ID: 908256226

View in Genome Browser
Species Human (GRCh38)
Location 1:62305705-62305727
Sequence ACCCTCCTGCAACACGGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 78}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908256222_908256226 -1 Left 908256222 1:62305683-62305705 CCAAGGTTCACTGGCCCTCTGAA 0: 1
1: 1
2: 1
3: 13
4: 126
Right 908256226 1:62305705-62305727 ACCCTCCTGCAACACGGTGAAGG 0: 1
1: 0
2: 0
3: 8
4: 78
908256219_908256226 22 Left 908256219 1:62305660-62305682 CCACTGTGAAAGTTATAACTCAT 0: 1
1: 0
2: 1
3: 11
4: 172
Right 908256226 1:62305705-62305727 ACCCTCCTGCAACACGGTGAAGG 0: 1
1: 0
2: 0
3: 8
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908256226 Original CRISPR ACCCTCCTGCAACACGGTGA AGG Intronic
900123594 1:1059701-1059723 ACCCTCCGGCAACTCCGCGAAGG - Intergenic
900254271 1:1689353-1689375 ACCCTCCAGCAGCACAGTCAGGG - Intronic
900263033 1:1742620-1742642 ACCCTCCAGCAGCACAGTCAGGG - Intronic
908256226 1:62305705-62305727 ACCCTCCTGCAACACGGTGAAGG + Intronic
911121584 1:94302237-94302259 TCCCTCCTGGAAGATGGTGATGG - Intergenic
919814935 1:201431284-201431306 AGCCTCCTGCAAAACAGTCATGG - Intergenic
922609140 1:226911468-226911490 GCCCACCTGCAACCTGGTGAAGG - Intronic
922649489 1:227325185-227325207 ACCCACCTGCCAGAAGGTGAAGG + Intergenic
1067997526 10:51291170-51291192 ACCCTCTTGCAAAAAGGTCAGGG - Intronic
1072158394 10:92744313-92744335 AACCTCCTGAAACCAGGTGAAGG - Intergenic
1076449120 10:130544146-130544168 AACCTCCTGCAACATGGACATGG + Intergenic
1082678355 11:56137963-56137985 AGCATCCTGCAACACTTTGAGGG + Intergenic
1089341195 11:117759114-117759136 AGCATCCTGCTACAGGGTGAGGG - Intronic
1096828190 12:54295129-54295151 ACTCACCTGCAGCTCGGTGATGG + Exonic
1097951441 12:65433600-65433622 ACCCTCCTGCTTCACTGTGATGG + Intronic
1106898651 13:34332309-34332331 ACCCTCCTGCTACAGTGTGGAGG - Intergenic
1108689694 13:52849622-52849644 ACTCTCCGGCTAAACGGTGATGG + Intergenic
1113600726 13:111566474-111566496 ACCCTCCTGCAACAGGTTCCAGG + Intergenic
1116785674 14:49285973-49285995 ACCTTCCAGCAACAATGTGACGG + Intergenic
1119582034 14:75793707-75793729 ACAATCTTGCAACACAGTGAAGG + Intronic
1122987414 14:105218900-105218922 ACCCTCCTGTCACATGGGGAAGG + Intronic
1124126897 15:26944736-26944758 ACCTTCCAGCAACACAGTGCAGG - Intronic
1126312880 15:47337035-47337057 ACACTCAGGCAACAGGGTGATGG + Intronic
1126595672 15:50382435-50382457 CCCCTCCTCCAACACTGGGAGGG - Intergenic
1132460886 16:53988-54010 ACCCTCCTGGAACACGTCCATGG - Exonic
1134247888 16:12553508-12553530 TCCCTCCTCCAGCACTGTGATGG - Intronic
1136067290 16:27767773-27767795 AAGCTCCTGCTACACGGGGAGGG - Intronic
1138922534 16:61549328-61549350 ACCCTCCTACCCCAGGGTGAGGG - Intergenic
1144633620 17:16889108-16889130 CCCCTGCTGCAACAATGTGATGG + Intergenic
1147042792 17:37731203-37731225 GCCATCCTCCAACACAGTGAGGG + Intronic
1150976344 17:70091407-70091429 ACCCTCCTCCAACACAGTGCAGG + Intronic
1151702768 17:75752256-75752278 GCCCTACCGCTACACGGTGAAGG + Exonic
1151980848 17:77507539-77507561 TCCCTCCAGGGACACGGTGATGG - Intergenic
1152169111 17:78732010-78732032 ACCCTCCTGAAGCACAGGGAGGG + Intronic
1152178421 17:78802602-78802624 ACCCGCCTGCAACATGGAGAAGG + Intronic
1153900846 18:9615197-9615219 TTCCTCGTGCAGCACGGTGAAGG + Intronic
1156298935 18:35818278-35818300 GGCCTCCTGCAACACGGAGTGGG - Intergenic
1157030020 18:43894494-43894516 ACCCTCCCACAACAAGGTGAGGG - Intergenic
