 11:16649220-16649242 CTAGATTGCTAGCAGGGCCAGGG - Intronic
1079177168 11:18153087-18153109 CTGGTTTGAAACCAGATCCAAGG + Intronic
1083782038 11:64923755-64923777 CTGGATGAGCAGCTGGTCCATGG - Intronic
1084273996 11:68042718-68042740 CTGGATGCGCAGCAGGTCCCGGG - Exonic
1084303932 11:68269491-68269513 CTGTGTTGGGAGCAGGCCCATGG - Intronic
1084335435 11:68454978-68455000 CTGGATTGGGAGCAAATGCAGGG - Intergenic
1088550568 11:111008911-111008933 CTGGCTTGGGAACGGGTCCAAGG + Intergenic
1089350273 11:117818126-117818148 CTGGTTAGGAAGCAGGTCCCAGG + Intronic
1089614925 11:119689873-119689895 CTGCTTTGGAAGCAGGTGGAGGG - Intronic
1090354590 11:126131522-126131544 GTGGATTAGAAGCAAGTCCCAGG - Intergenic
1091918186 12:4284030-4284052 CTGGATTGCAGGCAGATGCAGGG - Intronic
1091995387 12:4988946-4988968 CTGGACTGGAAGGGGGTTCAAGG - Intergenic
1095584965 12:43839391-43839413 CTGGATGGGGAGCAGGTGCAGGG - Intronic
1095992216 12:48043097-48043119 CTGTATTTGGACCAGGTCCAGGG + Exonic
1096812121 12:54177778-54177800 GAGGATTGGAAGCTGGTCTAGGG - Intronic
1098871034 12:75817286-75817308 CTGAATTGGATGCTGGTTCAGGG + Intergenic
1102860363 12:116330952-116330974 GTGGAATGGGAGCATGTCCAGGG + Intergenic
1106081414 13:26503420-26503442 CAGGATTGGAAGCAGAACCAGGG - Intergenic
1107121865 13:36804742-36804764 TTGGATTGGAACCGGATCCATGG + Intergenic
1107708608 13:43131303-43131325 CTGGATTCCAGGCAGTTCCAGGG - Intergenic
1109476882 13:62891014-62891036 CTGGAGTGGAAGGAGGAACATGG + Intergenic
1110139789 13:72114422-72114444 GTGGATTGGAAGCAAGTTCTAGG + Intergenic
1113369432 13:109709361-109709383 ATGGACTGGTACCAGGTCCATGG + Intergenic
1116539247 14:46078233-46078255 CTGGATTGGATCCTGGACCAGGG - Intergenic
1118322063 14:64759163-64759185 GTGGATAGGAAGCAGGGCCATGG - Intronic
1118368815 14:65118514-65118536 CTGGTTTGGTAAGAGGTCCAAGG + Intergenic
1119248034 14:73129823-73129845 CTGGGTTGAAATCAGGCCCATGG + Intergenic
1120923190 14:89773323-89773345 CTGCATGGGAAGCTGGTTCATGG + Intergenic
1126765414 15:52006615-52006637 GTGGATTGGCAGCTGGTCTAGGG + Intronic
1127642914 15:60932278-60932300 CTGCCTTGGAATCTGGTCCAAGG - Intronic
1127817917 15:62628765-62628787 CTAGAGTGGAAGAAGGTACAGGG - Intronic
1128785079 15:70389250-70389272 CTTGACTTGAAGCAGGTCCTGGG - Intergenic
1129269726 15:74413208-74413230 CTGGTTTGGAAGGAGGTATAGGG - Intronic
1133799986 16:9077376-9077398 CTGGATTGGAGGCAGACCCTGGG - Intergenic
1134571966 16:15298815-15298837 CTGAATTTGAAGCAGATTCAGGG + Intergenic
1134730416 16:16457228-16457250 CTGAATTTGAAGCAGATTCAGGG - Intergenic
1134937015 16:18254668-18254690 CTGAATTTGAAGCAGATTCAGGG + Intergenic
1138400776 16:56741464-56741486 CTGGATTGGAACCAGGTGTTTGG + Intronic
1139441627 16:66970862-66970884 CTGGCCTGGAAGCAGGTGCTCGG - Intronic
1140606829 16:76549123-76549145 CTGGGTTGGAAGGAAGTCCGGGG + Intronic
1141691508 16:85599421-85599443 CCAGATTGGGGGCAGGTCCAGGG - Intergenic
1141867054 16:86757575-86757597 ATGGATTTGAAGCAGGTTCCAGG + Intergenic
1142206010 16:88783649-88783671 CTGCACTGGGAGCAGGTCCCAGG + Intronic
1143670533 17:8393033-8393055 CAGGCTGGGCAGCAGGTCCAGGG + Exonic
1143975393 17:10825568-10825590 CTGGCTGGGCAGCAGGTCCTTGG + Exonic
1149319893 17:55472050-55472072 CTGGGTTGAAATCAGGCCCATGG - Intergenic
1149470572 17:56912599-56912621 CTGGATACGAGGCTGGTCCATGG + Intronic
1149638981 17:58191145-58191167 CAGGTTTGGAAACAGGTCCATGG + Intergenic
1149994229 17:61398566-61398588 CCCGATTGGAAGCAGGTGCGTGG + Intergenic
1151341142 17:73471731-73471753 AGGCATTGGAAGCAGGTGCAAGG + Intronic
1152352726 17:79792440-79792462 CTGGCTGGAAAGAAGGTCCAAGG + Exonic
1152750060 17:82058535-82058557 CTGGCTTGGGAGCAGTTCCCAGG - Intronic
1153135263 18:1910739-1910761 CTAGATTGGAAGCAGCACCAAGG + Intergenic
1154359375 18:13646311-13646333 GTGGATTGTAATCAGGCCCAAGG + Exonic
1161741560 19:6024107-6024129 CTGGACAGGCAGCAAGTCCACGG - Intronic
925230357 2:2227424-2227446 CTGGTTTGGCAGCTGGTCTAAGG - Intronic
928071140 2:28218358-28218380 CTGGCTTGGATCCTGGTCCAGGG - Intronic
928375209 2:30768254-30768276 CTGGATTGGAATCAGGTACTGGG + Intronic
929234386 2:39590872-39590894 CTGGATGGCATGCAGATCCAGGG + Intergenic
930066226 2:47329679-47329701 CTGGAGTGGGGGCCGGTCCAGGG + Intergenic
933938956 2:87229637-87229659 GTGGATTGTAACCTGGTCCAAGG + Intergenic
936354179 2:111736138-111736160 GTGGATTGTAACCTGGTCCAAGG - Intergenic
937095239 2:119231041-119231063 CTGGCTAGGACGCAGATCCAAGG + Intronic
938556398 2:132428634-132428656 CTGCATTGTAAGCAGATCCCTGG + Intronic
939095425 2:137828121-137828143 CTGGACTGGAAGCAGGAGGAGGG + Intergenic
940492452 2:154381071-154381093 CTGGATTAGAAGCAAGTCATAGG + Intronic
942139267 2:172961099-172961121 CTGGATTGTAATCAGGTGGAAGG - Intronic
943903433 2:193470219-193470241 TGGGATTGGAAGGAGGTCCTAGG + Intergenic
944160615 2:196655657-196655679 CAGGAGTGCAAGCAGTTCCAGGG - Intronic
945159642 2:206876312-206876334 CTGGATTGAGAGCAGGTCGCTGG + Intergenic
946192229 2:218013658-218013680 AAGGCTTGGAGGCAGGTCCAGGG - Intergenic
946235472 2:218322347-218322369 CTGGAATGGAAGCAGGTGTGAGG - Intronic
948572735 2:238927644-238927666 CAGGATTGGGAGCAGCTGCAGGG + Intergenic
1168896148 20:1325159-1325181 CTGGGTTGGAGGCAGGCCCTAGG - Intronic
1169329155 20:4703097-4703119 CTGGATTGGAGGCGTGCCCAGGG + Intergenic