1159960895 18:74555232-74555254 ACCCTCCTGCAGCAGGAGGAAGG - Intronic
1160438952 18:78874341-78874363 ACCCTTCTGCATCTCGCTGATGG - Intergenic
1166225363 19:41391859-41391881 AACCTGCAGCACCACGGTGATGG + Exonic
1166637643 19:44465058-44465080 ATCCTTCTGCCACACTGTGATGG - Intergenic
926764409 2:16311675-16311697 ATCCCACTGCACCACGGTGAGGG + Intergenic
927132782 2:20074549-20074571 ACACTCATGAAACATGGTGAGGG - Intergenic
932686017 2:73870901-73870923 ACCCTCCTACAACATGGGAAAGG - Intronic
937106946 2:119324728-119324750 CCCCTCCTGCAGCACTGAGAAGG + Intronic
943750033 2:191501350-191501372 TCCCTCCTGCCCCAGGGTGAAGG + Intergenic
1180130036 21:45821359-45821381 ACCCCCCTGCACCACGCTGTGGG + Intronic
1181640946 22:24198168-24198190 ACCACCCAGCAACATGGTGAAGG - Intergenic
1182456479 22:30454159-30454181 AGCCTCCTGCAAGATGCTGAAGG + Intronic
1183655957 22:39184845-39184867 CCACTCCTGCAGCAAGGTGATGG + Intergenic
1184580388 22:45413122-45413144 ACCCTCCTCCGACACCCTGAGGG - Intronic
957133348 3:76251279-76251301 ACCCTCCCGCAACTAGCTGAAGG - Intronic
961815965 3:129550531-129550553 ACCCTCCAGCCACTCTGTGAGGG + Intronic
962264647 3:133936213-133936235 AGCCTCCTGCCACACAGTGGAGG - Intronic
963139855 3:141938199-141938221 ACCCTGCTGCAGGACGGAGAAGG - Intergenic
964972200 3:162576705-162576727 CCCCTCCTGCAACAGCTTGAAGG - Intergenic
965595636 3:170408191-170408213 ACCCTCCTGCATGACTTTGAGGG + Intergenic
967436910 3:189457813-189457835 ACCCTCCTGCTAGACGGTTGGGG + Intergenic
967739795 3:192992526-192992548 ACACTCCTACAACACCATGACGG + Intergenic
969220288 4:5754627-5754649 ACCAGCCTGCAAGACGGTTACGG - Intronic
969534336 4:7746765-7746787 CCCCTCCTGCAACACGCTGGTGG + Intergenic
971502000 4:27328055-27328077 CCCCTCCTGTAACAGGGTGGGGG - Intergenic
985564761 5:609899-609921 CCCCTCCTGCAAGACTGTGAAGG - Intergenic
987400430 5:17469954-17469976 AAACCCCTGCAACACAGTGAAGG + Intergenic
1004289183 6:14350915-14350937 AGCATCCTGCAACAGGGTCATGG + Intergenic
1005010585 6:21331806-21331828 ACCCACCTTAAACACAGTGAGGG + Intergenic
1006411263 6:33875170-33875192 ACAGCCCTGCAGCACGGTGAGGG + Intergenic
1011002513 6:82606890-82606912 GCCCTGCTGCAGCACTGTGATGG + Intergenic
1013709501 6:112880278-112880300 ACCCTCCTGCAATACGTAGCGGG - Intergenic
1021397453 7:20167696-20167718 ACTCTCCAGCAACAGGGTCAGGG - Intronic
1029976390 7:104838645-104838667 ACCGTCTTGCAAAACAGTGACGG + Intronic
1032188370 7:129747290-129747312 TCCCTTCTGAAACACAGTGATGG - Intronic
1038363283 8:26904762-26904784 ACCCTCTTGAAAAACAGTGAAGG + Intergenic
1041960198 8:63605955-63605977 TCCCTCCTGCAAAAGGGTGATGG + Intergenic
1049430178 8:142559185-142559207 CCCCTCCTGTTAGACGGTGATGG - Intergenic
1051779864 9:20678578-20678600 GGCCTCCTGCAGCACTGTGAAGG - Intronic
1059397799 9:114049375-114049397 ACCCTGCTGGAACTCGGTGACGG + Exonic
1059565155 9:115377026-115377048 ACTCTGCTGCAACACTGTGCAGG - Intronic
1061848837 9:133402997-133403019 GCCCTCCTGCTGGACGGTGAGGG + Exonic
1062262307 9:135668971-135668993 ACCCTCCTGGAACACAGCTAGGG - Intergenic
1062268484 9:135698280-135698302 GTCCTCCGGCATCACGGTGATGG - Intronic
1190078758 X:47338541-47338563 ACCCTCTGCCAACATGGTGAGGG - Intergenic
1195228961 X:102826855-102826877 GCCCTCCTGCAACACTGGAATGG - Intergenic
1195229284 X:102829871-102829893 ACCATCCTGCAACACAGAAATGG - Intergenic
1195260194 X:103124343-103124365 ACCATCCTGCAACACAGAAATGG + Intergenic
1197170278 X:123426266-123426288 AGCCTTCAGCAACACTGTGAAGG + Intronic