1169518497 20:6345137-6345159 ATGGATAGGAAGCAGGTCAAAGG - Intergenic
1169607282 20:7336690-7336712 CTAGATTCCAAGCAGGTCTATGG + Intergenic
1170591874 20:17777546-17777568 CTGGAATGGAGGGAGGTACACGG - Intergenic
1171961642 20:31498884-31498906 CAGGATTGGAAGGATGTCCCAGG + Intergenic
1173904634 20:46617262-46617284 CTGGGCTGGAAGCTGGTACAAGG + Intronic
1174543275 20:51306445-51306467 CTGCATTTGAAGCAGGAGCATGG + Intergenic
1174719350 20:52795185-52795207 CTGAATGGGAAACAGGGCCATGG + Intergenic
1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG + Intronic
1177062772 21:16395230-16395252 CTGGGTTGAAATCAGGCCCATGG + Intergenic
1177327202 21:19606621-19606643 CTGGATTGGATCCAGTTACAAGG - Intergenic
1181662449 22:24362251-24362273 CTGGCAGGGAAGCAGGTCCTGGG + Intronic
1182081296 22:27530744-27530766 GTGGATTAGAAGCAGGTCACAGG - Intergenic
1183248805 22:36713781-36713803 CTGAATTCCAAGCAGGCCCATGG - Intergenic
1184255306 22:43283086-43283108 CTGGATGAGGAGCAGGGCCAGGG - Intronic
1185388303 22:50546596-50546618 CTTGAGTGGAAGCCGGGCCATGG - Intergenic
1185402461 22:50626017-50626039 CAGGGTAGGCAGCAGGTCCAGGG + Exonic
949466688 3:4351817-4351839 GTGGATTTAAAGCAGGTCAAAGG + Intronic
950041709 3:9923967-9923989 CTGTACTGGAATCAGGTCCAGGG + Exonic
950497891 3:13345106-13345128 CTTGATTGGATGAAGATCCAGGG + Intronic
953701816 3:45201880-45201902 CTGCAATGGAAGCATGTCCCTGG - Intergenic
958019465 3:87979264-87979286 GTGGATTGGAAGGAGGTCCTGGG - Intergenic
961823870 3:129588711-129588733 CTGGGTTGGGGGCAGGTCCAGGG + Intronic
966010894 3:175075549-175075571 CTGGCTTGGAAGAAAGTCCCAGG - Intronic
967079458 3:186036010-186036032 CTTGGTTAGAAGCAAGTCCAGGG - Intergenic
967808184 3:193733343-193733365 CTGGGTAGGGAGCAGGTGCAGGG + Intergenic
968530770 4:1090240-1090262 CTGGCTGGCAAGCAGGGCCAAGG + Intronic
968977400 4:3829143-3829165 CTGCATTTGAACCAGGTCCAGGG + Intergenic
969055967 4:4402913-4402935 CTGGGAAGGAAGCAGATCCAGGG - Intronic
974566186 4:63580429-63580451 TGGGATTGGAAGGAGGTCCTGGG - Intergenic
980507623 4:133743469-133743491 CTGGATAGGAAGCATGGCTAGGG + Intergenic
981540881 4:145845256-145845278 CTTCATGGGAAGCAGCTCCATGG + Intronic
983620781 4:169758640-169758662 ATGGATGTGAAGGAGGTCCAAGG - Intergenic
983915778 4:173289132-173289154 TGGGATTGGAAGGAGGTCCTAGG - Intronic
985301874 4:188498639-188498661 CTGGCTTGGAAGATGGTCCTAGG + Intergenic
987103725 5:14616498-14616520 CTGTATTGGCAGGAGGTCCCTGG + Intergenic
990065780 5:51712562-51712584 CTGGAATGGAAGCAGGCCTAGGG - Intergenic
992385260 5:76278653-76278675 GAGAACTGGAAGCAGGTCCATGG + Intronic
992447850 5:76850134-76850156 CTGCACAGGAAGCAGGTCTAAGG + Exonic
994141562 5:96347290-96347312 CTGGAGTAGAAACAGGTTCATGG - Intergenic
994727515 5:103453966-103453988 CTGGGCTGGAGGCAGGGCCAGGG + Intergenic
997890776 5:137674261-137674283 CTGGAGTGGTATCAGGTTCATGG - Intronic
1001118425 5:168958854-168958876 ATGGATAGGAAGGAGATCCAAGG - Intronic
1001718268 5:173835335-173835357 CTTGATTGCAAGCAAGTCCCTGG - Intergenic
1001775921 5:174329036-174329058 GTGGATGGCAAGGAGGTCCAGGG + Intergenic
1001970728 5:175953138-175953160 CTGGTTAGGAAGCTGGGCCAGGG + Intronic
1002246710 5:177890627-177890649 CTGGTTAGGAAGCTGGGCCAGGG - Intergenic
1003151608 6:3556426-3556448 TTGGATTGGCACCATGTCCAGGG + Intergenic
1003511901 6:6788725-6788747 CTGGATTGGAGGAAGATGCAGGG - Intergenic
1005269228 6:24145727-24145749 CTGCATTGGAGGCACGTCCATGG + Exonic
1005843315 6:29758772-29758794 CTGTATTTGAGGCAGGACCATGG - Intergenic
1006068331 6:31478449-31478471 CTGTATTTGAGGCAGGACCATGG + Intergenic
1006718620 6:36135969-36135991 CTGGTGTGGAAGCTGGGCCATGG + Intronic
1007082301 6:39116424-39116446 CTGGATTGGAAGGAGGGAGAGGG + Intergenic
1010218037 6:73422235-73422257 ATTGATTGGAAGCAAGTCAAAGG - Intronic
1012187181 6:96233395-96233417 CTGGATTAGAAGAAGGTAGATGG - Intergenic
1012862798 6:104580735-104580757 CTGGCTTGGTACCATGTCCAAGG - Intergenic
1013565271 6:111352804-111352826 CTGGATTGGACGCAGGTGGTCGG - Intronic
1014294718 6:119604311-119604333 CAGAATAGGAAGCAGCTCCAGGG - Intergenic
1014867993 6:126555593-126555615 GCTGATTGGAAGCAGATCCATGG + Intergenic
1015827860 6:137335081-137335103 CTGGAATGGAAGGAGGTGCCTGG + Intergenic
1015892415 6:137981959-137981981 CAGGAGTGGGAGCAGGTCCCAGG - Intergenic
1017074470 6:150604817-150604839 CTGGATTGGGATAAAGTCCATGG + Intronic
1018677646 6:166236668-166236690 CTGGGCTGGAAGCACGCCCAGGG + Intergenic
1018838413 6:167501957-167501979 CTGCATTGGATGCAGCTGCAGGG + Intergenic
1020192895 7:6014004-6014026 TTAGCTTGGAAGCACGTCCATGG - Intronic
1021161285 7:17275977-17275999 TTGGGTTGGGAGCAGTTCCATGG + Intergenic
1023494516 7:40780178-40780200 CTGGATGGGAATCAGGTGCTGGG + Intronic
1024628337 7:51227480-51227502 CTTGCCTGGAAGAAGGTCCATGG - Intronic
1024802731 7:53099734-53099756 CAGGATTTGAAGGAAGTCCATGG - Intergenic
1025030727 7:55554623-55554645 CTGGATGGGAGGCAGTGCCATGG + Intronic
1026681638 7:72471581-72471603 CTGAAATGTATGCAGGTCCACGG + Intergenic
1029531835 7:101130519-101130541 CGGGATCTGAAGCTGGTCCAGGG + Exonic
1029746983 7:102521442-102521464 CTGGATAGGAGGCAGGAGCAGGG + Intergenic
1029764936 7:102620531-102620553 CTGGATAGGAGGCAGGAGCAGGG + Intronic
1030445142 7:109639762-109639784 CTGGAGGGAAAGCAGGTTCAAGG + Intergenic
1033290417 7:140078311-140078333 CTGAAATGGAAGCAAGGCCAGGG + Intergenic
1033648007 7:143319903-143319925 CTGGAGTAGAAACAGGTACAGGG + Intronic
1034822718 7:154231940-154231962 CTGGATGCGAAGCAGCACCATGG - Intronic
1034970160 7:155413680-155413702 CTGGGTGGGGAGCAAGTCCACGG + Intergenic
1035271663 7:157723410-157723432 CTGGAGTAGAAGCTGGTTCAGGG - Intronic
1037202308 8:16271314-16271336 TTTGATTGGAAGAAGGGCCAAGG + Intronic
1039569945 8:38578795-38578817 CTGGATTGCCAGCAGGGCCACGG - Intergenic
1043626179 8:82261593-82261615 ATGGATAGGAACCAGGCCCAAGG - Intergenic
1046538242 8:115544389-115544411 CTGGATTGGAGGCAGGTGGAAGG + Intronic
1047333743 8:123916834-123916856 CTGGTTTAGCAGGAGGTCCAGGG + Intronic
1048269702 8:133018802-133018824 CTGGCTGCTAAGCAGGTCCATGG + Intronic
1048435624 8:134414317-134414339 CAGGATAGGAAGCAGGAGCAAGG - Intergenic
1048464341 8:134652414-134652436 ATGGAATGGATGCAGATCCAAGG + Intronic
1048687308 8:136918899-136918921 TTGGAATGGAAGGAGGTCCTGGG - Intergenic
1049538006 8:143191401-143191423 CTGTACAGGAAGCAGGGCCAGGG + Intergenic
1050025603 9:1331594-1331616 CTGCTTTTGAAGCAGCTCCAAGG + Intergenic
1050058402 9:1679386-1679408 CTGGAGAGGAGGCAGCTCCAGGG + Intergenic
1052977696 9:34423649-34423671 CTGCTCTGGGAGCAGGTCCAAGG + Intronic
1053141840 9:35687498-35687520 CAGCATAGGAAGCAGGTCCTTGG + Intronic
1054852592 9:69864000-69864022 CTGTGTGAGAAGCAGGTCCATGG + Intronic
1055436594 9:76297835-76297857 CTGGAGAGGAGGCACGTCCATGG + Intronic
1055599274 9:77898470-77898492 CTGGGTTACAAGCAAGTCCATGG - Intronic
1056710815 9:88991102-88991124 CAGGCTTGGAACCAGGTCCGAGG - Exonic
1058155583 9:101511294-101511316 CTGGACTGGTAACAGGTCCTTGG - Intronic
1058711028 9:107679271-107679293 CTGACTTGGAAGCTTGTCCAAGG + Intergenic
1059287604 9:113188562-113188584 CTGTGTTGGAAGCAGGTTTAGGG - Intronic
1060395229 9:123312111-123312133 ATGGATTGGAAAGAGGTCAAAGG - Intergenic
1061231626 9:129319069-129319091 CTGCATTCGAAGCTGGTACAGGG - Intergenic
1186390539 X:9154357-9154379 CTGGATTTTAGGGAGGTCCAAGG + Intronic
1187697657 X:21937888-21937910 CTGGATTGGGAGCTGGTGCAGGG + Intergenic
1191755682 X:64590036-64590058 CAGGTAAGGAAGCAGGTCCAGGG + Intergenic
1193196608 X:78639551-78639573 CTGGAGGGGAACCAGGTCAAGGG + Intergenic
1194436683 X:93875366-93875388 TGGGATTGGAAGAAGGTCCTAGG - Intergenic
1195521793 X:105839013-105839035 CTGGATTTGAAGTTGGTGCAGGG + Intronic
1200808567 Y:7458856-7458878 CTGGAATTGAAGCAAGTGCATGG + Intergenic
1200816526 Y:7539027-7539049 ATGGATTGGGAGCAGGGTCAAGG + Intergenic
1202086142 Y:21138972-21138994 TGGGATTGGAAGAAGGTCCTAGG + Intergenic